Application of LINC01532 in preparation of medicine for prognosis evaluation and treatment of hepatocellular carcinoma

Abstract

The invention discloses application of long-chain non-coding RNA LINC01532 in preparation of a medicine for prognosis evaluation and treatment of hepatocellular carcinoma, the gene sequence of the long-chain non-coding RNA LINC01532 is as shown in SEQ ID NO.1, and the LINC01532 is highly expressed in hepatocellular carcinoma, is related to poor prognosis of a hepatocellular carcinoma patient and can be used as a marker for preparation of a reagent for prognosis evaluation of hepatocellular carcinoma; besides, the compound can be used as a target spot for preparing a tyrosine kinase inhibitor treatment effect evaluation reagent, the sensitivity of a drug-resistant patient to treatment of the lenvatinib is improved by interfering or inhibiting expression of LINC01532, and a new strategy is provided for diagnosis and treatment of hepatocellular carcinoma.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a long non-coding RNA LINC01532 in the preparation of a prognosis evaluation and treatment drug for hepatocellular carcinoma. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most common malignant tumors, causing more than 700,000 deaths each year, with a 5-year survival rate of less than 20%, making it the second most lethal malignant tumor in the world. The incidence of HCC is still increasing worldwide, especially in East Asia. In the early stages of diagnosis, HCC can be cured by surgical removal of the tumor or liver transplantation. However, most people do not show symptoms of HCC and are not diagnosed with HCC until the late stages, which makes the treatment of HCC more difficult. In recent years, tyrosine kinase inhibitors (TKIs) have become the first-line targeted therapeutic drugs for HCC. In August 2018, the U.S. Food and Drug Administration approved lenvatinib as a first-line drug for HCC. Compared with sorafenib, lenvatinib significantly prolonged the progression-free survival of HCC patients from 3.6 months to 7.6 months. However, drug resistance is a common phenomenon in lenvatinib treatment and an important reason for the failure of HCC treatment. Due to the ineffectiveness of lenvatinib treatment or severe side effects, the average time for patients to receive lenvatinib treatment is only 7.4 months. Therefore, the study of lenvatinib resistance mechanism is crucial for whether targeted drug treatment of HCC can make further progress.

[0003] In recent years, tumor research has focused on the metabolic disorders of tumor cells, and abnormal metabolism of tumor cells may be one of the important causes of drug resistance. It is well known that tumor cells have different metabolic characteristics, including increased aerobic glycolysis, fatty acid synthesis, and glutamine decomposition, etc., to meet the increasing demand of tumor cells for bioenergy, biosynthesis, and avoiding drug killing. Metabolic reprogramming of tumor cells is considered to be a hallmark feature of tumors. So, do HCC cells acquire lenvatinib resistance through metabolic reprogramming and what is the mechanism? This question is currently unclear. Therefore, it is of great significance to explore new metabolic-related targets that lead to lenvatinib resistance in hepatocellular carcinoma and to explore its molecular mechanism in depth. Summary of the invention

[0004] The purpose of the present invention is to address the deficiencies in the prior art in the treatment and prognosis assessment of hepatocellular carcinoma, and to provide an application of long non-coding RNA LINC01532 in the preparation of hepatocellular carcinoma prognosis assessment and treatment drugs. By detecting the expression level of LINC01532 as an indicator for the treatment, diagnosis and prognosis prediction of hepatocellular carcinoma, a new method is provided to monitor the prognosis of hepatocellular carcinoma patients.

[0005] With the improvement of high-throughput technology, long non-coding RNA (lncRNA) has attracted more and more attention from researchers. lncRNA is defined as a non-coding transcript with a length of more than 200 nucleotides. It plays an important role in cells, including tumorigenesis, progression and drug resistance. lncRNAs cause cell signaling disorders by specifically interacting with RNA, DNA and proteins.

[0006] To elucidate the mechanism of drug resistance in hepatocellular carcinoma, this project combined theoretical research and experimental methods to conduct a comprehensive analysis of lncRNAs with potential functions, screened out a long non-coding RNA closely related to the metabolic reprogramming of hepatocellular carcinoma: LINC01532, and preliminarily explored the mechanism by which LINC01532 promotes the progression and drug resistance of lenvatinib in hepatocellular carcinoma, and elaborated in detail the detailed mechanism by which LINC01532 regulates the progression and drug resistance of hepatocellular carcinoma.

[0007] Based on the above research, the technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides the use of long non-coding RNA LINC01532 as a marker in the preparation of a hepatocellular carcinoma prognosis assessment reagent, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1, and is used to prepare a tyrosine kinase inhibitor treatment effect assessment reagent.

[0009] Optionally or preferably, in the above application, the tyrosine kinase inhibitor is lenvatinib.

[0010] Optionally or preferably, in the above application, the evaluation reagent is an RT-qPCR amplification primer for detecting the expression of the long non-coding RNA LINC01532 gene.

[0011] Optionally or preferably, in the above application, the nucleotide sequence of the primer is as shown in SEQ ID NO.2-3.

[0012] In a second aspect, the present invention provides the use of shRNA that inhibits the expression of long non-coding RNA LINC01532 gene in the preparation of a drug for treating hepatocellular carcinoma, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.4-5 or SEQ ID NO.6-7.

[0013] In a third aspect, the present invention provides a drug for treating hepatocellular carcinoma, comprising shRNA that inhibits the expression of long non-coding RNA LINC01532 gene, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1.

[0014] In a fourth aspect, the present invention provides the use of shRNA that inhibits the expression of long non-coding RNA LINC01532 gene in the preparation of a drug for treating lenvatinib-resistant hepatocellular carcinoma, wherein the long non-coding RNA LINC01532 gene sequence is shown as SEQ ID NO.1, and the nucleotide sequence of the shRNA is shown as SEQ ID NO.4-5 or SEQ ID NO.6-7.

[0015] In a fifth aspect, the present invention provides a pharmaceutical composition for treating hepatocellular carcinoma, comprising lenvatinib and shRNA that inhibits the expression of long non-coding RNA LINC01532 gene, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1.

[0016] Long non-coding RNA LINC01532 nucleotide sequence (SEQ ID NO.1):

[0017]

[0018] RT-qPCR amplification primers for detecting the expression of long noncoding RNA LINC01532 gene:

[0019] LINC01532 qPCR-F: GCCTCACAGTCCAGTCTACC (SEQ ID NO.2);

[0020] LINC01532 qPCR-R: CCTTGCCCTTAAGTCACCCG (SEQ ID NO. 3).

[0021] shRNA that inhibits the expression of long noncoding RNA LINC01532 gene:

[0022] LINC01532 shRNA1 F:

[0023] CCGGGCTAAAGACTCTTGAGAAACACTCGAGGTGTTTCTCAAGAGTCT TTAGCTTTTTG(SEQ IDNO.4);

[0024] LINC01532 shRNA1 R:

[0025] AATTCAAAAAGCTAAAGACTCTTGAGAAACACTCGAGGTGTTTCTCAA GAGTCTTTAGC (SEQ ID NO. 5).

[0026] LINC01532 shRNA2 F:

[0027] CCGGCAATCACAATTCAATCCTAACCTCGAGGTTAGGATTGAATTGT GATTGTTTTTG (SEQ IDNO.6);

[0028] LINC01532 shRNA2 R:

[0029] AATTCAAAAACAATCACAATTCAATCCTAACCTCGAGGTTAGGATTG AATTGTGATTG (SEQ ID NO. 7).

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] This study found that LINC01532 has a high expression level in hepatocellular carcinoma and is associated with poor prognosis in patients with hepatocellular carcinoma, and can be used as an effective marker for the prognosis assessment of hepatocellular carcinoma. More importantly, the present invention reveals the mechanism of lenvatinib resistance in patients with hepatocellular carcinoma, that is, LINC01532 increases NADPH production by upregulating pentose phosphate pathway metabolism, leading to an imbalance in redox homeostasis, and thus leading to lenvatinib resistance. The important role of LINC01532 in hepatocellular carcinoma has been repeatedly confirmed from multiple angles. Therefore, interfering with or inhibiting the expression of LINC01532 can effectively increase the sensitivity of resistant patients to lenvatinib treatment, providing potential new targets and new strategies for the diagnosis and treatment of hepatocellular carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The results of RT-qPCR detection of LINC01532 expression in 49 cases of HCC were statistically analyzed. T represents cancer tissue and N represents paracancerous tissue.

[0033] Figure 2 The statistical results of the correlation between LINC01532 expression level and prognosis in 95 HCC patients. The left figure shows the statistical results of the correlation between LINC01532 expression level and overall survival (OS) of HCC patients. The right figure shows the statistical results of the correlation between LINC01532 expression level and progression-free survival (DFS) of HCC patients.

[0034] Figure 3 The experimental results of detecting the expression level of LINC01532 in liver cancer cells after transfection with lentivirus containing shRNA. The left figure shows the expression level of LINC01532 in Huh7 cell line, and the right figure shows the expression level of LINC01532 in MHCC97-H cell line. shNC represents liver cancer cells infected with control shRNA lentivirus, and 1 and 2 represent liver cancer cells infected with shRNA1 and shRNA2 lentivirus, respectively.

[0035] Figure 4 These are the experimental results of shRNA inhibiting the expression of LINC01532 and thus inhibiting the proliferation and metastasis of HCC cells. The upper figure shows the cell clone counting results of each group, and the lower figure shows the cell counting results of each group in the cell invasion and migration experiments.

[0036] Figure 5 The relative cell viability and IC50 results of the experiment in which shRNA inhibited the expression of LINC01532 to enhance the sensitivity of lenvatinib.

[0037] Figure 6The results of the experiment of inhibiting PPP metabolism by inhibiting the expression of LINC01532 by shRNA. The upper row from left to right shows the NADPH detection levels and GSH detection levels of cells in different groups, and the lower row shows the ROS detection levels of three groups of cells after treatment with lenvatinib. LINC01532 shRNA1 and 2 are hepatocellular carcinoma cells with knockdown of LINC01532, respectively, and shNC is the control group cells.

[0038] Figure 7 The experimental results of inhibiting PPP metabolism by affecting G6PD expression by inhibiting LINC01532 expression with shRNA. The two figures on the left are the mRNA detection levels of G6PD in three groups of cells, and the figure on the right is the protein detection levels of G6PD in three groups of cells. LINC01532 shRNA1 and 2 are hepatocellular carcinoma cells with LINC01532 knocked down, respectively, and shNC is the control group cells.

[0039] Figure 8 These are the in vivo experimental results of shRNA inhibiting LINC01532 expression and thus improving lenvatinib sensitivity. The upper left picture shows the tumor volume of mice in different groups, the upper right picture shows the statistical results of tumor volume changes in mice in different groups over time, the lower left picture shows the statistical results of tumor weights in different groups of mice, and the lower right picture shows the Oil Red O staining results in different groups of mice; LINC01532 shRNA1 and 2 are hepatocellular carcinoma cell tumorigenesis groups with LINC01532 knockdown, respectively, and shNC is the control group cell tumorigenesis group. DETAILED DESCRIPTION

[0040] In order to make the technical personnel in this field better understand the present application scheme, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the described embodiments are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work should belong to the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.

[0041] lncRNA LINC01532 consists of 1948 bases, and its nucleotide sequence is shown in SEQ ID NO. 1. RT-qPCR primer sequences for detecting LINC01532 expression were designed, and the primer base sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2.

[0042] Example 1 Expression level of LINC01532 in tissues of hepatocellular carcinoma patients

[0043] In this example, the qPCR method was used to evaluate the expression level of LINC01532 in the tested tissue. The paired sample t-test was used to explore the difference in the expression of LINC01532 in tumor tissue and adjacent normal tissue. In this case, tissue samples (including cancer tissue and adjacent normal tissue) from 49 patients diagnosed with hepatocellular carcinoma in Peking University Cancer Hospital from 2011 to 2012 were collected for analysis.

[0044] 1.1 Real-time fluorescence quantitative PCR (qPCR)

[0045] LINC01532 qPCR-F:GCCTCACAGTCCAGTCTACC(SEQ ID NO.2);

[0046] LINC01532 qPCR-R:CCTTGCCCTTAAGTCACCCG (SEQ ID NO.3);

[0047] The specific operation method of real-time fluorescence quantitative PCR (qPCR) is as follows:

[0048] 1) The PCR reaction system is as follows:

[0049]

[0050] 2) ABI 7500fast instrument was used to perform real-time PCR experiments. The specific reaction conditions were as follows: melting curve program: 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s.

[0051]

[0052] 3) Export and process the data and calculate the relative expression.

[0053] qPCR test results Figure 1 As shown in the figure, the expression level of LINC01532 in hepatocellular carcinoma tissues was significantly higher than that in adjacent adjacent tissues, indicating that LINC01532 was highly expressed in hepatocellular carcinoma.

[0054] Example 2 Relationship between LINC01532 expression level and prognosis of hepatocellular carcinoma patients

[0055] In this implementation case, the expression level of LINC01532 in tumor tissues was detected, and the relationship between LINC01532 and patient survival and prognosis was explored using Kaplan-Meier analysis. In this case, tissue samples from 95 patients diagnosed with hepatocellular carcinoma in Peking University Cancer Hospital from 2011 to 2012 were collected to detect the expression level of LINC01532 in HCC tissue samples over time.

[0056] qPCR test results Figure 2 As shown in the data, LINC01532 was lowly expressed in 25 tissues and highly expressed in 70 tissues. High levels of LINC01532 were negatively correlated with the patients' overall survival (OS) and progression-free survival (DFS), suggesting that high expression of LINC01532 may be associated with poor prognosis.

[0057] Example 3 Lentiviral drugs targeting the gene corresponding to LINC01532 can reduce the expression level of LINC01532 in hepatocellular carcinoma cells

[0058] The following two shRNAs were used to knock down LINC01532 expression.

[0059] LINC01532 shRNA1 F:

[0060] CCGGGCTAAAGACTCTTGAGAAACACTCGAGGTGTTTCTCAAGAGTCT TTAGCTTTTTG,

[0061] LINC01532 shRNA1 R:

[0062] AATTCAAAAAGCTAAAGACTCTTGAGAAACACTCGAGGTGTTTCTCAAGA GTCTTTAGC.

[0063] LINC01532 shRNA2 F:

[0064] CCGGCAATCACAATTCAATCCTAACCTCGAGGTTAGGATTGAATTGTGA TTGTTTTTG,

[0065] LINC01532 shRNA2 R:

[0066] AATTCAAAAACAATCACAATTCAATCCTAACCTCGAGGTTAGGATTGAA TTGTGATTG.

[0067] At the same time, set the control gene and use the corresponding shRNA control gene.

[0068] 3.1 Construction of stable cell lines with LINC01532 knockdown

[0069] First, construct a lentiviral expression vector plasmid, then use 293T cells to package the lentivirus, and then use the lentivirus to infect hepatocellular carcinoma cell lines (Huh7, MHCC97-H) to construct a stable cell line, and finally use qPCR to detect the knockdown efficiency. The specific method is as follows:

[0070] The experiment was divided into three groups: LINC01532 shRNA1 group, LINC01532 shRNA2 group and control group. The corresponding target plasmids were three kinds. The first group contained LINC01532 shRNA1 described in Example 3, the second group contained LINC01532 shRNA2 described in Example 3, and the third group was a control group containing control shRNA. The other experimental conditions and operations were the same among the three groups. Two types of hepatocellular carcinoma cells were used, namely Huh7 cells and MHCC97-H cells.

[0071] 1) Lentiviral packaging:

[0072] a) HEK 293T cells were evenly plated in a culture dish and cultured overnight at 37°C under 5% CO2.

[0073] b) Mix 1 μg of pLKO.1 shRNA plasmid, 750 ng of psPAX2 and 250 ng of pMD2.G packaging plasmid, and add an appropriate amount of serum-free OPTI-MEM to a total volume of 20 μl; mix 6 ul of PEI with 74 μL of OPTI-MEM; mix the two tubes of liquid thoroughly and incubate at room temperature for 20 minutes. Carefully add the transfection MIX to the HEK 293T cell culture medium and incubate for 12-15 hours.

[0074] c) After overnight, the culture medium was replaced, the transfection reagent was removed, and the virus solution was collected after 24 hours. Fresh culture medium was added again, and the virus solution was collected again after 24 hours. The virus solutions collected twice were mixed.

[0075] d) Centrifuge the culture medium at 1250 rpm for 5 minutes to remove the HEK-293T cells in the virus liquid and store the virus liquid at -80°C.

[0076] 2) Lentivirus infection of cells:

[0077] Hepatocellular carcinoma cells were evenly spread on a culture dish to a density of 70%, and the virus solution containing 8 μg / ml polybrene was replaced. 24 hours after infection, the culture medium containing puromycin was replaced for screening.

[0078] 3) Detection of knockdown efficiency:

[0079] The expression of LINC01532 in hepatocellular carcinoma cells was detected by qPCR, and the knockdown efficiency was calculated based on the control shRNA group.

[0080] The results are as follows Figure 3 As shown, the expression level of LINC01532 was significantly reduced in the LINC01532 stable knockdown cell lines (Huh7, MHCC97-H), indicating that the stable cell line with LINC01532 knockdown was successfully constructed.

[0081] Example 4 shRNA inhibits the expression of LINC01532 and thus inhibits the proliferation and metastasis of HCC cells

[0082] 4.1 Colony formation counting

[0083] 1) Take cells in the logarithmic growth phase, digest them, resuspend them, and try to disperse them into single cells by pipetting.

[0084] 2) Add 10 3 The cells were mixed by gentle pipetting and placed in a cell culture incubator at 37°C and 5% CO2.

[0085] 3) After 10-14 days, terminate the culture. Discard the supernatant and wash twice with PBS. Add 2 ml of paraformaldehyde to fix the cells for 15 minutes. Remove the fixative and add an appropriate amount of crystal violet staining solution for 20 minutes, then slowly wash away the staining solution with running water and place in air to dry.

[0086] 4) Count the number of colonies under a microscope.

[0087] 4.2 Transwell experiment

[0088] All experiments used 8μM transwell chambers (Corning Co., Ltd., USA). In the cell invasion experiment, Matrigel was added to the chamber. HCC cells were cultured overnight under starvation conditions and then resuspended in serum-free medium. The cells were seeded in the transwell chamber, and 600μL of medium containing 10% fetal bovine serum was added to the lower chamber. After incubation for about 24h, the invaded or migrated cells were fixed and stained with crystal violet. The cells in all images were counted under a microscope.

[0089] The experimental results can be found in Figure 4 , Figure 4 The upper left figure shows the photos of three groups of cells under a microscope, and the upper right figure shows the statistical results of the number of clones of three groups of cells under a microscope. It can be seen that the number of clones formed by hepatocellular carcinoma cells with stable knockdown of LINC01532 (LINC01532shRNA1, 2 in the upper left figure, and LINC01532-1, 2 in the upper right figure) is significantly reduced. Figure 4The lower left is a photo of the three groups of cells under the Transwell experiment microscope, and the lower right is the statistical results of the cell number of the three groups of cells in the Transwell experiment. It can be seen that the number of invasive and migrating cells in the hepatocellular carcinoma cells with stable knockdown of LINC01532 (LINC01532 shRNA1, 2 in the lower left figure, and LINC01532-1, 2 in the lower right figure) is significantly reduced compared with the control group (shNC), indicating that shRNA inhibits the expression of LINC01532 and thus inhibits the proliferation and metastasis of HCC cells.

[0090] Example 5: shRNA inhibits the expression of LINC01532 and enhances lenvatinib sensitivity

[0091] 5.1 Determination of drug IC50 curve

[0092] 1) Digest and resuspend the cells in the logarithmic growth phase and add 8×10 3 Cells were placed in a 37°C, 5% CO2 cell culture incubator overnight. This experiment involved two groups of cells, the LINC01532shRNA1 group and the control group.

[0093] 2) After the cells adhered, different concentrations of lenvatinib were configured according to the experimental design, with at least 3 replicate wells for each concentration. In addition, a blank control group and a DMSO control group were set up, and different concentrations of lenvatinib solutions were added to a 96-well plate.

[0094] 3) After 72 hours, the culture medium in the 96-well plate was aspirated, and the plate was protected from light. A culture medium containing 10% CCK-8 reagent (Yeasen Biotechnology Co., Ltd., China) was added to each well, and the plate was incubated in an incubator for 3 hours.

[0095] 4) Measure the absorbance at 450 nm using an enzyme-labeled instrument and calculate the relative cell survival rate in each well.

[0096] The results are as follows Figure 5 As shown, the IC50 of Huh7 cells and MHCC97-H in the shRNA1 group were 1.063μM and 47.62μM, respectively, while the corresponding IC50 of the two cells in the control group were 1.582μM and 57.77μM, respectively. Under the same concentration of lenvatinib treatment, the survival rate of hepatocellular carcinoma cells with stable knockdown of LINC01532 was lower than that of the control group; the IC50 was significantly lower than that of the control group, indicating that shRNA inhibited the expression of LINC01532 and thus enhanced the sensitivity of lenvatinib.

[0097] Example 6: shRNA inhibits the expression of LINC01532 and inhibits PPP metabolism

[0098] One of the important products of the pentose phosphate pathway is NADPH. NADPH not only serves as a hydrogen donor in the cell to maintain the reduced state of glutathione (GSH), but also can serve as a reducing substance to eliminate reactive oxygen species (ROS). Therefore, the following experiments were conducted in this implementation case:

[0099] 6.1 NADPH level detection

[0100] The NADP+ / NADPH kit (Beyotime Biotechnology Co., Ltd., China) was used for detection. Three groups of cells, LINC01532 shRNA1 group, LINC01532 shRNA2 group and control group, were collected, the extract was added to the cells, and the supernatant was taken as the sample. The samples were incubated at 60°C for 30 minutes to remove NADP+, and then the samples were cooled on ice. The samples and standards were added to the wells of the detection plate, and then the reaction solution was added, mixed and placed at room temperature for 5 minutes. NADPH luminescent reagent was added, and after 1-4 hours of reaction, the NADPH content was detected using an enzyme reader.

[0101] 6.2 Detection of reduced glutathione levels

[0102] The reduced glutathione (GSH) content detection kit (Solarbio Life Science Co., Ltd., China) was used for the operation. The cells of LINC01532 shRNA1 group, LINC01532 shRNA2 group and control group were collected, and the cells were lysed by ultrasonication. An equal amount of DTNB reagent was added and mixed, and then the mixture was allowed to stand at room temperature for 2 minutes. The absorbance was measured by an ELISA instrument, and the intracellular GSH content was determined according to the standard curve.

[0103] 6.3 Flow cytometry detection of ROS levels

[0104] The cells of LINC01532 shRNA1 group, LINC01532 shRNA2 group and control group were seeded in 6-well plates, with 5×10 5 cells. After the cells adhered, the cells were treated with the same concentration of lenvatinib for 24 hours. After 24 hours, 10mM DCFH-DA (Beyotime Biotechnology Co., Ltd., China) was added and incubated at 37°C in the dark for 20 minutes. Subsequently, serum-free cell culture medium was added to the cells for washing, the cells were trypsinized, and the cells were resuspended in PBS. The samples were detected by flow cytometry, and the data were processed and analyzed using Flow-Jo software.

[0105] The results are as follows Figure 6 The NADPH level and GSH level of hepatocellular carcinoma cells with stable knockdown of LINC01532 were significantly reduced; after lenvatinib treatment, the ROS level of hepatocellular carcinoma cells with stable knockdown of LINC01532 was significantly increased, indicating that shRNA inhibited the expression of LINC01532 and thus inhibited PPP metabolism.

[0106] Example 7 LINC01532-shRNA inhibits PPP metabolism by affecting G6PD expression

[0107] In this embodiment, qPCR and protein immunoblotting experiments were used to detect the expression of G6PD in hepatocellular carcinoma cells.

[0108] 7.1 Protein immunoblotting

[0109] 1) Glue preparation

[0110] a) Wash the glass plate and dry it for later use. Prepare the separation gel with appropriate concentration according to the size of protein molecules.

[0111] b) Slowly add separation gel and press the gel with isopropanol, leaving it for 20 minutes until a clear refraction line is visible to the naked eye at the junction of anhydrous ethanol and separation gel.

[0112] c) Aspirate the isopropanol and add concentrated gel until full. Insert the comb vertically into the concentrated gel and let it stand at room temperature until it is completely solidified.

[0113] 2) Sample loading and SDS-polyacrylamide gel electrophoresis

[0114] a) Sample loading: Mix the protein sample with 5× SDS buffer by pipetting and slowly add the same amount of protein sample to each well. Add 5uL of prestained protein marker to one side of the sample.

[0115] b) Electrophoresis: Cover the electrophoresis tank with the black and red electrodes. Adjust the voltage, concentrated gel: 80V, after the concentrated gel is finished, adjust the voltage to 120V, and continue electrophoresis until the bromophenol blue indicator line approaches the bottom edge of the separation gel.

[0116] 3) Transfer

[0117] a) Peel the gel off the glass plate and remove the bromophenol blue at the bottom of the concentrated gel and the separation gel. Put the rack together and fix it in the order of 2 layers of sponge - 3 layers of filter paper - separation gel - nitrocellulose membrane - 3 layers of filter paper - 2 layers of sponge.

[0118] b) Place the "sandwich" in the transfer solution tank, cover the lid with the black and red electrodes, apply 80V for 2h, and transfer in an ice water bath.

[0119] 4) Blocking, antibody incubation and development

[0120] a) Prepare blocking solution, place the nitrocellulose membrane in the blocking solution, and block at room temperature for 1 hour. Blocking solution: 2.5g milk powder + 50mL PBST.

[0121] b) Primary antibody incubation: dilute the primary antibody to an appropriate concentration using blocking buffer and incubate at room temperature for 1 h.

[0122] c) Wash the membrane three times with PBST, replacing the solution with fresh one each time for 10 min / time.

[0123] d) Secondary antibody incubation: dilute the secondary antibody in blocking solution and incubate at room temperature for 1 hour.

[0124] e) Wash the membrane three times with PBST, changing the solution each time for 10 min each time.

[0125] f) Development and imaging: Place the nitrocellulose membrane on the luminescent plate, take equal amounts of ECL super-sensitive luminescent liquid A and B, mix thoroughly and drop evenly onto the membrane, and develop in a darkroom.

[0126] In the pentose phosphate pathway metabolism, G6PD is a key enzyme that determines the speed of metabolic reactions. Figure 7 As shown in the figure, the mRNA and protein levels of G6PD in hepatocellular carcinoma cells with stable knockdown of LINC01532 were significantly reduced, indicating that LINC01532-shRNA inhibits PPP metabolism by affecting G6PD expression.

[0127] Example 8 shRNA inhibition promotes lenvatinib sensitivity in hepatocellular carcinoma cells in vivo

[0128] 8.1 Cell line-derived xenograft tumor models

[0129] BALB / c female nude mice (4-6 weeks old) were used. The mice were randomly divided into six groups (n=6, including LINC01532-control shRNA group, LINC01532 shRNA1 group, LINC01532 shRNA2 group, LINC01532-control shRNA+lenvatinib group, LINC01532 shRNA1+lenvatinib group, and LINC01532 shRNA2+lenvatinib group). 5×10 6The cells were resuspended in 200 μL PBS and injected subcutaneously into the armpit of the mouse under SPF environment. Two weeks later, the three groups of mice were given lenvatinib (10 mg / kg, once a day) by gavage for 12 consecutive days. During this period, the tumor volume of the mice was measured and recorded every 2 days. After the administration, the mice were killed and the volume and weight of the subcutaneous tumor were recorded. The volume was calculated using the formula V = (short diameter 2 × long diameter) / 2.

[0130] 8.2 Oil Red O staining of frozen sections

[0131] The exfoliated subcutaneous tumor was made into frozen sections, fixed with 4% paraformaldehyde, washed twice with distilled water, and soaked in 60% isopropanol for 30 seconds. The sections were stained with Oil Red O staining solution (Solarbio Life Science Co., Ltd., China). After 15 minutes, the staining solution was discarded and the sections were rinsed with 60% isopropanol. The cell nuclei were then restained with hematoxylin staining solution for 2 minutes. After rinsing, the sections were sealed and observed. The results were analyzed using Image J analysis software.

[0132] The results are as follows Figure 8 As shown, the appearance photos of cell line-derived xenograft tumors are shown in the figure. The tumor volume change curve was drawn according to the measurement records and the tumor weight after peeling was recorded. Compared with the control group, the xenograft tumors in the LINC01532 knockdown group were significantly smaller and had lower tumor weights. Oil red O staining showed that compared with the control group, LINC01532 knockdown reduced cellular lipid accumulation, indicating that shRNA inhibition inhibited tumor proliferation and PPP metabolism in vivo; when lenvatinib was administered, compared with the control group, the xenograft tumors in the LINC01532 knockdown group were significantly smaller and had lower tumor weights, indicating that shRNA inhibition promoted the killing effect of lenvatinib on hepatocellular carcinoma cells in vivo, making hepatocellular carcinoma cells more sensitive to lemvatinib.

[0133] The invention concept is described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the core idea of ​​the invention. It should be pointed out that any obvious modification, equivalent substitution or other improvement made by a person of ordinary skill in the art without departing from the invention concept should be included in the protection scope of the present invention.

Claims

1. Use of long non-coding RNA LINC01532 as a marker in the preparation of a prognosis assessment reagent for hepatocellular carcinoma, characterized in that: The long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1 and is used to prepare a reagent for evaluating the therapeutic effect of tyrosine kinase inhibitors.

2. The use according to claim 1, characterized in that: The tyrosine kinase inhibitor is lenvatinib.

3. The use according to claim 2, characterized in that: The evaluation reagent is an RT-qPCR amplification primer for detecting the expression of the long non-coding RNA LINC01532 gene.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the primer is shown in SEQ ID NO.2-3.

5. Use of shRNA that inhibits the expression of long non-coding RNA LINC01532 gene in the preparation of a drug for treating hepatocellular carcinoma, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.4-5 or SEQ ID NO.6-7.

6. A drug for treating hepatocellular carcinoma, characterized in that: It comprises shRNA for inhibiting the expression of long chain non-coding RNA LINC01532 gene, and the gene sequence of the long chain non-coding RNA LINC01532 is shown as SEQ ID NO.

1.

7. Use of shRNA that inhibits the expression of long non-coding RNA LINC01532 gene in the preparation of a drug for treating lenvatinib-resistant hepatocellular carcinoma, wherein the long non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.4-5 or SEQ ID NO.6-7.

8. A pharmaceutical composition for treating hepatocellular carcinoma, characterized in that: It includes lenvatinib and shRNA that inhibits the expression of long-chain non-coding RNA LINC01532 gene, and the long-chain non-coding RNA LINC01532 gene sequence is shown in SEQ ID NO.1.

Images