Nanoparticles with targeting function as well as preparation method and application thereof

Abstract

The invention discloses nanoparticles with a targeting function as well as a preparation method and application thereof, and relates to the technical field of medicines. The nano-particle has a core-shell structure, the surface of the nano-particle is loaded with alkannin and derivatives thereof, and the outside of the shell layer is coupled with a nucleic acid aptamer. The prepared nanoparticles have excellent targeting property, have no toxic effect on HUVEC cells, have good biocompatibility, can inhibit proliferation of tumor cells and promote apoptosis of the tumor cells, and have excellent glutathione (GSH) response performance; the nanoparticles and the aptamer are coupled to deliver the shikonin and the derivative of the shikonin in a targeted manner, so that tumors can be accurately treated; the preparation method is simple, convenient and easy to operate, and a strategy is provided for development of high-efficiency and low-toxicity innovative targeted drugs and precise treatment of tumors.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to a nanoparticle with targeting function and a preparation method and application thereof. Background Art

[0002] Shikonin (SK) is a naphthoquinone active ingredient derived from the traditional Chinese medicinal plant Lithospermum officinale. Shikonin and its derivatives have multiple biological functions such as anti-tumor, anti-inflammatory, anti-allergic, and immunomodulatory. It has been shown to be able to initiate the immunogenic cell death (ICD) program of cancer cells by inducing endoplasmic reticulum stress and ROS production, promote dendritic cell (DC) maturation and increase the infiltration of immunogenic cytokines into tumors, thereby inducing a strong immune response. However, the poor bioavailability and lesion tissue targeting of SK severely limit its potential to be developed as a clinical therapeutic drug. Therefore, how to improve the bioavailability of SK and enhance its ability to target tumors is the key to treating clinical problems in tumors.

[0003] Aptamers, also known as "chemical antibodies", can recognize target molecules with high affinity and specificity, selectively deliver cytotoxic drugs to tumor cells, and reduce toxic side effects while increasing tumor lethality, which has a good application prospect in tumor treatment. Based on this, the search for innovative targeted drugs with high efficiency and low toxicity and the development of breakthrough biological treatment methods have become research hotspots in the fight against tumors. How to construct a tumor-targeted aptamer-coupled nano-drug delivery system may be an important strategy to achieve precision tumor treatment.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide a nanoparticle with targeting function and a preparation method and application thereof to solve the above technical problems.

[0006] The present invention is achieved in that:

[0007] In a first aspect, an embodiment of the present invention provides a nanoparticle with a targeting function, wherein the nanoparticle has a core-shell structure, and the surface of the nanoparticle is loaded with shikonin and its derivatives; a nucleic acid aptamer is coupled to the outer shell of the nanoparticle, and the nucleic acid aptamer is selected from aptamer S30 and / or AS1411, and the nucleotide sequence of aptamer S301 is shown in SEQ ID NO: 1 and the nucleotide sequence of aptamer AS1411 is shown in SEQ ID NO: 2;

[0008] The shell material of the nanoparticles includes a GSH-responsive shell material.

[0009] In a second aspect, an embodiment of the present invention provides a method for preparing the aforementioned nanoparticles, the method comprising the following steps:

[0010] The GSH-responsive shell material, shikonin and its derivatives and PEG are mixed and reacted under vacuum to obtain a core-shell structure with shikonin and its derivatives loaded on the surface;

[0011] The core-shell structure of shikonin and its derivatives loaded on the surface and the nucleic acid aptamer are mixed and reacted under vacuum to prepare nanoparticles.

[0012] In a third aspect, an embodiment of the present invention provides a pharmaceutical composition comprising the aforementioned nanoparticles.

[0013] In a fourth aspect, an embodiment of the present invention provides an application of the aforementioned nanoparticles in the preparation of a drug for treating tumors, wherein the tumors include at least one of leukemia, breast cancer, colorectal cancer, lung cancer, liver cancer, glioma, lymphoma and melanoma; wherein the leukemia is selected from any one of acute lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia, preferably acute myeloid leukemia.

[0014] The present invention has the following beneficial effects:

[0015] The nanoparticles with targeting function provided by the embodiments of the present invention have a core-shell structure, and the surface of the nanoparticles is loaded with shikonin and its derivatives; the shell layer of the nanoparticles is coupled with a nucleic acid aptamer; the prepared nanoparticles have excellent targeting, are non-toxic to HUVEC cells, and have good biocompatibility. At the same time, the nanoparticles can inhibit tumor cell proliferation and promote tumor cell apoptosis, and have a potential effect in treating tumors; in addition, the nanoparticles have excellent glutathione (GSH) response performance, and the targeted delivery of shikonin and its derivatives coupled with nucleic acid aptamers can accurately treat tumors, and the preparation method is simple and easy to operate, providing a strategy for the development of innovative targeted drugs with high efficiency and low toxicity and the realization of accurate treatment of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0017] Figure 1 Schematic diagram of the mechanism of the preparation process of nanoparticles S30-PEG-PDA@SK;

[0018] Figure 2 The test pictures of different nanoparticles, where (A) is the transmission electron microscopy (TEM) image of S30-PEG-PEDA@SK nanoparticles; (B) is the average particle size of S30-PEG-PDA@SK; (C) is the Zeta potential of S30-PEG-PDA@SK in water;

[0019] Figure 3 FTIR spectra of PDA, SK and S30-PEG-PDA@SK;

[0020] Figure 4 Screening of the coupling ratio of S30 and PEG-PDA@SK in Example 1;

[0021] Figure 5 The response of S30-PEG-PDA@SK under GSH at different time periods;

[0022] Figure 6 Cumulative release curves of SK in S30-PEG-PDA@SK: (A) Release curves of SK in different dissolution media (PBS group, H2O2 group and GSH group) at pH 5.4; (B) Release curves of SK in PBS group with different pH values;

[0023] Figure 7 The stability of particle size of S30-PEG-PDA@SK in PBS (A) and the stability of potential (B);

[0024] Figure 8 To investigate the anti-tumor effects of different nanoparticles in vitro: (A) In vitro biocompatibility study of PDA particles with different concentrations; (B) Evaluation of the cytotoxicity of shikonin (SK) at different concentrations on HL-60 cells at different times; (C) Evaluation of the cytotoxicity of shikonin and different nanoparticles made of shikonin on HL-60 cells;

[0025] Fig. 9 The Calcein / PI cell activity and cytotoxicity of PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK on HL-60 cells were detected;

[0026] Fig.10 The study of the apoptosis-inducing effects of PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK on HL-60 cells: (A) flow cytometry apoptosis scatter plot; (B) quantification of apoptosis percentage;

[0027] Fig.11The targeting effects of free Dil, PDA@Dil, S30-PDA@Dil, PEG-PDA@Dil, and S30-PEG-PDA@Dil on HL-60 cells;

[0028] Fig.12 The toxicity evaluation results of different concentrations of SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK on cells: (A) 4T1 cells, (B) CT26 cells; (C) the toxicity evaluation results of different concentrations of ASK, PDA@ASK, PEG-PDA@ASK, and S30-PEG-PDA@ASK on cells. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0030] In a first aspect, an embodiment of the present invention provides a nanoparticle with a targeting function, wherein the nanoparticle has a core-shell structure, and the surface of the nanoparticle is loaded with shikonin and its derivatives; a nucleic acid aptamer is coupled to the outer shell of the nanoparticle, and the nucleic acid aptamer is selected from aptamer S30 and / or AS1411, and the nucleotide sequence of aptamer S30 is shown in SEQ ID NO: 1 and the nucleotide sequence of aptamer AS1411 is shown in SEQ ID NO: 2;

[0031] The shell material of the nanoparticles includes a GSH-responsive shell material.

[0032] Specifically, the sequence of SEQ ID NO: 1 is: TACCAGTGCGATGCTCAGCACGCTTATGGGGCTGGACACCCCTTCTAC CCAGCCTTTTCTGACGCATTCGGTTG; and the sequence of SEQ ID NO: 2 is TTGGTGGTGGTGGTTGTGGTGGTGGTGG.

[0033] It should be noted that GSH-responsive materials usually have good biocompatibility; they can respond to the high GSH microenvironment of the tumor and increase the concentration of the drug in the lesion site, thereby improving the therapeutic effect and reducing side effects; GSH-responsive materials can release drugs or other active substances according to the concentration changes of glutathione (GSH), thereby achieving the treatment and diagnosis of the disease; they can achieve the slow release of drugs, thereby prolonging the drug's action time. This sustained release function is particularly important for situations that require long-term treatment.

[0034] The nanoparticles provided in the embodiments of the present invention improve the bioavailability of shikonin (SK) and enhance its ability to target tumors, providing a strategy for the development of innovative targeted drugs with high efficiency and low toxicity and for achieving precise treatment of tumors.

[0035] Nucleic acid aptamers are a segment of DNA, RNA or nucleic acid analog sequences that have a specific recognition function similar to that of antibodies. They can specifically recognize inorganic ions, small organic molecules, peptides, proteins, bacteria, viruses and cells. They are widely used in the medical field. They mainly achieve precise tumor treatment by specifically binding to target molecules.

[0036] In a preferred embodiment of the present invention, the nucleic acid aptamer used is S30.

[0037] In an optional embodiment of the present invention, the shell material of the nanoparticle further comprises PEG, and PEG is selected from any one of DSPE-PEG, mPEG and hydroxylated PEG derivatives; and the GSH responsive material comprises polydopamine.

[0038] Furthermore, the molar ratio of PEG to polydopamine is 1:(9-11), which can be specifically selected from any one of 1:9, 1:9.5, 1:10, 1:11, or other values ​​within the range of 1:(9-11).

[0039] It should be noted that the PEG used in the embodiment of the present invention is an amphiphilic structure, and its main feature is that they have both hydrophilicity and lipophilicity, and this characteristic enables them to self-assemble in solution to form specific supramolecular ordered aggregates, which are amphiphilic polymers. The self-assembly behavior of amphiphilic polymers in selective solvents is related to various factors, the most basic of which is the structure, composition and molecular weight of the polymer. Different hydrophobic segments in amphiphilic polymers will lead to differences in their self-assembly behavior. For graft copolymers, the molecular weight of the backbone polymer also has a certain influence on the self-assembly behavior of the polymer. When the amphiphilic polymer contains crystalline segments, crystallization also plays an important role in the self-assembly process of the molecule. Adjusting the crystallinity of the polymer segment can adjust the performance of the self-assembly to form an aggregate, so that it has special uses, such as drug carriers, etc. It is necessary to make a reasonable selection according to actual needs.

[0040] Among them, DSPE-PEG is a commonly used drug carrier material. Through its stable structure and composition, it can achieve targeted delivery and efficient utilization of drugs. DSPE-PEG, namely methoxypolyethylene glycol-distearoylphosphatidylethanolamine, provides many advantages for drug delivery systems by combining the properties of polyethylene glycol (PEG) and phospholipids; the polypeptide part in its structure can also achieve targeting to specific cells by binding to specific receptors; in addition, PEG has good biocompatibility, which can reduce the immunogenicity of compounds and reduce toxic effects on organisms.

[0041] mPEG is widely used, mainly in the fields of drug delivery, cell imaging and biosensors. The good water solubility of mPEG makes its distribution and metabolism in the body more efficient; at the same time, mPEG has good biocompatibility and can reduce toxic reactions to organisms. In addition, mPEG can also achieve targeted delivery to cells or tissues by combining with specific targeting molecules, thereby improving the targeting and effectiveness of drugs.

[0042] The molecular structure of hydroxylated PEG derivatives usually contains hydroxyl (-OH) and polyethylene glycol (PEG) parts. This structure not only increases the water solubility of the compound, but also improves its ability to bind to biological molecules. In addition, hydroxylated PEG derivatives usually have good biocompatibility and can reduce rejection and immune responses. These characteristics make them widely used in the biomedical field.

[0043] In an optional embodiment of the present invention, shikonin and its derivatives are selected from any one of shikonin, acetylshikonin, isovalerylshikonin, β-hydroxyisovalerylshikonin, methacryloylshikonin, indoleylshikonin, furanoic acid shikonin, benzenesulfonamideshikonin and isobutyrylshikonin. Specifically, the shikonin and its derivatives selected in the embodiments of the present invention are shikonin and acetylshikonin. In other embodiments of the present invention, the specific use type can be reasonably adjusted according to actual conditions.

[0044] In an optional embodiment of the present invention, the molar ratio of the core-shell structure loaded with shikonin and its derivatives to the nucleic acid aptamer is 6:(0.05-1); further 6:(0.5-1), specifically any one of 6:0.5, 6:0.8, 6:1, or other values ​​within the range of 6:(0.5-1).

[0045] In an optional embodiment of the present invention, the average particle size of the nanoparticles is 218 nm±22.51 nm.

[0046] It should be noted that particle size affects the physical stability, solubility, dissolution rate, bioavailability and targeting of nanoparticles. Generally speaking, smaller particles have a higher surface area to volume ratio, resulting in higher solubility and faster dissolution rate. Smaller particles also have a longer circulation time in the bloodstream, and have enhanced permeability and retention in tumor tissues. However, smaller particles may also have a higher tendency to aggregate and a lower loading capacity. Nanoparticles of appropriate particle size are conducive to the dispersion and delivery of drugs.

[0047] In a second aspect, an embodiment of the present invention provides a method for preparing the aforementioned nanoparticles, the method comprising the following steps:

[0048] The GSH-responsive shell material, shikonin and its derivatives and PEG are mixed and reacted under vacuum to obtain a core-shell structure with shikonin and its derivatives loaded on the surface;

[0049] The core-shell structure of shikonin and its derivatives loaded on the surface and the nucleic acid aptamer are mixed and reacted under vacuum to prepare nanoparticles.

[0050] In an optional embodiment of the present invention, the mass ratio of the GSH-responsive shell material, shikonin and its derivatives and PEG is 4:(4-8):(2-4); wherein the preparation of the GSH-responsive shell material comprises: mixing dopamine hydrochloride and the first mixed solution, reacting at room temperature for 8h-12h, to obtain the GSH-responsive shell material; the dosage ratio of dopamine hydrochloride and the first mixed solution is (1-2.5) mg:(50-55) μL.

[0051] Furthermore, the dosage ratio of dopamine hydrochloride to the first mixed solution can be selected from any one of 1.5 mg:53 μL, 1.8 mg:55 μL, 2 mg:52 μL, 2.4 mg:54 μL, or other values ​​within the range of (1-2.5) mg:(50-55) μL.

[0052] It should be noted that the preparation of the GSH-responsive shell material is carried out at room temperature, and the reaction time is reasonably set according to the actual amount of raw materials; further, the reaction time is 12 hours, and after the reaction, the product is centrifuged at 10000rpm / min-120000rpm / min for 15min-20min to obtain the GSH-responsive shell material. In addition, strict control of the reaction time is conducive to the formation of polydopamine with a suitable particle size; if the reaction time is too long, the particle size will become larger, and if the time is insufficient, a good polymerization cannot be formed.

[0053] Specifically, an alkaline solution is added to an alcohol solution to prepare a first mixed solution, and then an aqueous solution of dopamine hydrochloride is added to the first mixed solution for blending to prepare a GSH-responsive shell material, which is denoted as PDA.

[0054] In an optional embodiment of the present invention, the first mixed solution includes water, alcohol solution and alkaline solution in a volume ratio of 9:4:(0.1-0.4).

[0055] Furthermore, the volumes of water, alcohol solution and alkali solution are 9:4:0.2.

[0056] Further, the alcohol solution is ethanol, and the alkaline solution is selected from any one of ammonia water, Tris-HCl buffer, triethanolamine and sodium hydroxide solution, wherein the pH of Tris-HC buffer is 8.5. Further, the alkaline solution is ammonia water.

[0057] It should be noted that the alkaline solution is mainly used to provide an alkaline environment to facilitate the generation of polydopamine from dopamine hydrochloride through an oxidative polymerization reaction; in other embodiments of the present invention, other reasonable alkaline solutions can be selected for the reaction according to actual needs.

[0058] The prepared GSH-responsive shell material is dispersed in water, shikonin and its derivatives and PEG are dispersed in an ethanol solution, and then they are blended to prepare a core-shell structure with shikonin and its derivatives loaded on the surface.

[0059] Furthermore, the mass ratio of the GSH-responsive shell material, shikonin and its derivatives, and PEG is 4:8:4.

[0060] It should be noted that the reaction was carried out at room temperature and vacuum conditions for 8h-12h. After the reaction was completed, the mixture was centrifuged and freeze-dried to prepare a core-shell structure with shikonin and its derivatives loaded on the surface, which was recorded as PEG-PDA@SK.

[0061] Centrifugal treatment can facilitate rapid sedimentation of the product. Freeze-drying is beneficial to the formation of a porous structure of the material on the one hand, and can prevent the product from decomposing and deteriorating due to high heat on the other hand. The aqueous solution in the product is freeze-dried to convert it into a dry powder for easy storage.

[0062] In an optional embodiment of the present invention, the nanoparticles are prepared by reacting for 6 h to 12 h under vacuum conditions.

[0063] It should be noted that strict control of the reaction time is conducive to the formation of core-shell structures and nanoparticles of appropriate particle size; if the reaction time is too long, the particle size will become larger, and if the time is insufficient, particles of appropriate particle size cannot be formed.

[0064] In an optional embodiment of the present invention, the preparation of the nanoparticles also includes a coupling agent, which includes 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) in a molar ratio of (0.8-1):(3-5).

[0065] Furthermore, the molar ratio of 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) to N-hydroxysuccinimide (NHS) is 0.1:4.

[0066] It should be noted that the introduction of the coupling agent is to activate the core-shell structure or the groups on the surface of the nucleic acid aptamer to facilitate better coupling with each other. In addition, the coupling agent can also promote the reaction rate and enhance the reaction effect.

[0067] In an optional embodiment of the present invention, the mass ratio of the core-shell structure of shikonin and its derivatives loaded on the surface to the coupling agent is 5:(2-5).

[0068] Specifically, the mass ratio of the core-shell structure loaded with shikonin and its derivatives and the coupling agent can be selected from any one of 5:2, 5:3.5, 5:4 and 5:5, or other values ​​within the range of 5:(2-5).

[0069] It should be noted that the core-shell structure of shikonin and its derivatives loaded on the surface, nucleic acid aptamer, and coupling agent were dispersed in water respectively, mixed and reacted at room temperature under vacuum conditions, and after 6h-12h of reaction, nanoparticles were obtained after centrifugation, which were recorded as S30-PEG-PDA@SK.

[0070] In a third aspect, an embodiment of the present invention provides a pharmaceutical composition comprising the aforementioned nanoparticles.

[0071] In a fourth aspect, an embodiment of the present invention provides an application of the aforementioned nanoparticles in the preparation of a drug for treating tumors, wherein the tumors include at least one of leukemia, breast cancer, colorectal cancer, lung cancer, liver cancer, glioma, lymphoma and melanoma; wherein the leukemia is selected from any one of acute lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia, preferably acute myeloid leukemia.

[0072] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0073] Example 1

[0074] This embodiment provides a nanoparticle with targeting function, and the preparation method thereof comprises the following steps:

[0075] (1) Synthesis of GSH-responsive material (PDA).

[0076] 0.3 mL of aqueous ammonia was added to a mixture of 4 mL of ethanol and 10 mL of pure water, and the mixture was stirred at room temperature for 0.5 h to prepare a first mixed solution.

[0077] 25 mg of dopamine hydrochloride was dissolved in 500 μL of pure water and then dropped into the first mixed solution system. After reacting at room temperature for 12 h, high-speed centrifugation was used to centrifuge at 12000 rpm / min for 20 min to obtain PDA nanoparticles, which were recorded as PAD.

[0078] (2) Synthesis of surface-loaded shikonin core-shell structure (PEG-PDA@SK).

[0079] 4 mg of PDA nanoparticles were ultrasonically dispersed in pure water to prepare a PDA nanoparticle aqueous solution; 4 mg of shikonin (SK) and 2 mg of DSPE-PEG were dissolved in ethanol to prepare SK ethanol solution and DSPE-PEG ethanol solution, respectively.

[0080] Then, the ethanol solution of SK and the ethanol solution of DSPE-PEG were added to the aqueous solution of PDA nanoparticles, and the reaction was stirred for 12 hours at room temperature and vacuum conditions. The product was centrifuged and freeze-dried to obtain the final product, which was recorded as PEG-PDA@SK.

[0081] (3) Synthesis of nanoparticles with targeting function (S30-PEG-PDA@SK).

[0082] Preparation of S30 solution: Dissolve the nucleic acid aptamer S30 in pure water, pre-denature it at 95°C for 5 minutes, and then treat it in an ice bath for 20 minutes to prepare a 0.05 μM S30 aqueous solution.

[0083] 2 mg PEG-PDA@SK was weighed and dispersed in pure water. Then an appropriate amount of nucleic acid aptamer S30, 2 mg EDC and 5 mg NHS were dissolved in pure water and added to the PEG-PDA@SK solution. After stirring and reacting for 12 h at room temperature and vacuum conditions, the product was centrifuged and freeze-dried to obtain the final product, which was recorded as S30-PEG-PDA@SK.

[0084] The schematic diagram of the mechanism of the preparation process of the nanoparticles (S30-PEG-PDA@SK) with targeting function provided in this embodiment is shown in Figure 1 .

[0085] Example 2

[0086] This embodiment provides a nanoparticle with a targeting function, and the preparation method thereof is different from that of Example 1 only in that acetylshikonin is used in the following synthesis:

[0087] (2) Synthesis of the core-shell structure loaded with acetylshikonin (PEG-PDA@ASK): The amount of substances used was the same as that in Example 1.

[0088] (3) Synthesis of nanoparticles with targeting function (S30-PEG-PDA@ASK): The relationship between the amounts of substances used is the same as that in Example 1.

[0089] Test Example 1

[0090] In this test example 1, the material prepared in Example 1 was subjected to TEM test, particle size and Zeta potential test, as follows:

[0091] In order to evaluate whether PDA, PEG-PDA@SK and S30-PEG-PDA@SK were successfully synthesized, the synthesized PDA nanoparticles were collected and the morphology of the PDA nanoparticles was observed by TEM. The particle size and potential of PDA and S30-PEG-PDA@SK were then measured in a particle size analyzer. The synthesis and characterization results of different nanoparticles are shown in Figure 2 .

[0092] Among them, Figure 2 As shown in (A), PDA and S30-PEG-PDA@SK nanoparticles were tested by TEM. Figure 2 It can be clearly seen in (A) that both PDA and S30-PEG-PDA@SK nanoparticles have hollow core-shell structures and uniform particle sizes. Figure 2 The particle size of (B)b) is significantly larger than that of PDA( Figure 2 (B) Particle size of a).

[0093] from Figure 2 From (B)a, we can see that the average particle size of PDA is 145±18.42nm, and from (B)b, we can see that the average particle size of S30-PEG-PDA@SK is 218nm±22.51nm.

[0094] Through the above particle size and Figure 2(C) Zeta potential of S30-PEG-PDA@SK in water. It can be seen that after S30 and PEG-DSPEG were grafted onto PDA nanoparticles, the particle size of the nanoparticles increased from 145nm±18.42nm to 218nm±22.51nm, and the nanoparticles changed significantly. The absolute value of Zeta potential increased from -17.45mV±0.22mV to -33.59mV±0.09mV. Since both S30 and PEG are negatively charged, it provides evidence for PDA surface modification. After drug loading, the Zeta potential of PDA@SK also increased, indicating the successful preparation of S30-PEG-PDA@SK nanoparticles.

[0095] Test Example 2

[0096] In this test example, infrared spectroscopy tests were performed on PDA, SK and S30-PEG-PDA@SK. The test results are shown in Figure 3 .

[0097] from Figure 3 It can be seen that at 3430cm -1 -3440cm -1 The presence of an absorption peak indicates the presence of an associated hydroxyl group. The presence of an associated hydroxyl group is the main reason why SK has biological activity. -1 , 1452cm -1 Both PDA and S30-PDA-PEG have obvious absorption peaks at 1603cm -1 There is a stretching vibration peak of aromatic structure at 3327 cm -1 The stretching vibration peaks of OH and NH bonds of PDA are shown in Figure 2, while the peaks of S30-PEG-PDA are at 1061 cm -1 The characteristic peak of the stretching vibration of -CH2CH2O in the PEG structure is at 2932cm -1 The characteristic peak of the stretching vibration of the alkyl chain -CH2 in the PEG structure is shown in Figure 3. Therefore, the FTIR spectrum test further proves the successful polymerization of PDA and the successful preparation of S30-PEG-PDA@SK.

[0098] Test Example 3

[0099] In this test example, the amount of dopamine hydrochloride and the first mixed solution in the preparation of polydopamine (PDA) was screened. The specific process was as follows: 90 mL and 40 mL of water and anhydrous ethanol were added respectively for stirring, the temperature was kept at 37°C, the amount of ammonia water was 1 mL, 2 mL, 3 mL, and 4 mL respectively, and 500 mg of dopamine hydrochloride was added after stirring evenly for half an hour, the reaction was carried out for 12 hours, and the particle size was measured by centrifugation. The relevant results are shown in Table 1.

[0100] Table 1

[0101]

[0102] In Table 1, “-” indicates no data; “Peak 1 (light intensity)” indicates particle size, the smaller the value, the smaller the particle size of the nanoparticles, and vice versa; “Polydispersity index” indicates PDI, the larger the value, the more stable it is, and vice versa, the more unstable it is.

[0103] From the results in Table 1, it can be seen that after adding ammonia water, no PDA particles were found after centrifugation at 3 mL and 4 mL of ammonia water, and the particle size graph showed that the particle size was the smallest and the PDI was stable when the ammonia water was 2 mL.

[0104] Test Example 4

[0105] This test example screens the coupling ratio of S30 and PEG-PDA@SK. The specific process is as follows:

[0106] Weigh 2 mg of PEG-PDA@SK and dissolve it in pure water. Add different proportions of S30, that is, the molar ratios of S30 to PEG-PDA@SK are 0.01:3, 0.1:6, 0.1:3, 1:6, and 1:3, respectively. S30-PEG-PDA@SK prepared under different proportions is separated by agarose gel electrophoresis. Agarose gel has a network structure, and the molecules of substances will encounter resistance when passing through. The resistance of macromolecular substances is large when surging. The aptamer will encounter resistance after coupling. When the PEG-PDA@SK site is full, the aptamer will be separated and displayed on the strip. The relevant results are shown in Figure 4 .

[0107] from Figure 4 It can be seen that the molar ratio of PEG-PDA@SK:S30 is 1: 6. After the introduction of EDC and NHS in the preparation, the optimal ratio is the molar ratio of EDC:NHS:PEG-PDA@SK:S30 of 0.1:4:1:6.

[0108] Test Example 5

[0109] This test case studies the GSH response of S30-PEG-PDA@SK nanoparticles. The specific process is as follows:

[0110] Take an appropriate amount of S30-PEG-PDA@SK nanoparticles and disperse them in 10mmol GSH. Take photos of the nanoparticle morphology under TEM at 0min, 15min, 30min, and 60min. Figure 5 .

[0111] from Figure 5It can be seen that as time goes by, the morphology of the nanoparticles gradually disintegrates. In summary, the S30-PEG-PDA@SK nanoparticles prepared in the present invention are GSH responsive and can release SK in response to high GSH in the tumor microenvironment.

[0112] Test Example 6

[0113] This test example evaluates the in vitro release characteristics of different nanoparticles: PDA@SK, PEG-PDA@SK and S30-PEG-PDA@SK. The specific process is as follows:

[0114] Appropriate amounts of PDA@SK, PEG-PDA@SK and S30-PEG-PDA@SK were placed in activated dialysis bags, and 9 mL of dissolution medium was added to study the cumulative release of SK. The dissolution media were: (A) pH = 5.4 PBS group, pH = 5.4 5 mmol H2O2 group and pH = 5.4 10 mmol GSH group; (B) pH = 5.4 PBS group, pH = 6.2 PBS group and pH = 7.4 PBS group. Shake in a 37°C incubator, take 1 mL of dissolution medium at 1h, 2h, 4h, 6h, 8h, 10h, 12h, 24h, and 36h, measure the absorbance at a wavelength of 515nm under an ultraviolet spectrophotometer, calculate the release rate at each time point and draw the cumulative release curve. Related results are shown in Figure 6 .

[0115] from Figure 6 (A) It can be seen that the release of SK is limited in PBS and H2O2 at different pH values, while in the presence of GSH, most of SK is released after 6 h. In the presence of 10 mmol GSH at pH = 5.4, SK is released faster and enters a slow release phase after 8 h. The release rate reaches more than 80% after 10 h. Figure 6 (B) It can be seen that as the pH value decreases, the release rate of SK increases. In summary, the S30-PEG-PDA@SK nanoparticles prepared in the present invention have pH and GSH responsive properties and can release SK in the tumor microenvironment.

[0116] Test Example 7

[0117] In this test example, the particle size and potential of S30-PEG-PDA@SK nanoparticles were tested. The specific process is as follows:

[0118] The S30-PEG-PDA@SK nanoparticles were kept in PBS for 14 days, and the stability of their particle size and potential was investigated; the S30-PEG-PDA@SK nanoparticles were dispersed in PBS, and their particle size and potential were measured for 14 consecutive days. Figure 7 .

[0119] from Figure 7 It can be seen that the particle size of the prepared S30-PEG-PDA@SK nanoparticles remained at 220 nm ( Figure 7 (A)), the potential was maintained at 25 mV ( Figure 7 (B)), there is no obvious change, therefore, the prepared S30-PEG-PDA@SK nanoparticles have good stability.

[0120] Test Example 8

[0121] This test example studies the in vitro determination of cytotoxicity, and uses the CCK8 cell proliferation toxicity assay to evaluate the proliferation toxicity of PDA on HUVEC cells and SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK on HL-60 cells. The details are as follows:

[0122] HUVEC and HL-60 cells were cultured at 5×10 4 The cells were seeded in a 96-well plate at a density of 100 cells / well. In the HUVEC cell experiment, different concentrations of PDA were added. After 24 hours, CCK8 solution was added for detection. In the HL-60 cell experiment, different concentrations of SK were added. After 24 hours, 48 ​​hours and 72 hours, CCK8 solution was added for detection. In the HL-60 cell experiment, different concentrations of PDA, SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK drug-containing culture medium were added. After 24 hours, CCK8 solution was added for detection.

[0123] The results of the toxicity evaluation of PDA nanoparticles with different concentrations on HUVEC cells and the toxicity evaluation of shikonin and its different nanoparticles on HL-60 cells:

[0124] The in vitro biocompatibility of PDA particles was determined by incubating HUVEC cells with different concentrations of PDA for 24 h. Figure 8 (A).

[0125] from Figure 8 (A) It can be seen that the CCK-8 experiment shows that when the concentration of PDA nanoparticles reaches 100 mg / mL, the cell survival rate of HUVEC cells remains above 80%, so PDA has good biocompatibility; Figure 8 (B) Evaluation of cytotoxicity of shikonin at different concentrations on HL-60 cells at different times; and Figure 8(C) The combination of shikonin and its different nanoparticles on HL-60 cell cytotoxicity evaluation shows that SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK all have cytotoxic effects on HL-60 cells, and S30-PEG-PDA@SK has a more obvious killing effect on HL-60 cells.

[0126] Test Example 9

[0127] This experiment is to study the Calcein-AM / PI cell activity detection of PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK, as follows:

[0128] HL-60 cells were cultured at 8×10 4 The cells were inoculated at a density of 100 μL / well in a 24-well plate. After culturing in a cell culture incubator for 24 hours, the culture medium was discarded and the cells were incubated with PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK drug-containing culture medium for 24 hours. Then, after discarding the culture medium, the cells were stained with Calcein-AM / PI dye for 20 minutes, washed three times with PBS, and 100 μL PBS was added to each well. The fluorescence of each well was observed using a fluorescence microscope and photographed. The relevant results are shown in Fig. 9 .

[0129] from Fig. 9 It can be seen that free SK can kill some HL-60 cells. After modification with PEG and S30, it further kills HL-60 cells. The number of cell deaths in the S30-PEG-PDA@SK group is significantly higher than that in other groups, indicating that the drug delivery system has a strong killing ability against HL-60.

[0130] Test Example 10

[0131] This experiment studies the detection of Annexin V-FITC cell apoptosis by PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK, as follows:

[0132] HL-60 cells were cultured at 1.5 × 10 5 The cells were inoculated at a density of 100 μL / well in a 12-well plate. After culturing in a cell culture incubator for 24 hours, the culture medium was discarded and the culture medium was replaced with fresh culture medium of PDA, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK, respectively, and incubated with the cells for 24 hours. The cells were stained with Annexin V-FITC for 20 minutes, then washed three times with PBS, and 100 μL PBS was added to each well. The apoptosis of cells in different groups was measured by flow cytometry and statistically analyzed. The relevant results are shown in Fig.10 .

[0133] from Fig.10 (A) Flow cytometry apoptosis scatter plot and Fig.10 (B) The quantitative graph of apoptosis percentage shows that the apoptosis of HL-60 cells after treatment with different groups is different. Compared with the control group, free shikonin promotes HL-60 apoptosis (P<0.001). After modification with PEG and S30, it further promotes cell apoptosis. The statistical results show that the apoptosis rate of S30-PEG-PDA@SK is 33.5±0.29%, which has a better effect on killing HL-60 cells than other groups.

[0134] Test Example 11

[0135] This test case studies the targeting effects of shikonin and different nanoparticles made thereof on HL-60 cells, as follows:

[0136] PDA@Dil, PEG-PDA@Dil, S30-PEG-PDA@Dil and free Dil were co-incubated with HL-60 cells at the same concentration as Dil and then flow cytometry was performed. The relevant results are shown in Fig.11 .

[0137] from Fig.11 The results showed that the fluorescence intensity of HL-60 cells after taking up free Dil was significantly weaker than that of the other groups. This was because PDA could respond to tumor GSH and S30 specifically targeted HL-60 cells. Therefore, S30-PEG-PDA@Dil could enter HL-60 cells more easily than PDA@Dil, PEG-PDA@Dil and free Dil.

[0138] Test Example 12

[0139] The killing effects of shikonin and different nanoparticles made of it on different cancer cells (4T1 cells, CT26 cells), as well as the killing effects of different nanoparticles made of shikonin derivatives (acetylshikonin (ASK)) on HL-60 cells were studied. The details are as follows:

[0140] 4T1 cells, CT26 cells, and HL-60 cells were cultured at 5×10 4 The cells were seeded at a density of 100 / well in a 96-well plate. Fresh culture medium containing different concentrations of PDA, SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK was added to the 4T1 cell and CT26 cell experiments, while fresh culture medium containing PDA, ASK, PDA@ASK, PEG-PDA@ASK, and S30-PEG-PDA@ASK was added to the HL-60 cell experiments. After 24 hours, CCK8 solution was added for detection.

[0141] The toxicity evaluation results of different concentrations of SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK on 4T1 cells and CT26 cells are shown in the table. Fig.12 : (A) 4T1 cells, (B) CT26 cells.

[0142] from Fig.12 (A) and Fig.12 (B) It can be seen that SK, PDA@SK, PEG-PDA@SK, and S30-PEG-PDA@SK not only have obvious killing effects on HL-60 cells, but also have good killing effects on 4T1 cells and CT26 cells, indicating that the prepared nanoparticles S30-PEG-PDA@SK and S30-PEG-PDA@ASK have good universality in treating tumors.

[0143] The results of the cytotoxicity evaluation of different concentrations of ASK, PDA@ASK, PEG-PDA@ASK, and S30-PEG-PDA@ASK on HL-60 cells are shown in Fig.12 (C).

[0144] from Fig.12 (C) It can be seen that the prepared ASK nanoparticles can also exert anticancer activity, but their killing effect is weaker than that of SK nanoparticles.

[0145] In summary, the nanoparticles with targeting function provided by the embodiment of the present invention have uniform particle size, stable particle size and potential, and good biocompatibility. The nanoparticles covalently combine polydopamine (PDA) with high adsorption capacity with DSPE-PEG that can prolong the blood circulation time of nanoparticles and improve their stability to form drug-loaded particles, and couple nucleic acid aptamers (S30) on the outer surface, and finally construct a S30-coupled nano drug delivery system; it has no toxic effect on HUVEC cells and has good biocompatibility. At the same time, the nanoparticles S30-PEG-PDA@shikonin and its derivatives can inhibit tumor cell proliferation and promote tumor apoptosis; it has excellent glutathione response performance; it is conducive to the efficient drug loading and accurate, sufficient and long-term delivery of shikonin and its derivatives, providing a new strategy for achieving accurate tumor treatment.

[0146] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nanoparticle with targeting function, characterized in that: The nanoparticle has a core-shell structure, and the surface of the nanoparticle is loaded with shikonin and its derivatives; the shell of the nanoparticle is coupled with a nucleic acid aptamer, and the nucleic acid aptamer is selected from aptamer S30 and / or AS1411, and the nucleotide sequence of the aptamer S30 is shown in SEQ ID NO: 1 and the nucleotide sequence of the aptamer AS1411 is shown in SEQ ID NO: 2; The shell material of the nanoparticles includes a GSH (glutathione) responsive shell material.

2. The nanoparticle according to claim 1, characterized in that The shell material of the nanoparticles further comprises PEG, wherein the PEG is selected from any one of DSPE-PEG, mPEG and hydroxylated PEG derivatives; The GSH-responsive material includes polydopamine; Preferably, the molar ratio of the PEG to the polydopamine is 1:(9-11).

3. The nanoparticle according to claim 1, characterized in that The shikonin and its derivatives are selected from any one of shikonin, acetylshikonin, isovalerylshikonin, β-hydroxyisovalerylshikonin, methacryloylshikonin, indoleylshikonin, furanoylshikonin, benzenesulfonamideshikonin and isobutyrylshikonin; Preferably, the molar ratio of the core-shell structure loaded with shikonin and its derivatives to the nucleic acid aptamer is 6:(0.05-1); preferably 6:(0.5-1).

4. The nanoparticle according to claim 1, characterized in that The average particle size of the nanoparticles is 218 nm±22.51 nm.

5. A method for preparing nanoparticles according to any one of claims 1 to 4, characterized in that: The preparation method comprises the following steps: The GSH-responsive shell material, shikonin and its derivatives and PEG are mixed and reacted under vacuum to obtain a core-shell structure with shikonin and its derivatives loaded on the surface; The core-shell structure with shikonin and its derivatives loaded on the surface and the nucleic acid aptamer are mixed and reacted under vacuum to prepare the nanoparticles.

6. The preparation method according to claim 5, characterized in that: The mass ratio of the GSH-responsive shell material, shikonin and its derivatives and PEG is 4:(4-8):(2-4); wherein the preparation of the GSH-responsive shell material comprises: mixing dopamine hydrochloride and a first mixed solution, reacting at room temperature for 8h-12h, to obtain the GSH-responsive shell material; the dosage ratio of the dopamine hydrochloride and the first mixed solution is (1-2.5) mg:(50-55) μL.

7. The preparation method according to claim 6, characterized in that: The first mixed solution includes water, alcohol solution and alkaline solution in a volume ratio of 9:4:(0.1-0.4); Preferably, the volume ratio of the water, the alcohol solution and the alkaline solution is 9:4:0.2; Preferably, the alcohol solution is ethanol; Preferably, the alkaline solution is selected from any one of aqueous ammonia, Tris-HCl buffer, triethanolamine and sodium hydroxide solution.

8. The preparation method according to claim 5, characterized in that: The preparation of the nanoparticles also includes a coupling agent, which includes 1-ethyl-(3-dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) in a mass ratio of (1.5-2.5): (4-5.5); preferably 2:5; Preferably, the mass ratio of the core-shell structure of shikonin and its derivatives loaded on the surface to the coupling agent is 5:(2-5); Preferably, the reaction time under vacuum conditions is 6 h to 12 h to obtain the nanoparticles.

9. A pharmaceutical composition, characterized in that It comprises the nanoparticles according to any one of claims 1 to 4.

10. Use of the nanoparticles according to any one of claims 1 to 4 in preparing a drug for treating tumors, characterized in that: The tumor includes at least one of leukemia, breast cancer, colorectal cancer, lung cancer, liver cancer, glioma, lymphoma and melanoma; The leukemia is selected from any one of acute lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia, preferably acute myeloid leukemia.

Images