InDel molecular marker related to growth traits of Haimen goats and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker related to growth traits of Haimen goats and application of the InDel molecular marker, and belongs to the field of biotechnology and livestock breeding. The InDel molecular marker is a 58bp ins mutation located at the 67616252bp position of the genome sequence of the PPP1R13B gene, and the InDel molecular marker is a 58bp ins mutation located at the 67616252bp position. According to the method, the genotype is judged by taking the blood genome DNA of the Haimen goat as a template and directly sequencing a PCR (Polymerase Chain Reaction) product. Wherein the growth traits of the Haimen goats of the ID genotype are excellent, and the ID genotype can be used as an effective molecular marker for improving the growth traits of the Haimen goats. The detection method disclosed by the invention is simple and rapid, high in accuracy and low in price, can improve the breeding efficiency of the Haimen goats, and has a very high application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and livestock breeding, and relates to an InDel molecular marker related to the growth traits of Haimen goats and an application thereof. Background Art

[0002] Good breeds are the foundation of modern animal husbandry production. Strengthening the protection and utilization of breed resources and improving the degree of good breeds play an important role in promoting the high-quality development of animal husbandry. Haimen goats are unique to Haimen, Jiangsu Province. They are excellent local breed resources and national-level protected livestock and poultry breeds. Protecting the Haimen goat breed is of great significance to strengthening the awareness of livestock and poultry breeding, increasing local farmers' income and promoting the high-quality development of my country's animal husbandry. At present, the production performance of Haimen goats is not high and the population is not large. Therefore, by strengthening the selection and breeding of Haimen goats to improve quality and expand the population, it is possible to transform high-quality germplasm resources into advantageous economic benefits and promote the high-quality development of my country's modern animal husbandry.

[0003] In animal husbandry production, improving the growth of fine breeds of livestock and poultry significantly affects the economic benefits of animal husbandry production. Among them, the weight, body length, body height, chest circumference, chest depth, and chest width of Haimen goats are important indicators for measuring growth performance. Therefore, improving the weight, body length, body height, chest circumference, chest depth, and chest width of Haimen goats is the focus of Haimen goat research. The traditional breeding method has a long breeding cycle and low selection efficiency, and it is difficult to quickly and effectively improve the growth performance of goats. With the development of genetics and molecular biology, molecular marker-assisted selection technology (MAS) provides a new idea for animal breeding. MAS eliminates the interference of environmental factors and other factors on phenotypic traits, and directly selects the target genotype, which can effectively improve the efficiency of breeding and reduce the blindness in the breeding process, providing strong technical support for the breeding of growth traits of Haimen goats.

[0004] The development of high-throughput sequencing technology has reduced the cost of InDel marker development (Varshney et al, 2009). As one of the most abundant polymorphic mutations, InDel is suitable for the development of whole-genome molecular markers (Gao et al, 2012). As a high-throughput molecular marker, InDel combines the advantages of various genetic markers. Traditional molecular marker development is generally based on only one sequence, while InDel marker development is completely based on sequence differences, so there are fewer non-polymorphic sites during the development process. Compared with other molecular markers, the probability of InDel mutations of the same length at the same site in the genome is extremely small, and can be regarded as the same source (identify-by-descent, IBD) (Shedlock & Okada, 2000), so InDel markers have high accuracy and stable variation, avoiding subsequent analysis ambiguity due to specificity and complexity. In addition, InDel markers are polymorphic both within and between species, and their versatility is relatively strong ( et al, 2008).

[0005] The PPP1R13B gene encodes a member of the ASPP (p53 apoptosis stimulating protein) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53 family proteins. They promote DNA binding and transactivation of p53 family proteins on the promoters of pro-apoptotic genes. The expression of this gene is regulated by E2F transcription factors. (Provided by RefSeq, July 2008). However, no studies have reported the presence of molecular markers for the PPP1R13B gene associated with growth traits in Haimen goats. Summary of the invention

[0006] In order to overcome the shortcomings of the prior art in the breeding of Haimen goats for growth traits, the object of the present invention is to provide an InDel molecular marker related to the growth traits of Haimen goats and an application thereof.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] In the first aspect, the present invention claims the use of an InDel molecular marker associated with the growth traits of Haimen goats or a substance for detecting an InDel molecular marker associated with the growth traits of Haimen goats in any of the following:

[0009] (1) screening and / or breeding Haimen goats with excellent growth traits;

[0010] (2) preparing products for screening and / or breeding Haimen goats with excellent growth traits;

[0011] (3) Regulate the growth traits of Haimen goats;

[0012] The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No.1.

[0013] The present invention screens an InDel molecular marker related to the growth traits of Haimen goats in the PPP1R13B gene, the sequence number of the PPP1R13B gene is NC_030828.1, and the InDel molecular marker is a TGAGGATTTGACCTTTTAATGAATACAAATCATAAGCATTGTATTTTCTGTTCTACAG ins mutation located at the 67616252bp of the genome sequence of the PPP1R13B gene (referred to as PPP1R13B 58bp ins). The results of the study show that different genotypes of the InDel molecular marker site have a significant effect on the growth traits of Haimen goats, and the body length, body height and chest depth of the Haimen goats with the InDel molecular marker site being the ID heterozygous genotype are significantly higher than those of the Haimen goats with the InDel molecular marker site being the DD and II homozygous genotypes.

[0014] Furthermore, the screening and / or breeding of Haimen goats with excellent growth traits is to use the above-mentioned InDel molecular markers to identify and screen Haimen goats with excellent growth traits and then breed them.

[0015] Furthermore, the substance contains (or is) a PCR primer for amplifying a Haimen goat genomic DNA fragment containing the InDel molecular marker.

[0016] In a specific embodiment of the present invention, the PCR primers include an upstream primer F1 and a downstream primer R1;

[0017] Upstream primer F1: 5'-AGCATCTGGGATGATGCTTGTA-3' (SEQ ID No. 2);

[0018] Downstream primer R1: 5'-TTCTTCCCGTAAAGCCGCTC-3' (SEQ ID No. 3).

[0019] (The upstream primer F1 is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker in the Haimen goat genomic DNA, and the downstream primer R1 is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker in the Haimen goat genomic DNA).

[0020] Furthermore, the growth trait of the Haimen goat is at least one of body length, body height and chest depth.

[0021] Furthermore, the above application is to detect different genotypes of the InDel molecular marker site in the blood genomic DNA of the Haimen goat to be tested. The body length, body height and chest depth of Haimen goat individuals with the InDel molecular marker site as the ID heterozygous genotype are significantly higher than those of Haimen goat individuals with the InDel molecular marker site as the DD and II homozygous genotypes.

[0022] In the second aspect, the present invention claims protection for a method for identifying the growth performance of Haimen goats, detecting different genotypes of the InDel molecular marker site in the blood genomic DNA of the Haimen goats to be tested, and the body length, body height and chest depth of Haimen goat individuals with the InDel molecular marker site as the ID heterozygous genotype are significantly higher than those of Haimen goat individuals with the InDel molecular marker site as the DD and II homozygous genotypes.

[0023] In the third aspect, the present invention claims protection for a genetic breeding method for Haimen goats with high growth performance, comprising the step of using the blood genomic DNA of the Haimen goat to be tested as a template and performing PCR amplification using the above-mentioned PCR primers; judging the genotype of the InDel molecular marker site based on the product of the PCR amplification, wherein the body length, body height and chest depth of Haimen goat individuals with the ID heterozygous genotype of the InDel molecular marker site are significantly higher than those of Haimen goat individuals with the DD and II homozygous genotypes of the InDel molecular marker site; retaining Haimen goat individuals with the ID heterozygous genotype, and improving the growth performance of Haimen goats from generation to generation.

[0024] In a specific embodiment of the present invention, the reaction system of the PCR amplification is 20 μL, comprising: 2×Taq Plus Master MixⅡ10 μL; 0.6 μL of upstream and downstream primers; 1 μL of template DNA; 7.8 μL of deionized water; the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after the PCR is completed.

[0025] Further, the method for judging the genotype of the InDel molecular marker site according to the PCR amplification product is: directly sequencing or agarose gel electrophoresis the PCR amplification product, and judging according to the sequencing result or agarose gel electrophoresis result;

[0026] The agarose gel electrophoresis result showed that there was a clear band at the 278bp position for Haimen goat individuals with homozygous genotype DD (Haimen goat individuals without the InDel molecular marker), there were a clear band at the 278bp position and the 336bp position for Haimen goat individuals with heterozygous genotype ID (for heterozygous Haimen goat individuals containing the InDel molecular marker), and there was a clear band at the 336bp position for Haimen goat individuals with homozygous genotype II (homozygous Haimen goat individuals containing the InDel molecular marker);

[0027] Alternatively, the product of the PCR amplification is directly sequenced and judged according to the sequencing peak graph: when the peak graphs of both chains at the target position all add a segment of bases, it is a Haimen goat individual with the II homozygous genotype; when the peak graph only has one chain that adds a segment of bases, it is a Haimen goat individual with the ID heterozygous genotype; when the peak graph does not have a segment of bases added, it is a Haimen goat individual with the DD homozygous genotype.

[0028] In a fourth aspect, the present invention claims protection for the above-mentioned InDel molecular markers related to the growth traits of Haimen goats.

[0029] In a fifth aspect, the present invention claims a PCR primer for detecting the above-mentioned InDel molecular marker related to the growth traits of Haimen goats or a kit containing the PCR primer. The specific sequence of the PCR primer is as described above.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The present invention firstly finds an effective InDel molecular marker that affects the growth traits of Haimen goats in the PPP1R13B gene. The kit provided by the present invention is used to detect the genotype of the molecular marker by PCR amplification and product direct sequencing. The method is simple, fast, highly accurate and inexpensive. The molecular marker of the present invention is used to screen Haimen goats, retain individuals with ID heterozygous genotypes, eliminate individuals with DD and II homozygous genotypes, improve the growth traits of Haimen goats generation by generation, accelerate the breeding progress of Haimen goats, and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The results of 2% agarose gel electrophoresis of the PCR amplification product of PPP1R13B 58bp ins in Haimen goats, where M represents DL2000 Plus DNA Marker, DD represents the homozygous individual of PPP1R13B 58bp ins site, ID represents the heterozygous individual, and II represents the mutant homozygous individual.

[0033] Figure 2This is the sequencing map of the PPP1R13B 58bp insPCR amplification product. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further described in detail below in conjunction with the embodiments and related drawings. However, it is worth noting that the implementation of the present invention is not limited to this, and relevant personnel can implement it in other different forms without violating the purpose and spirit of the present invention.

[0035] Example 1 Typing and identification of the InDel molecular marker locus of the PPP1R13B gene in Haimen goats

[0036] 1. Experimental animals and sample collection

[0037] The Haimen goats used in this experiment were from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd., with a total of 210 goats. All goats were healthy and grew up in the same breeding conditions and environment. 10 mL of goat blood was collected from the jugular vein, placed in an anticoagulant tube containing EDTA, and stored at -20°C. The phenotypic information such as the growth data of Haimen goats was collected for subsequent association analysis experiments.

[0038] 2. Main instruments

[0039] Pipette (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortexer (Dalong), digital constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro-spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis instrument (Beijing Liuyi, DYY-6C), automatic digital gel imaging system (Tanon, Tanon-4100).

[0040] 3. Main Reagents

[0041] TIANGEN blood genomic DNA extraction kit (centrifugal column type), 50×TAE (Solarbio), agarose (BIOWEST), 2×Taq Plus Master MixⅡ (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed nucleic acid gel dye (TSINGKE, TSJ003), 100bp Ladder (CWBIO).

[0042] 4. Methods

[0043] 4.1 Extraction of genomic DNA from goat blood

[0044] Five hours in advance, the goat blood was taken out of the -20°C refrigerator and placed in a 4°C refrigerator for thawing. After the blood was completely thawed, DNA was extracted from the whole blood according to the instructions of the TIANGEN blood genomic DNA extraction kit.

[0045] DNA concentration and quality were measured using a micro-spectrophotometer. 260 / 280 Should be between 1.80 and 2.00, OD 260 / 230 It should be between 1.80 and 2.20. DNA samples that pass the test should be stored in a -20℃ refrigerator.

[0046] 4.2 Primer design for candidate InDel sites

[0047] The Ensembl database (https: / / asia.ensembl.org / index.html) was used to search for the InDel site information related to the PPP1R13B gene, and the genotyping primers were designed using Primer Premier 5 software. The InDel site information and primer information are shown in Tables 1 and 2.

[0048] Table 1 InDel site information of PPP1R13B gene

[0049]

[0050] Table 2 PPP1R13B InDel genotyping primer sequences

[0051]

[0052]

[0053] 4.3 Primer verification of candidate InDel molecular marker sites

[0054] 4.3.1 Mixing pool production

[0055] 60 samples were randomly selected from 95 DNA samples of Haimen goats and randomly divided into six groups, each with ten samples. 1 μL of each group of ten samples was added to the same 1.5 mL centrifuge tube to make a DNA pool for subsequent candidate InDel site polymorphism and primer verification.

[0056] 4.3.2 Pooled PCR amplification

[0057] (1) PCR amplification system (20 μL): 2× Taq Plus Master MixⅡ 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0058] (2) PCR amplification procedure: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0059] 4.3.3 Agarose gel electrophoresis of mixed PCR products

[0060] (1) Prepare 2% agarose gel: Measure 2 g agarose and 100 mL 1×TAE and pour into a conical flask. Heat in a microwave oven on high for 3 min until the solution is clear and transparent. Otherwise, extend the heating time appropriately. Let stand until the solution is no longer hot, then add 5 μL of nucleic acid dye, mix thoroughly, pour onto a plate, and wait for solidification.

[0061] (2) After the agarose gel solidifies, the sample loading operation is performed, where the PCR product loading volume is 10 μL and the DNA Marker loading volume is 4 μL. Gently place the agarose gel into an electrophoresis tank filled with 1×TAE (the 1×TAE liquid level must cover the gel surface) and perform electrophoresis at 140V300mA for 35 minutes.

[0062] (3) After electrophoresis, transfer the gel to a fully automatic digital gel imaging system for observation.

[0063] The mixed pool DNA was subjected to agarose gel electrophoresis, and the results were as follows Figure 1 As shown. The agarose gel electrophoresis results show that there is a clear band at the 278bp position for the Haimen goat individual without the InDel molecular marker (DD homozygous genotype), a clear band at the 278bp position and a clear band at the 336bp position for the heterozygous Haimen goat individual containing the InDel molecular marker (ID heterozygous genotype), and a clear band at the 336bp position for the pure and Haimen goat individual containing the InDel molecular marker (II homozygous genotype). The expected fragment size is consistent with the absence of nonspecific miscellaneous bands, indicating that the two pairs of primers have good specificity and can be used for subsequent operations.

[0064] 4.4 Genotyping

[0065] 4.4.1 Sample PCR amplification

[0066] (1) PCR amplification system (20 μL): 2× Taq Plus Master MixⅡ 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0067] (2) PCR amplification procedure: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0068] 4.4.2 Sequencing of sample PCR products and result determination

[0069] The above PCR products were sent to Qingke Biotechnology for sequencing, and the sequencing results were compared and analyzed using SnapGene software.

[0070] The genotype of the PPP1R13B 58bp ins site was determined based on the sequencing peak graph: when both chains at the target position had a base addition, the genotype was II; when only one chain had a base addition, the genotype was ID; when no base addition was found, the genotype was DD ( Figure 2 ).

[0071] The above results showed that the PCR amplification of Haimen goat genomic DNA using primer P1 and the interpretation of genotype by direct sequencing could quickly and accurately identify the InDel molecular marker site of the PPP1R13B gene of Haimen goat.

[0072] Example 2 Statistical analysis of the polymorphism of the InDel site of the PPP1R13B gene and its relationship with the growth traits of Haimen goats

[0073] 1. Statistics of genetic parameters of PPP1R13B 58bp ins population

[0074] According to the primers and methods designed in Example 1, 95 Haimen goats were genotyped, and the population genetic parameters of the locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective allele number, polymorphic information content and Hardy-Weinberg equilibrium P value.

[0075] The results are shown in Table 3. The PPP1R13B 58bp ins site had three genotypes in Haimen goats: DD, ID and II. Among them, I was the dominant allele with low polymorphism (PIC<0.25), which was in line with Hardy-Weinberg equilibrium (P>0.05).

[0076] Table 3 Genetic parameters of PPP1R13B gene population

[0077]

[0078] 2. Association of PPP1R13B 58 bp ins with growth traits of Haimen goats

[0079] The association between different genotypes of PPP1R13B 58bpins and growth traits of Haimen goats was analyzed by least squares statistical analysis using GLM procedure using SAS (9.4) software.

[0080] Taking gender as a fixed effect, the model is: ijk =μ+Gi +S j +e ijk In the formula, Y ijk is the phenotypic value of individual body weight and size traits; μ is the population mean; G i is the genotype effect; S j is a fixed effect; e ijk is a random error.

[0081] 2.1 Analysis of the association between PPP1R13B 58 bp ins and growth traits of Haimen goats

[0082] Fixed effects that had no significant association with individual phenotypic values ​​except for genotype effects were deleted, and the association analysis between the InDel locus of PPP1R13B gene and the litter size of Haimen goats was performed. The results were expressed as "least square mean ± standard error".

[0083] The results are shown in Table 4. PPP1R13B 58bp ins has a significant effect on the growth traits of Haimen goats. The body length, height and chest depth of Haimen goats with the InDel molecular marker site being the ID heterozygous genotype are significantly higher than those of Haimen goats with the InDel molecular marker site being the DD and II homozygous genotypes.

[0084] Table 4 Association results between PPP1R13B gene InDel site and growth traits of Haimen goats

[0085]

[0086] Note: Different lowercase letters in the same column indicate significant differences (P<0.05).

[0087] Example 3 Method for improving growth traits of Haimen goats

[0088] The method for improving the growth traits of Haimen goats mainly includes the following steps:

[0089] 1. Collect blood from Haimen goats to be tested and extract blood genomic DNA.

[0090] 2. Using the primer P1 described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification product.

[0091] in:

[0092] (1) PCR amplification system (20 μL): 2× Taq Plus Master MixⅡ 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0093] (2) PCR amplification procedure: pre-denaturation at 95°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0094] (3) Sequencing: The PCR product and primer P1 were sent to Qingke Biotechnology Co., Ltd. for direct sequencing.

[0095] (4) Genotype determination: SnapGene software was used to compare and analyze the peak graphs of PPP1R13B 58bp ins sequencing. When the peak graphs of both chains at the target position added a base segment, the genotype was II; when the peak graph only added a base segment, the genotype was ID; when the peak graph did not add a base segment, the genotype was DD ( Figure 2 ).

[0096] 3.The ID genotype of PPP1R13B 58bp ins can be used as an effective molecular marker to improve the growth traits of Haimen goats.

[0097] Selecting individuals with ID genotype as parents in Haimen goat breeding can improve the growth traits of offspring.

[0098] By using the InDel molecular marker of the present invention to screen Haimen goats, retaining individuals with ID genotypes for genetic breeding, and eliminating individuals with DD and II genotypes, the breeding goal of improving the growth performance of Haimen goats can be achieved.

Claims

1. Use of InDel molecular markers related to growth traits of Haimen goats or substances for detecting InDel molecular markers related to growth traits of Haimen goats in any of the following: (1) screening and / or breeding Haimen goats with excellent growth traits; (2) preparing products for screening and / or breeding Haimen goats with excellent growth traits; (3) Regulate the growth traits of Haimen goats; The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The substance contains or is a PCR primer for amplifying a Haimen goat genomic DNA fragment containing the InDel molecular marker.

3. The use according to claim 2, characterized in that: The PCR primers include an upstream primer F1 and a downstream primer R1; Upstream primer F1: 5′-AGCATCTGGGATGATGCTTGTA-3′; Downstream primer R1: 5′-TTCTTCCCGTAAAGCCGCTC-3′.

4. The use according to claim 1, characterized in that: The growth trait of the Haimen goat is at least one of body length, body height and chest depth.

5. The use according to claim 1 or 2 or 3 or 4, characterized in that: The different genotypes of the InDel molecular marker site as claimed in claim 1 are detected in the blood genomic DNA of the Haimen goat to be tested. The body length, body height and chest depth of the Haimen goat individuals with the InDel molecular marker site as the ID heterozygous genotype are significantly higher than those of the Haimen goat individuals with the InDel molecular marker site as the DD and II homozygous genotypes.

6. A method for identifying the growth performance of Haimen goats, characterized in that: The different genotypes of the InDel molecular marker site as claimed in claim 1 are detected in the blood genomic DNA of the Haimen goat to be tested. The body length, body height and chest depth of the Haimen goat individuals with the InDel molecular marker site as the ID heterozygous genotype are significantly higher than those of the Haimen goat individuals with the InDel molecular marker site as the DD and II homozygous genotypes.

7. A genetic breeding method for high growth performance Haimen goats, characterized in that: Using the genomic DNA of the blood of the Haimen goat to be tested as a template, PCR amplification is performed using the PCR primers described in claim 2 or 3; The genotype of the InDel molecular marker site is determined according to the product of the PCR amplification. The body length, body height and chest depth of Haimen goat individuals with the InDel molecular marker site being the ID heterozygous genotype are significantly higher than those of Haimen goat individuals with the InDel molecular marker site being the DD and II homozygous genotypes. Haimen goat individuals with the ID heterozygous genotype are retained to improve the growth performance of Haimen goats generation by generation.

8. The method according to claim 7, characterized in that The method for judging the genotype of the InDel molecular marker site according to the PCR amplification product is: directly sequencing or agarose gel electrophoresis the PCR amplification product, and judging according to the sequencing result or the agarose gel electrophoresis result; The agarose gel electrophoresis results showed that there was a clear band at the 278bp position for the Haimen goat individual with the DD homozygous genotype, a clear band at the 278bp position and a clear band at the 336bp position for the Haimen goat individual with the ID heterozygous genotype, and a clear band at the 336bp position for the Haimen goat individual with the II homozygous genotype. Alternatively, the product of the PCR amplification is directly sequenced and judged according to the sequencing peak graph: when the peak graphs of both chains at the target position all add a segment of bases, it is a Haimen goat individual with the II homozygous genotype; when the peak graph only has one chain that adds a segment of bases, it is a Haimen goat individual with the ID heterozygous genotype; when the peak graph does not have a segment of bases added, it is a Haimen goat individual with the DD homozygous genotype.

9. The InDel molecular marker associated with the growth traits of Haimen goats as claimed in claim 1.

10. A PCR primer for detecting the InDel molecular marker associated with the growth traits of Haimen goats according to claim 9 or a kit containing the PCR primer, characterized in that: The PCR primers include upstream primer F1 and downstream primer R1: Upstream primer F1: 5′-AGCATCTGGGATGATGCTTGTA-3′; Downstream primer R1: 5′-TTCTTCCCGTAAAGCCGCTC-3′.

Images