Method for screening listeria monocytogenes hemolysin O inhibitor in vitro, application of listeria monocytogenes hemolysin O inhibitor and inhibitor

Abstract

The invention belongs to the field of biological analysis and detection, and particularly relates to a method for screening a listeria monocytogenes hemolysin O inhibitor in vitro, application and the inhibitor. According to the method, hemolysin O inhibitor molecules are screened by detecting fluorescence resonance energy transfer (FRET) signal changes in vitro. The specific method comprises the following steps: firstly, fusing a protein tag to a hemolysin O protein through a genetic engineering method, then respectively covalently labeling FRET donor-receptor fluorescent small molecules to the hemolysin O through specific combination of tag protein and a substrate, and according to the characteristic that the cholesterol-dependent listeria monocytogenes hemolysin O is self-assembled in a solution to form nano-pores, carrying out self-assembly on the listeria monocytogenes hemolysin O to form the nano-pores. The pore-forming activity of the hemolysin O in a solution is monitored through the FRET effect between the assembled small fluorescent molecules, the inhibitor can inhibit assembly of the hemolysin O to weaken the FRET effect of the small fluorescent molecules, and then the pore-forming inhibitor of the hemolysin O can be rapidly screened in vitro through FRET. The screening method has the characteristics of simplicity in operation, rapidness and high sensitivity.

Description

Technical Field

[0001] The invention belongs to the field of biological analysis and detection, and specifically relates to a method for in vitro screening of a listeriolysin O inhibitor, an application thereof, and an inhibitor. Background Art

[0002] Listeria monocytogenes (LM) is a Gram-positive bacterium and a conditional pathogen that can infect humans and animals. It is mainly transmitted through food and is particularly susceptible to infecting people with low immunity, such as the elderly and pregnant women. It can cause gastroenteritis, meningitis, rhombencephalitis, sepsis, and miscarriage in pregnant women, with a mortality rate of up to 30%. Because it can tolerate low temperatures and extreme pH values, and its presence (especially at low pollution levels) can be easily overlooked, this bacterium has become one of the most serious pathogens in the world.

[0003] The pathogenicity of Listeria monocytogenes mainly depends on several virulence factors expressed by it, among which listeriolysin O (LLO) is one of the important virulence factors in the process of Listeria monocytogenes infecting cells. LLO is encoded by the hly gene and belongs to the cholesterol-dependent cytolysin family. It can specifically bind to cholesterol on the phagocytic vacuole membrane to form pores that lyse the vacuole membrane, allowing bacteria to escape from the phagocytic vacuole, thereby avoiding the immune attack of macrophages and entering the cytoplasm to proliferate. The key role of LLO in the virulence of Listeria monocytogenes makes it an effective target for the development of drugs against Listeria monocytogenes infection.

[0004] Currently, the widely used screening of LLO inhibitors is to determine the inhibitory effect of drugs on LLO protein pore formation by detecting the difference in the hemolytic activity of red blood cells in the presence of drugs. However, the red blood cells used in this method are not easy to obtain, are expensive to purchase, and cannot be stored for a long time, making them unsuitable for broad-spectrum screening of LLO inhibitors. Summary of the invention

[0005] The purpose of the present invention is to provide a method for in vitro screening of listeriolysin O inhibitors, applications and inhibitors.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A method for in vitro screening of inhibitors of Listeria monocytogenes hemolysin O comprises: using a protein labeling method to respectively label a pair of fluorescent small molecules with a fluorescence resonance energy transfer effect to hemolysin O; monitoring the pore-forming activity of Listeria monocytogenes hemolysin O in a solution through the fluorescence resonance energy transfer effect between the fluorescent small molecules; and further screening the pore-forming inhibitors of hemolysin O in vitro.

[0008] Furthermore, the protein tag is fused to the hemolysin O protein, and then the FRET donor-acceptor fluorescent small molecule pair is covalently labeled to the hemolysin O through the specific binding of the tag protein to the substrate. The pore-forming activity of Listeria monocytogenes hemolysin O is then monitored through the fluorescence resonance energy transfer effect between the fluorescent small molecules, and the pore-forming inhibitors of hemolysin O are screened in vitro.

[0009] The protein tag is fused to the C-terminus of the hemolysin O protein, wherein the protein tag can be selected from SNAP and Halo.

[0010] The FRET donor-acceptor fluorescent small molecule pair can be Cy3-Cy5, fluorescein-rhodamine 6G, Alexa488-Alexa555, Alexa488-Cy3, Aze-543 dyes. The structure is shown in the following formula, wherein Alexa-related dyes are commercial dyes that can be purchased commercially, and Halo-Aze dyes are cited from patent CN111333576A.

[0011]

[0012] Dyes Aze and 543 are preferred.

[0013] Specifically

[0014] (1) covalently labeling the FRET donor-acceptor fluorescent small molecules with specific substrates of the tag protein to the hemolysin O-protein tag fusion protein and purifying them;

[0015] (2) adding 1:0.2-1:5 (preferably 1:1) molar ratio of FRET donor-acceptor fluorescently labeled hemolysin O to the solution, and adding the molecule to be screened or the control at the same time, mixing well, and standing for 1-30 minutes;

[0016] The controls are negative and positive controls. Negative control: adding 1:0.2-1:5 (preferably 1:1, the ratio is consistent with the sample group) molar ratio of FRET donor-acceptor fluorescently labeled hemolysin O; positive control: only adding FRET donor fluorescent small molecule labeled hemolysin O.

[0017] (3) Add 10-500 μg / mL cholesterol to the above solutions and incubate for 5-30 minutes.

[0018] (4) exciting with a fluorescence donor wavelength and collecting the fluorescence spectrum;

[0019] (5) Analyze the spectral data and screen out inhibitors of Listeria monocytogenes hemolysin O.

[0020] The FRET donor-acceptor fluorescent small molecules with the label protein-specific substrate in step (1) are Cy3-Cy5, fluorescein-rhodamine 6G, Alexa488-Alexa555, Alexa488-Cy3, and Aze-543 dyes.

[0021] The step (5) analyzes the spectral data and first calculates the ratio of the maximum emission peak of the fluorescent acceptor (A) to the maximum emission peak of the fluorescent donor (D). A / D , and then the following formula is used to calculate the inhibition efficiency of the sample in inhibiting hemolysin O pore formation, and then the inhibitor of Listeria monocytogenes hemolysin O is obtained,

[0022] The screening revealed that the Listeria monocytogenes hemolysin O inhibitor can inhibit the pore formation of hemolysin O.

[0023] An inhibitor screened according to the in vitro screening method for Listeria monocytogenes hemolysin O inhibitors: the structure is shown below

[0024]

[0025] An application of the Listeria monocytogenes hemolysin O inhibitor, and an application of the inhibitor in drugs for treating Listeria monocytogenes infection.

[0026] The advantages and beneficial effects of the present invention are:

[0027] The present invention establishes a FRET system by fluorescently labeling LLO to screen LLO pore-forming inhibitors. FRET technology is widely used to study protein interactions. Compared with the use of expensive and unstable red blood cells and the complexity of operation in the hemolytic activity detection method, FRET is more economical, simple and intuitive through fluorescence spectroscopy technology. In addition, after the protein tag is fused to the LLO protein by genetic engineering, any small molecule fluorescent probe with the tag substrate can be labeled on the LLO protein for application, which is convenient and quick. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is an SDS-PAGE electrophoresis diagram of LLO, LLO-SNAP, and LLO-Halo fusion proteins after expression provided by the embodiments of the present invention.

[0029] Figure 2 The SDS-PAGE electrophoresis Coomassie Brilliant Blue staining and fluorescence images of the purified LLO, LLO-SNAP, and LLO-Halo fusion proteins before and after fluorescent labeling provided in the embodiments of the present invention.

[0030] Figure 3This is a diagram showing the hemolytic activity effects of LLO, LLO-SNAP, and LLO-Halo proteins provided in the embodiments of the present invention.

[0031] Figure 4 This is an SDS-PAGE electrophoresis diagram of the FRET donor and acceptor before and after fluorescent labeling of LLO-Halo protein provided in an embodiment of the present invention.

[0032] Figure 5 The fluorescence spectra and ratio graphs of the FRET donor and acceptor fluorescently labeled LLO-Halo provided in the embodiments of the present invention before and after the addition of cholesterol.

[0033] Figure 6 The fluorescence spectra and ratio graphs of LLO-Halo fluorescently labeled with different ratios of FRET donor and acceptor provided in the embodiments of the present invention.

[0034] Figure 7 The fluorescence spectra and ratio graphs of LLO-Halo labeled with a FRET donor and acceptor fluorescent small molecule in cholesterol solutions of different concentrations provided in the embodiments of the present invention.

[0035] Figure 8 The fluorescence spectra and ratio graphs of LLO-Halo labeled with a FRET donor and acceptor fluorescent small molecule in different pH solutions provided in the embodiments of the present invention.

[0036] Fig. 9 The fluorescence spectra and ratio graphs of LLO-Halo labeled with a FRET donor and acceptor fluorescent small molecule in solutions at different temperatures provided in the embodiments of the present invention.

[0037] Fig.10 The fluorescence spectrum and ratio spectrum of LLO-Halo labeled with FRET donor and acceptor fluorescent small molecules in the presence of known LLO inhibitors fisetin, myricetin and baicalin provided in the embodiments of the present invention.

[0038] Fig.11 Screening of unknown LLO inhibitors by in vitro FRET provided by the embodiments of the present invention

[0039] The present invention will be further described in the following examples, but the present invention is not limited thereto. DETAILED DESCRIPTION

[0040] The present invention screens hemolysin O inhibitor molecules by detecting fluorescence resonance energy transfer (FRET) signal changes in vitro. A FRET donor-acceptor fluorescent small molecule pair is covalently labeled to hemolysin O by a protein labeling method, and according to the characteristics of cholesterol-dependent Listeria monocytogenes hemolysin O self-assembling in a solution to form nanopores, the pore-forming activity of hemolysin O in the solution is monitored by the FRET effect between fluorescent small molecules after assembly. The inhibitor can inhibit the assembly of hemolysin O to weaken the FRET effect of the fluorescent small molecule, and then the pore-forming inhibitor of hemolysin O can be quickly screened in vitro by FRET. The screening method of the present invention has the characteristics of simple operation, rapidity, and high sensitivity.

[0041] The Listeria monocytogenes used in the following examples can be obtained through any channel known to the public.

[0042] Example 1

[0043] Construction of LLO, LLO-SNAP, and LLO-Halo fusion expression vectors

[0044] 1) Obtaining the full-length gene hlyA of LLO:

[0045] The target gene hlyA (GenBank: HAA2355043.1) of LLO protein was amplified from Listeria monocytogenes, which does not contain the 1-24 amino acid sequence as a signal peptide. The primers used for amplification are shown in the following table.

[0046] Table 1: hlyA gene amplification primer sequences (5'-3')

[0047] hlyA-F GCATTTAAATCTGTACAGACCGGTGAATTCAAGGATGCATCTGCATTCAATAAAG hlyA-R AGTGGTGGTGGTGGTGGTGCTCGAGTTCGATTGGATTATCTACACTATTAC hlyA-SF CATTTAAATCTGTACAGACCGGTGAATTCAAGGATGCATCTGCATTCAATAAAG hlyA-SR TTCGCAGTCTTTGTCCATGGTGAATTCTTCGATTGGATTATCTACACTATTAC hlyA-HF CATGGATATCAAGCTTACCGGTGAATTCAAGGATGCATCTGCATTCAATAAAG hlyA-HR CAGTACCGATTTCTGCCATATGGAATTCTTCGATTGGATTATCTACACTATTAC

[0048] The PCR amplification system for hlyA is as follows

[0049]

[0050] The PCR reaction procedure is as follows:

[0051]

[0052] 2) Obtaining LLO, LLO-SNAP, and LLO-Halo restriction vectors:

[0053] (1) Construction of LLO expression vector: The pET-22b-SNAP plasmid was double-digested with restriction endonucleases EcoRⅠ and XhoⅠ.

[0054] (2) Construction of LLO-SNAP expression vector: The pET22b-SNAP plasmid was digested with restriction endonuclease EcoRⅠ.

[0055] (3) Construction of LLO-Halo expression vector: The pET22b-Halo plasmid was digested with restriction endonuclease EcoRⅠ.

[0056] The enzyme digestion system is as follows:

[0057]

[0058] After overnight digestion at 37°C, the PCR product obtained in step 1) and the digestion product in step 2) were verified by electrophoresis using 1% agarose gel electrophoresis, and the target gene hlyA was at 1515 bp. The target band was then excised and recovered using a gel recovery kit.

[0059] 3) Obtaining LLO, LLO-SNAP, and LLO-Halo fusion expression vectors

[0060] (1) Obtaining LLO fusion expression vector: The full-length gene hlyA of LLO obtained in step 1) was ligated with the pET-22b-SNAP-EcoRⅠ-XhoⅠ double-enzyme-cut vector obtained in step 2) (1) by seamless cloning method, and the SNAP protein gene was replaced with the full-length gene of hlyA to obtain pET-22b-LLO (hlyA).

[0061] (2) Obtaining LLO-SNAP fusion expression vector: The full-length gene hlyA of LLO obtained in step 1) was connected with the pET22b-SNAP-EcoRⅠ single restriction vector obtained in step 2) by seamless cloning method, and the SNAP protein tag was fused to the C-terminus of the hemolysin O protein to obtain pET-22b-LLO-SNAP.

[0062] (3) Obtaining LLO-Halo fusion expression vector: The full-length gene hlyA of LLO obtained in step 1) was connected with the pET22b-Halo-EcoRⅠ single restriction vector obtained in step 2) (3) by seamless cloning method, and the Halo protein tag was fused to the C-terminus of the hemolysin O protein to obtain pET-22b-LLO-Halo.

[0063] Use the seamless cloning and ligation kit to connect the target gene and vector at a concentration ratio of 3:1. The connection system is as follows:

[0064]

[0065] The reaction was continued at 50°C for 40 min and immediately placed in an ice bath for 2 min.

[0066] 4) Transformation of ligation products

[0067] Take out 100μL of DH5α competent cells from -80℃, put them in an ice box, add 4μL of the ligation product to the total E. coli competent cell tube after melting, and mix gently. Ice shock for 30min, and heat shock at 42℃ for 90s. After the heat shock, quickly ice shock for 5min. Add 500μL of liquid LB culture medium and place in a shaker at 37℃, 160r / min for 1h. Centrifuge at 4000g for 3min. Discard 400μL of LB culture medium, retain 200μL and gently resuspend the precipitate, inoculate it into a culture dish with resistance to ampicillin, and place it in a 37℃ incubator for 12-16h.

[0068] 5) Monoclonal colony PCR identification

[0069] Six colonies were selected from the bacterial culture dish for colony PCR. The system was as follows:

[0070]

[0071] The PCR reaction procedure is as follows:

[0072]

[0073] 6) Agarose gel electrophoresis verification: Use 1% agarose gel electrophoresis to verify the PCR product, select the correct colony, add it to 5 mL of liquid LB culture medium containing Amp, and shake it on a shaker at 37°C at 180 r / min for 12-16 h.

[0074] 7) Preservation of bacteria and sending for sequencing verification After shaking the bacteria, make two copies of 500 μL of bacterial solution and mix it with 500 μL of 40% glycerol. One copy is stored in a -80℃ refrigerator for preservation of bacteria; the other copy is sent to a sequencing company for sequencing.

[0075] 8) After sequencing verification, the pET-22b-LLO, pET-22b-LLO-SNAP, and pET-22b-LLO-Halo plasmid vectors were successfully constructed.

[0076] Example 2

[0077] Prokaryotic expression and purification of LLO, LLO-SNAP, and LLO-Halo proteins

[0078] The plasmids pET-22b-LLO, pET-22b-LLO-SNAP, and pET-22b-LLO-Halo constructed in the above examples were respectively transferred into E. coli BL21 competent cells, plated and cultured at 37°C overnight, and single clones were picked and placed in 10 mL LB medium containing 50 μg / mL Amp, and cultured at 37°C overnight. The next day, the bacterial solution was transferred to 300 mL LB medium containing 50 μg / mL Amp until the OD 600 ≈0.1, 37℃ shaking culture, real-time monitoring of OD 600 Changes, when OD 600 When the pH reaches 0.8, add the inducer IPTG to a final concentration of 1 mM, culture at 16°C for 18-22 hours, collect the cells, centrifuge at 6000 rpm for 20 minutes, and discard the supernatant. Resuspend the cells with 50 mM Tris-Hcl (containing 150 mM NaCl, pH 7.0) buffer and wash twice by centrifugation. Finally, resuspend the collected cells with 15 mL of 50 mM Tris-Hcl (containing 150 mM NaCl, pH 7.0) buffer, and add the protease inhibitor PMSF to a final concentration of 0.1 mM. Ultrasonicate the bacterial solution in an ice bath (400 W, 10 min), then centrifuge at 14000 rpm for 20 min in a high-speed centrifuge, and collect the supernatant.

[0079] The prokaryotic expressed protein was purified by nickel column, and 10, 60, 250, and 500 mM imidazole (20 mM Tris; 300 mM NaCl; pH = 7.0) were used to pass through the nickel column, and the purified eluted protein solution was collected. The LLO protein was eluted with 60 and 250 mM imidazole (20 mMTris; 300 mM NaCl; pH = 7.0) and the target protein was present in the solution; the LLO-SNAP protein was eluted with 250 mM imidazole (20 mM Tris; 300 mM NaCl; pH = 7.0) and the target protein was present in the solution; the LLO-Halo protein was eluted with 60 and 250 mM imidazole (20 mM Tris; 300 mM NaCl; pH = 7.0) (see Figure 1 The protein was then purified and concentrated using Coomassie Brilliant Blue solution and a spectrophotometer. 595 The measured protein concentrations were LLO = 4.8 μg / μL; LLO-SNAP = 1.2 μg / μL; LLO-Halo = 2.74 μg / μL; and the expression levels of the three LLO proteins were LLO protein: 54.8 mg / L, LLO-SNAP protein: 30 mg / L, and LLO-Halo protein: 54 mg / L.

[0080] Figure 1These are the results of 10% SDS-PAGE after prokaryotic expression of the target protein, where the first lane is a protein marker; lanes 2 to 5 are LLO expression bands; lanes 6 to 9 are LLO-SNAP expression bands; lanes 10 to 13 are LLO-Halo expression bands. The theoretical molecular weights of LLO, LLO-SNAP, and LLO-Halo target proteins are 50 kDa, 72 kDa, and 83 kDa, respectively, which are consistent with the results of the SDS-PAGE electrophoresis supernatant bands.

[0081] Example 3

[0082] Fluorescent labeling and purification of LLO-SNAP and LLO-Halo proteins

[0083] The purified protein was fluorescently labeled with a small molecule dye, LLO-SNAP was labeled with SNAP-488 dye, and LLO-Halo was labeled with Halo-543 dye; the molar ratio of the small molecule dye to the protein was 2:1.

[0084] 0.1 μL of SNAP-488 dye (5 mM) was added to 10 μL of LLO-SNAP (protein concentration was 1.2 μg / μL) protein solution; 0.3 μL of Halo-543 dye (2 mM) was added to 10 μL of LLO-Halo protein solution (protein concentration was 2.74 μg / μL); mixed and incubated at 37 degrees for 1 hour, and then verified by electrophoresis, while the LLO wild-type protein purified as above was used as a control (see Figure 2 ).

[0085] Figure 2 The fluorescence labeling of LLO, LLO-SNAP, and LLO-Halo proteins and the SDS-PAGE protein electrophoresis after purification show that LLO-SNAP and LLO-Halo proteins have bright fluorescent bands at the target band under UV light. This proves that the LLO wild-type protein and LLO protein with SNAP and Halo tags were successfully expressed and fluorescently labeled with small molecule fluorophores with specific substrates.

[0086] Example 4

[0087] Detection of hemolytic activity of LLO, LLO-SNAP, and LLO-Halo proteins

[0088] The purified LLO, LLO-SNAP, and LLO-Halo in vitro expressed proteins were subjected to three parallel experiments using a mouse erythrocyte lysis experiment to detect hemolytic activity using a concentration gradient. The three LLO proteins expressed in vitro were prepared with Tris (20 mM, containing 300 mM NaCl, pH = 5.8) buffer to a concentration of 20 nM (LLO protein has the highest hemolytic activity at around pH = 5.5), and then each protein solution was diluted 2 times in equal volume to make 12 gradient concentrations (respectively 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.156, 0.078, 0.039, 0.0195, 0.0097 nM), and allowed to stand at 37 ° C for 10 min. Take 100 μL of 5% mouse erythrocytes and 100 μL of the above protein incubation solutions and dilute them to 2.5% mouse erythrocytes / 10nM protein concentration. Add 5% mouse erythrocytes to dilute the remaining gradient concentrations in the same way and let stand at 37°C for 1 hour. Negative control: ①2.5% mouse erythrocytes, ②2.5% mouse erythrocytes + Tris (20mM, 300mM NaCl, pH=5.8) solution, positive control: 2.5% mouse erythrocytes + Triton10mM, the control group was also let stand at 37°C for 1 hour. Centrifuge each incubated sample at 3700g for 5 minutes, take the supernatant and put it in a 96-well plate to detect the value at 570nm using an enzyme reader. Statistical method for drawing a curve of hemolytic activity: (sample-negative control②) / (positive control-negative control①) The three groups of samples calculated the average and standard deviation values, and used the Boltzmann curve in the Origin software Nonlinear CurveFit to draw the curve (see Figure 3 ).

[0089] Depend on Figure 3 The hemolytic activity curves of three groups of parallel data of LLO, LLO-SNAP, and LLO-Halo proteins were made. The numerical values ​​were observed and it was found that the hemolytic activity increased with the increase of protein concentration. It was found that both the wild-type LLO protein and the LLO protein with protein tag had obvious hemolytic activity, indicating that the LLO protein after fusion of protein tag can have hemolytic activity, but it is slightly reduced. C50 (LLO) = 0.14 nM, H C50 (LLO-SNAP) = 0.79 nM, H C50 (LLO-Halo) = 1.14 nM.

[0090] Example 5

[0091] FRET donor-acceptor fluorescent small molecules labeled LLO-Halo and purified

[0092] In order to establish the FRET technology to detect the in vitro pore-forming activity of LLO, the Halo small molecule dyes Halo-Aze (mother solution 1.4mM) and Halo-543 (mother solution 2mM) of different wavelengths were used as FRET donor-acceptor fluorescent small molecule pairs to incubate the LLO-Halo protein expressed in vitro obtained above. The small molecule dyes were mixed with the LLO-Halo protein at a molar concentration ratio of 2:1 and incubated at 37°C in the dark for 1 hour. The LLO-Halo protein labeled with the FRET donor-acceptor fluorescent small molecule was then purified, and the Halo dye that was not labeled with the LLO-Halo protein was removed using a G25 dextran gel column. The buffer used was Tris (20mM, 300mM NaCl, pH=7.0). The LLO-Halo-Aze protein and LLO-Halo-543 protein successfully labeled with the Halo dye were collected (see Figure 4 ).

[0093] Depend on Figure 4 The fluorescence and Coomassie Brilliant Blue staining results of LLO-Halo-Aze protein and LLO-Halo-543 protein in 10% SDS-PAGE. The first lane is the three-color pre-stained Marker, and the second and third lanes are LLO-Halo-Aze protein and LLO-Halo-543 protein. There is bright fluorescence in the correct target band, indicating that LLO-halo protein is successfully labeled with FRET donor-acceptor fluorescent small molecules.

[0094] Example 6

[0095] FRET donor-acceptor fluorescent small molecule labeled LLO-SNAP:

[0096] The LLO-SNAP protein expressed in vitro was incubated with SNAP small molecule dyes SNAP-Aze (mother solution 1.4mM) and SNAP-543 (mother solution 2mM) of different wavelengths as FRET donor-acceptor fluorescent small molecule pairs. The small molecule dyes were mixed with LLO-SNAP protein at a molar concentration ratio of 2:1 and incubated at 37°C in the dark for 1h. Then, the FRET donor-acceptor fluorescent small molecule labeled LLO-SNAP protein was purified, and the dye not labeled with LLO-SNAP protein was removed with a G25 dextran gel column. The buffer used was Tris (20mM, 300mM NaCl, pH=7.0). The LLO-SNAP-Aze protein and LLO-SNAP-543 protein successfully labeled with SNAP dye were collected.

[0097] Example 7

[0098] FRET donor-acceptor fluorescently labeled LLO-Halo, fluorescence spectra and ratios before and after adding cholesterol

[0099] 5mM cholesterol (chol) solution was prepared with ethanol as the mother solution. Samples LLO-Halo-Aze, LLO-Halo-543, LLO-Halo-Aze+LLO-Halo-543, LLO-Halo-Aze+chol, LLO-Halo-543+chol, LLO-Halo-Aze+LLO-Halo-543+chol were prepared with Tris (20mM, 300mM NaCl, pH=5.8) solution respectively; the final concentrations of LLO-Halo-Aze and LLO-Halo-543 proteins in the above-prepared samples were 1μM, and the final concentration of cholesterol was 100μg / mL. Each sample was incubated at 37°C in the dark for 1h. The absorption and excitation spectra of the FRET donor-acceptor fluorescent small molecules are Halo-Aze: Em: 450nm, Ex: 460-700nm; Halo-543: Em: 540nm, Ex: 550-700nm (see Figure 5 ).

[0100] Depend on Figure 5 It can be seen that the donor fluorescence peak I of the LLO-Halo-Aze + LLO-Halo-543 mixed solution before adding cholesterol 526nm The fluorescence of LLO-Halo-Aze is stronger than that of LLO-Halo-Aze, indicating that there is no FRET effect. After adding cholesterol, the donor fluorescence peak I 526nm Weaker than the fluorescence of LLO-Halo-Aze+chol, its acceptor fluorescence peak I 566nm The fluorescence is stronger than that of LLO-Halo-543+chol added alone, indicating that a FRET effect has been produced. This is because cholesterol can induce the pore formation of LLO protein, bringing the fluorescence of Aze and 543 close together to produce FRET. It can be seen that the fluorescent small molecule FRET donor-acceptor pair Aze-543 can respond to LLO pore formation to produce a fluorescence resonance energy transfer effect. Further, replacing the fluorescent small molecule FRET pair with others should have corresponding effects. At the same time, the fluorescent small molecule FRET pair can also be Cy3-Cy5, Alexa488-Alexa555, Alexa488-Cy3, FITC-TRITC, etc.

[0101] Example 8

[0102] FRET effect of different ratios of LLO-Halo-Aze and LLO-Halo-543

[0103] In Tris (20mM, 300mM NaCl, pH=5.8) solution, dilute the FRET donor-labeled protein LLO-Halo-Aze to 1μM, and dilute the FRET acceptor-labeled protein LLO-Halo-543 to 0.2μM, 0.4μM, 0.6μM, 0.8μM, 1μM, 2μM, and 4μM in sequence. Positive control: only add the FRET donor-labeled protein LLO-Halo-Aze to the solution. Add 100μg / mL of cholesterol to the protein mixture solution, and incubate at 37℃ in the dark for 1h before measuring the fluorescence spectrum (see Figure 6 ).

[0104] Depend on Figure 6 It can be seen that the fluorescence spectra and ratio spectra of LLO-Halo-Aze and LLO-Halo-543 at different ratios prove that LLO-Halo-Aze and LLO-Halo-543 have FRET effect in the presence of cholesterol.

[0105] Example 9

[0106] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the pore-forming efficiency of LLO under different cholesterol concentrations

[0107] Prepare a 5 mM cholesterol (chol) solution as the mother solution, mix LLO-Halo-Aze and LLO-Halo-543 proteins in Tris (20 mM, 300 mM NaCl, pH = 5.8) solution, and the final concentration of each protein is 1 μM. Add different concentrations of cholesterol solution to the mixed solution, the concentrations are 10, 20, 50, 100, 200, 500 μg / mL, respectively, incubate at 37 ° C in the dark for 1 h, and detect with a fluorescence spectrometer (see Figure 7 ).

[0108] Depend on Figure 7 It can be seen that the fluorescence spectra and ratio diagrams of the pore-forming efficiency of LLO under different cholesterol concentration conditions detected by the FRET effect of LLO-Halo-Aze and LLO-Halo-543 show that the pore-forming efficiency of LLO is the best when 100 μg / mL of cholesterol is added.

[0109] Example 10

[0110] Application of FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the pore-forming efficiency of LLO under different pH conditions

[0111] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20mM, 300mM NaCl) solution, and the final concentration of each protein was 1μM. The pH of the Tris buffer used was pH=4.5, pH=5.8, pH=7.0, and pH=8.0, respectively. Cholesterol was added to a final concentration of 100μg / mL and incubated at 37°C in the dark for 1h. The pore-forming efficiency of LLO under different pH conditions was detected by fluorescence spectrometer (see Figure 8 ).

[0112] Depend on Figure 8 It can be seen that the fluorescence spectra and ratio diagrams of the pore-forming efficiency of LLO under different pH conditions detected by the FRET effect of LLO-Halo-Aze and LLO-Halo-543 show that the pore-forming efficiency of LLO is the best under acidic conditions (pH=5.8).

[0113] Embodiment 11

[0114] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the pore-forming efficiency of LLO under different temperature conditions

[0115] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20 mM, 300 mM NaCl, pH = 5.8) solution, with the final concentration of each protein being 1 μM. Cholesterol was added at a concentration of 100 μg / mL, and incubated at 4°C and 37°C for 1 h in the dark. The pore-forming efficiency of LLO under different temperature conditions was detected by fluorescence spectrometer (see Fig. 9 ).

[0116] Depend on Fig. 9 It can be seen that the fluorescence spectra and ratio diagrams of the pore-forming efficiency of LLO under different temperature conditions detected by the FRET effect of LLO-Halo-Aze and LLO-Halo-543 show that the pore-forming efficiency of LLO is better at 37°C.

[0117] Example 12

[0118] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the inhibition of LLO pore formation by different concentrations of inhibitor fisetin

[0119] It is known that the natural drug flavonoid analogue fisetin (commercially available product) has an inhibitory effect on the pore-forming activity of LLO. Three sets of parallel experiments were performed to detect the inhibitory effect of different concentrations of fisetin on LLO pore-forming.

[0120] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20mM, 300mM NaCl, pH=5.8) solution, and the final concentration of each protein was 1μM. The prepared fisetin (5mM) was added to the mixture containing LLO-Halo-Aze and LLO-Halo-543 to a final concentration of 32μg / mL, and diluted with the mixture of LLO-Halo-Aze and LLO-Halo-543 to an equal volume to a fisetin concentration of 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125μg / mL, respectively, and finally 100μg / mL of cholesterol solution was added. Negative control: LLO-Halo-Aze + LLO-Halo-543 + cholesterol; positive control: LLO-Halo-Aze + cholesterol, incubated at 37℃ for 1h. Then add the sample to a 96-well plate and use an ELISA reader to detect the fluorescence spectrum, using Em: 450nm, Ex: 460-700nm (see Fig.10 ). Statistical method for inhibitory activity: First calculate the I of each sample spectrum. A / D =I 566nm / I 526nm value, and then use the formula To calculate the inhibitory efficiency of the inhibitor, the samples were repeated three times, the average value and standard deviation were calculated, and the Boltzmann curve was drawn using the Nonlinear Curve Fit tool in the Origin software.

[0121] Depend on Fig.10 In the experiment, the FRET effect of LLO-Halo-Aze and LLO-Halo-543 was used to detect the fluorescence spectra and inhibitory activity curves of different concentrations of fisetin on LLO pore formation inhibition. The data analysis showed that the FRET method detected that fisetin inhibited LLO pore formation activity at a dose concentration, and the higher the concentration, the better the inhibitory effect. 50 (Fisetin) = 3.82 μg / mL, fisetin, a known inhibitor of LLO pore formation, verifies the effectiveness of the FRET system.

[0122] Example 13

[0123] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the inhibition of LLO pore formation by different concentrations of inhibitor myricetin

[0124] It is known that the natural drug flavonoid analog myricetin (commercially available product) has an inhibitory effect on the pore-forming activity of LLO, and the inhibitory effect of different concentrations of myricetin on LLO pore-forming was detected.

[0125] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20mM, 300mM NaCl, pH=5.8) solution, and the final concentration of each protein was 1μM. The prepared myricetin (5mM) was added to the mixture containing LLO-Halo-Aze and LLO-Halo-543 to a final concentration of 32μg / mL, and diluted with the mixture of LLO-Halo-Aze and LLO-Halo-543 to an equal volume to a myricetin concentration of 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125μg / mL, respectively, and finally 100μg / mL of cholesterol solution was added. Negative control: LLO-Halo-Aze + LLO-Halo-543 + cholesterol; positive control: LLO-Halo-Aze + cholesterol, incubated at 37°C for 1h. Then add the sample to a 96-well plate and use an ELISA reader to detect the fluorescence spectrum using Em: 450nm, Ex: 460-700nm. Statistical method for inhibitory activity: First calculate the I of each sample spectrum. A / D =I 566nm / I 526nm value, and then use the formula To calculate the inhibitory efficiency of the inhibitor, the samples were repeated three times, the average value and standard deviation were calculated, and the Boltzmann curve was drawn using the Nonlinear Curve Fit tool in the Origin software.

[0126] Depend on Fig.10 In the experiment, the FRET effect of LLO-Halo-Aze and LLO-Halo-543 was used to detect the fluorescence spectra and inhibitory activity curves of different concentrations of myricetin on the inhibition of LLO pore formation. The data analysis showed that the FRET method detected that myricetin inhibited the LLO pore-forming activity of LLO protein at a dose concentration, and the higher the concentration, the better the inhibitory effect. 50 (Myricetin) = 2.88 μg / mL, myricetin, a known inhibitor of LLO pore formation, verifies the effectiveness of the FRET system.

[0127] Embodiment 14

[0128] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to detect the inhibition of LLO pore formation by different concentrations of inhibitor Baicalin

[0129] It is known that the natural drug flavonoid analog Baicalenin (commercially available product) has an inhibitory effect on the pore-forming activity of LLO, and the inhibitory effect of Baicalenin at different concentrations on the pore-forming activity of LLO was detected.

[0130] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20mM, 300mM NaCl, pH=5.8) solution, and the final concentration of each protein was 1μM. The prepared Baicalin (5mM) was added to the mixture containing LLO-Halo-Aze and LLO-Halo-543 to a final concentration of 32μg / mL, and diluted with the mixture of LLO-Halo-Aze and LLO-Halo-543 to an equal volume until the concentration of Baicalin was 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125μg / mL, and finally 100μg / mL of cholesterol solution was added. Negative control: LLO-Halo-Aze + LLO-Halo-543 + cholesterol; positive control: LLO-Halo-Aze + cholesterol, incubated at 37℃ for 1h. Then add the sample to a 96-well plate and use an ELISA reader to detect the fluorescence spectrum using Em: 450nm, Ex: 460-700nm. Statistical method for inhibitory activity: First calculate the I of each sample spectrum. A / D =I 566nm / I 526nm value, and then use the formula To calculate the inhibitory efficiency of the inhibitor, the samples were repeated three times, the average value and standard deviation were calculated, and the Boltzmann curve was drawn using the Nonlinear Curve Fit tool in the Origin software.

[0131] Depend on Fig.10 In the experiment, the FRET effect of LLO-Halo-Aze and LLO-Halo-543 was used to detect the fluorescence spectra and inhibitory activity curves of different concentrations of Baicalin on the inhibition of LLO pore formation. The data analysis showed that the FRET method detected that Baicalin inhibited the LLO pore-forming activity of LLO protein at a dose concentration, and the higher the concentration, the better the inhibitory effect. IC 50 Baicalein = 11.52 μg / mL. Baicalein, a known inhibitor of LLO pore formation, verifies that the FRET system is effective.

[0132] Embodiment 15

[0133] Using the FRET effect of LLO-Halo-Aze and LLO-Halo-543 to screen for unknown inhibitors of LLO pore-forming activity

[0134] Using the method of the present invention, it is known that the natural drug flavonoid analogue fisetin (commercially available product) has the best inhibitory effect on the pore-forming activity of LLO. Fifteen fisetin analogue compounds (compounds 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15) are used to screen out effective inhibitors of the pore-forming activity of LLO.

[0135] LLO-Halo-Aze and LLO-Halo-543 proteins were mixed in Tris (20mM, 300mM NaCl, pH=5.8) solution, and the final concentration of each protein was 1μM. First, the prepared compound 1-15 (5mM) was added to the mixture containing LLO-Halo-Aze and LLO-Halo-543 to a final concentration of 16μg / mL, and finally 100μg / mL of cholesterol solution was added. Experimental group: LLO-Halo-Aze+LLO-Halo-543+compound+cholesterol, control group: LLO-Halo-Aze+LLO-Halo-543+cholesterol, incubated at 37°C for 1h. Then the samples were added to a 96-well plate and the fluorescence spectrum was detected by an enzyme-labeled instrument, using Em: 450nm, Ex: 460-700nm for detection. Statistical method: First calculate the I value of the measured spectrum of each sample. A / D =I 566nm / I 526nm Then the experimental group / control group values ​​of each compound sample spectrum were plotted using Origin software (see Fig.11 ), and the data analysis revealed that compounds 1, 2, 4, and 8 had significant inhibitory effects.

[0136] Add the prepared compounds 1, 2, 4, 8 (5mM) to the mixture containing LLO-Halo-Aze and LLO-Halo-543 to a final concentration of 32μg / mL, and dilute with an equal volume of the mixture of LLO-Halo-Aze and LLO-Halo-543 to a concentration of 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125μg / mL of compounds 1, 2, 4, 8, respectively, and finally add 100μg / mL of cholesterol solution. Negative control: LLO-Halo-Aze + LLO-Halo-543 + cholesterol; positive control: LLO-Halo-Aze + cholesterol, incubate at 37°C for 1h. Then add the samples to a 96-well plate and use an enzyme reader to detect the fluorescence spectrum, using Em: 450nm, Ex: 460-700nm for detection. Statistical method for inhibitory activity: First calculate the I of the measured spectrum of each sample A / D =I 566nm / I 526nm value, and then use the formula To calculate the inhibitory efficiency of the inhibitor, the samples were repeated three times, the average value and standard deviation were calculated, and the Boltzmann curve was drawn using the Nonlinear Curve Fit tool in the Origin software.

[0137] Depend on Fig.11In the experiment, the FRET effect of LLO-Halo-Aze and LLO-Halo-543 was used to screen out inhibitors that were effective in inhibiting LLO pore-forming activity. The fluorescence spectrum bar graphs of the inhibition of LLO pore-forming by compounds 1-15 were detected. The data analysis showed that compounds 1, 2, 4, and 8 had significant inhibitory effects on LLO pore-forming activity by FRET. Then, the inhibitory activity curves of compounds 1, 2, 4, and 8 at different concentrations on LLO pore-forming were detected. The data analysis showed that compounds 1, 2, 4, and 8 inhibited LLO pore-forming activity at dose concentrations by FRET. The higher the concentration, the better the inhibitory effect. IC 50 (Compound 1) = 5.01 μg / mL, IC 50 (Compound 2) = 6.22 μg / mL, IC 50 (Compound 4) = 2.36 μg / mL, IC 50 (Compound 8) = 0.53 μg / mL. The inventive method was used to screen out inhibitor compounds 1, 2, 4, and 8 that are effective for the pore-forming activity of LLO.

Claims

1. A method for in vitro screening of inhibitors of Listeria monocytogenes hemolysin O, characterized in that: Through the protein labeling method, fluorescent small molecule pairs with fluorescence resonance energy transfer effect are respectively labeled with hemolysin O. The pore-forming activity of Listeria monocytogenes hemolysin O in the solution is monitored by the fluorescence resonance energy transfer effect between the fluorescent small molecules, and then the pore-forming inhibitors of hemolysin O are screened in vitro.

2. The method for in vitro screening of inhibitors of Listeria monocytogenes O according to claim 1, characterized in that: The protein tag is fused to the hemolysin O protein, and then the FRET donor-acceptor fluorescent small molecule pair is covalently labeled to the hemolysin O through the specific binding of the tag protein to the substrate. The pore-forming activity of Listeria monocytogenes hemolysin O is then monitored through the fluorescence resonance energy transfer effect between the fluorescent small molecules, and the pore-forming inhibitors of hemolysin O are screened in vitro.

3. The method for in vitro screening of Listeria monocytogenes hemolysin O inhibitors according to claim 2, characterized in that: The protein tag is fused to the C-terminus of the hemolysin O protein, wherein the protein tag can be selected from SNAP and Halo.

4. The method for in vitro screening of Listeria monocytogenes hemolysin O inhibitors according to claim 2, characterized in that: The FRET donor-acceptor fluorescent small molecule pair can be Cy3-Cy5, fluorescein-rhodamine 6G, Alexa488-Alexa555, Alexa488-Cy3, Aze-543 dyes.

5. The method for in vitro screening of inhibitors of Listeria monocytogenes O according to any one of claims 1 to 4, characterized in that: (1) covalently labeling the FRET donor-acceptor fluorescent small molecules with specific substrates of the tag protein to the hemolysin O-protein tag fusion protein and purifying them; (2) adding 1:0.2-1:5 molar ratio of FRET donor-acceptor fluorescently labeled hemolysin O to the solution, and adding the molecule to be screened or the control at the same time, mixing well, and standing for 1-30 minutes; (3) Add 10-500 μg / mL cholesterol to the above solutions and incubate for 5-30 minutes. (4) exciting with a fluorescence donor wavelength and collecting the fluorescence spectrum; (5) Analyze the spectral data and screen out inhibitors of Listeria monocytogenes hemolysin O.

6. The method for in vitro screening of inhibitors of Listeria monocytogenes O according to claim 5, characterized in that: The step (5) analyzes the spectral data and first calculates the ratio of the maximum emission peak of the fluorescent acceptor (A) to the maximum emission peak of the fluorescent donor (D). A / D , and then the following formula is used to calculate the inhibition efficiency of the sample in inhibiting hemolysin O pore formation, and then the inhibitor of Listeria monocytogenes hemolysin O is obtained, 7. The method for in vitro screening of Listeria monocytogenes hemolysin O inhibitors according to claim 4, characterized in that: The screening revealed that the Listeria monocytogenes hemolysin O inhibitor can inhibit the pore formation of hemolysin O.

8. An inhibitor screened out by the method for in vitro screening of Listeria monocytogenes hemolysin O inhibitors according to claim 1, characterized in that: The structure is shown in the figure below 9. A use of the Listeria monocytogenes hemolysin O inhibitor according to claim 8, characterized in that: Application of the inhibitor in drugs for treating Listeria monocytogenes infection.

Images