Vine cutting disease resistance related protein ibceil1 and related biological materials and applications thereof

Abstract

The application discloses a vine cutting disease resistance related protein IbCEIL1 and related biological materials and application. The application aims to solve how to regulate the vine cutting disease resistance of plants. The IbCEIL1 is any one of the following proteins: A1) a protein with an amino acid sequence shown in sequence 2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues of the protein in A1), the protein having more than 80% identity with the protein shown in A1) and having the function of regulating the vine cutting disease resistance of plants; and A3) a fusion protein obtained by connecting an N terminal or / and C terminal of A1) or A2) with a protein tag. A substance for inhibiting or reducing or down-regulating IbCEIL1 gene expression can be used for improving the vine cutting disease resistance of sweet potatoes or for breeding sweet potatoes with vine cutting disease resistance.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the vine disease resistance-related protein IbCEIL1I and its related biomaterials and applications. Background Technology

[0002] Sweet potato (Ipomoea batatas (L.) Lam.) is a hexaploid plant belonging to the Convolvulaceae family, Ipomoea genus, and Section Batatas. It is an important food, feed, industrial raw material, and new energy crop, making its position particularly important. Sweet potato vine rot is a serious fungal disease affecting sweet potato production and storage, severely impacting yield and quality, and even causing total crop failure. It has long been a major disease problem hindering the development of the sweet potato industry.

[0003] Sweet potato wilt, also known as Fusarium oxysporum f.sp. batatas, is a fungal disease and a major disease affecting sweet potato growing areas in southern my country. Field symptoms include yellowing and leaf drop from the bottom up, browning of the vascular bundles in the stem, eventually stem cracking, and ultimately, death of the entire plant. Both stems and leaves can be infected, and the pathogen is spread by insects, making it difficult to control once it spreads in the field. Sweet potato wilt infection can cause a 10%–20% yield reduction, with severe cases resulting in losses exceeding 50%. Chemical control is costly, pollutes the soil and other environmental factors, and long-term use can lead to drug resistance. Currently, breeding and promoting disease-resistant varieties is a safe and effective control measure.

[0004] Besides resistance genes, plants also contain a large number of susceptibility (S) genes, which are often manipulated by pathogens to disrupt the host's defense system. Discovering and mutating susceptibility (S) genes exploited by pathogens is of great significance for breeding crops with tolerance and broad-spectrum resistance. Genome editing technology has opened up new possibilities for modifying susceptibility (S) genes. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to regulate plant resistance to vine rot, such as sweet potato vine rot.

[0006] To solve the above-mentioned technical problems, the present invention provides any one of the following proteins:

[0007] A1) The amino acid sequence is that of the protein shown in sequence 2;

[0008] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in A1) that has more than 80% identity with the protein shown in A1) and has the ability to regulate plant resistance to vine pruning disease.

[0009] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0010] The protein mentioned above may be named IbCEIL1 and may be derived from sweet potato.

[0011] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0012] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.

[0013] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0014] In the protein described above, sequence 2 (SEQ ID No. 2) consists of 268 amino acid residues.

[0015] To address the aforementioned technical problems, the present invention also provides biomaterials related to the protein.

[0016] The biomaterial provided by this invention may be any of the following:

[0017] B1) RNA molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein or RNA molecules that inhibit, reduce, or downregulate the activity or content of the protein.

[0018] B2), genes that express the RNA molecules described in B1);

[0019] B3), an expression cassette containing the gene described in B2);

[0020] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);

[0021] B5) Recombinant microorganisms containing the gene described in B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4);

[0022] B6) A transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4);

[0023] B7) Transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4);

[0024] B8) Transgenic plant organs containing the gene described in B2), or transgenic plant organs containing the expression cassette described in B3), or transgenic plant organs containing the recombinant vector described in B4);

[0025] B9) Nucleic acid molecules encoding the protein;

[0026] B10), an expression cassette containing the nucleic acid molecule described in B9);

[0027] B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10;

[0028] B12) recombinant microorganisms containing the nucleic acid molecules described in B9), or recombinant microorganisms containing the expression cassette described in B10), or recombinant microorganisms containing the recombinant vector described in B11);

[0029] B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11;

[0030] B14) Transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11;

[0031] B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

[0032] In the above-mentioned biological materials, the RNA molecule described in B1) may be RNA transcribed from a DNA molecule as shown in formula (I):

[0033] SEQ forward - X - SEQ reverse (I);

[0034] The forward SEQ is a partial fragment of sequence 1; the reverse SEQ sequence is inversely complementary to the forward SEQ sequence; X is a spacer sequence between the forward and reverse SEQ sequences, causing the RNA molecule transcribed from the DNA molecule as shown in formula (I) to form a stem-loop structure. X may not be complementary to either the forward or reverse SEQ sequence. In formula (I), the nucleotide sequence of the forward SEQ sequence may specifically be positions 291 to 450 of sequence 1.

[0035] In the above-mentioned biological materials, the nucleic acid molecule described in B9) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0036] In the nucleic acid molecule described in B9), those skilled in the art can easily mutate the nucleotide sequence encoding the protein IbCEIL1 of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the protein IbCEIL1 isolated in the present invention, as long as they encode protein IbCEIL1 and have the function of protein IbCEIL1, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0037] The aforementioned 75% or higher identity can be 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0038] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0039] In the aforementioned biological materials, the nucleic acid molecule described in B9) may be the gene encoding the protein. Specifically, the nucleic acid molecule described in B9) may be a DNA molecule whose coding sequence is shown in Sequence 1.

[0040] In this document, the vectors described are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be vectors pFGC5941 and / or pCAMBIA1300 and / or vector pEASY-Blunt simple;

[0041] In the aforementioned biological materials, the expression cassettes described in B3) and B10) refer to DNA capable of expressing the gene in a host cell. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically inducible promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by jasmonic acid methyl ester); heat shock promoter (US Patent 5,187,267); tetracycline inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator (see, for example, Odell et al. (I)). 985 Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res. 15:9627.

[0042] In B11) above, a recombinant expression vector containing the gene expression cassette can be constructed using a plant expression vector. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When constructing a recombinant expression vector using IbCEIL1, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0043] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants that encode enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0044] To address the aforementioned technical problems, this invention also provides the use of any of the following materials in regulating plant resistance to vine rot, preparing products that regulate plant resistance to vine rot, or in plant breeding:

[0045] The protein described in C1);

[0046] C2) Substances that regulate the expression of genes encoding proteins;

[0047] C3) Substances that regulate the activity or content of the protein.

[0048] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein IbCEIL1.

[0049] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0050] In this invention, the purpose of plant breeding may include cultivating plants resistant to vine rot. The plants described herein may be any of the following: c1) dicotyledonous or monocotyledonous plants; c2) tubular flower order plants; c3) Convolvulaceae family plants; c4) Ipomoea genus plants; c5) sweet potato.

[0051] In the above-mentioned uses, the substance C2) or C3) is the aforementioned biological material.

[0052] To address the aforementioned technical problems, this invention also provides a method for regulating plant resistance to vine rot.

[0053] The method for regulating plant resistance to vine rot provided by the present invention includes regulating plant resistance to vine rot by regulating the expression of the gene encoding the protein or regulating the activity or content of the protein.

[0054] In this application, the regulation can be up-regulation, enhancement, or increase, or it can be down-regulation, suppression, or reduction.

[0055] In this invention, the regulation of plant resistance to vine cutting disease can be achieved by upregulating, enhancing, or increasing plant resistance to vine cutting disease, or by downregulating, inhibiting, or reducing plant resistance to vine cutting disease.

[0056] In this invention, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0057] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0058] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0059] The above-mentioned uses may specifically include the use of substances that inhibit, reduce, or downregulate the expression of the encoded gene in upregulating, enhancing, or increasing plant resistance to vine rot; the use of substances that inhibit, reduce, or downregulate the expression of the encoded gene in cultivating plants resistant to vine rot; and the use of substances that upregulate, enhance, or increase the expression of the encoded gene in inhibiting, reducing, or downregulating plant resistance to vine rot.

[0060] To address the aforementioned technical problems, this invention also provides a method for cultivating plants resistant to vine rot.

[0061] The method for cultivating vine-resistant plants provided by the present invention includes downregulating, inhibiting, or reducing the expression level of the gene encoding the protein in the target plant to obtain vine-resistant plants, wherein the vine-resistant plants have higher resistance to vine disease than the target plant.

[0062] To address the aforementioned technical problems, this invention also provides a method for cultivating plants susceptible to vine pruning disease.

[0063] The method for cultivating plants susceptible to vine cutting disease provided by the present invention includes upregulating, enhancing, or increasing the expression level of the gene encoding the protein in the target plant to obtain plants susceptible to vine cutting disease, wherein the plants susceptible to vine cutting disease have lower resistance to vine cutting disease than the target plant.

[0064] In this invention, the plant may specifically be any of the following:

[0065] C1) Dicotyledons or monocotyledons;

[0066] C2) Plants of the order Tubularflorales,

[0067] C3) Convolvulaceae family plants,

[0068] C4) Sweet potato plants.

[0069] C5) Sweet potato.

[0070] This invention introduces the IbCEIL1 protein gene (IbCEIL1 gene) into sweet potato (also known as wild type) to obtain transgenic sweet potatoes overexpressing the IbCEIL1 gene. Silencing the endogenous IbCEIL1 gene in wild-type sweet potatoes via RNA interference yields transgenic sweet potatoes with a silenced IbCEIL1 gene. Experiments show that transgenic sweet potatoes overexpressing the IbCEIL1 gene have lower resistance to vine blight than wild-type sweet potatoes, and wild-type sweet potatoes have lower resistance to vine blight than transgenic sweet potatoes with a silenced IbCEIL1 gene. This indicates that the IbCEIL1 gene and its encoded protein play an important role in plant disease resistance. This invention clones and identifies a sweet potato susceptibility (S) protein, IbCEIL1. Silencing this protein significantly improves the resistance of sweet potato plants to vine blight, providing a new strategy, new ideas, and an important candidate gene for molecular breeding of sweet potato disease resistance. Substances that inhibit, reduce, or downregulate IbCEIL1 gene expression can be used to improve sweet potato resistance to vine blight or for breeding sweet potato vine blight resistance. Attached Figure Description

[0071] Figure 1 The results are from the PCR amplification of transgenic sweet potato plants.

[0072] Figure 2 The results are RT-qPCR of transgenic sweet potato plants.

[0073] Figure 3 The results of inoculation (dip method) for sweet potato plant vine rot identification; B's vertical axis is the number of infected leaves (leaf / plant), and the horizontal axis is different strains; C's vertical axis is the length of diseased stem segment (cm / plant), and the horizontal axis is different strains.

[0074] Figure 4 Results of inoculation (strip method) for sweet potato plant vine rot identification; the vertical axis of B is the length of diseased stem segment (cm / plant), and the horizontal axis is different strains; there are no significant differences between treatments with the same letter at the 0.05 level, and there are significant differences between treatments with different letters at the 0.05 level. Detailed Implementation

[0075] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0076] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0077] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0078] Chestnut Fragrance (Wang Yuping et al., In vitro screening and identification of drought-resistant mutants of sweet potato, Chinese Agricultural Science, 2003, 36(9): 1000-1005) is a sweet potato variety that can be obtained by the public from the Sweet Potato Genetics and Breeding Research Laboratory of China Agricultural University to replicate this experiment.

[0079] ND98 (He Shaozhen. In vitro screening of salt-tolerant mutants of sweet potato and cloning of salt-tolerant candidate genes, Doctoral dissertation of China Agricultural University, 2008) is a salt-tolerant mutant of sweet potato, which can be obtained by the public from the Sweet Potato Genetics and Breeding Research Laboratory of China Agricultural University to replicate this experiment.

[0080] The cloning vector pMD19-T is a product of Takara Bio Engineering (Dalian) Co., Ltd., product catalog number 6013. The vector pCambia1300-GFP is a product of Cambia Biotechnology Co., Ltd. (PrimeScript) TM The 1st Strand cDNA Synthesis Kit is a product of Takara Bio Engineering (Dalian) Co., Ltd., with product catalog number 6110A.

[0081] The vector pFGC5941 is described in the following literature: K McGinnis, et al. Transgene-induced RNA interference as a tool for plant functional genomics. Methods in Enzymology, 2005, 392:1-24. It is available to the public from the Sweet Potato Genetics and Breeding Research Laboratory of China Agricultural University to replicate this experiment.

[0082] The vector pCambia1300-GFP used in the following examples is a product of Beijing Huayueyang Biotechnology Co., Ltd. Its product number is Beijing Huayueyang Biotechnology VECT0460.

[0083] The sweet potato vine-cutting pathogen and PDA culture medium are described in the following literature: Hu Xun, Yu Ping, Fang Yihong, Li Wei. Induced resistance of sweet potato vine-cutting pathogen to sweet potato and determination of the properties of PR protein. Journal of Fujian Normal University (Natural Science Edition), November 2007.

[0084] Example 1: Obtaining the IbCEIL1 gene

[0085] The steps to obtain the IbCEIL1 gene are as follows:

[0086] 1. Using the sweet potato disease resistance gene IbC3H18, which has been studied in the laboratory, the interacting gene IbCEIL1 was obtained through screening of a sweet potato yeast two-hybrid library. The diploid ORF sequence of this gene was obtained by comparison with the sweet potato diploid genome database, and primers IbCEIL1-F:5'-ATGGAAGGATCATCTGATGATCG-3' and IbCEIL1-R:5'-CTAGGGATCGGGGAGCACG-3' were artificially synthesized. Total RNA was extracted from the young leaf organs of ND98 using a plant total RNA extraction kit. This total RNA was then processed using PrimeScript. TM The 1st Strand cDNA Synthesis Kit reverse transcribes the first-strand cDNA.

[0087] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using IbCEIL1-F and IbCEIL1-R primers. This amplified cDNA was then ligated to the cloning vector pMD19-T to obtain recombinant plasmid 2. Recombinant plasmid 2 was sequenced to obtain the IbCEIL1 CDS sequence of the Xushu No. 3 gene.

[0088] The results showed that the nucleotide sequence of the PCR amplification product obtained in step 2 was as shown in sequence 1 of the sequence listing. The gene represented by this sequence was named the IbCEIL1 gene, and the protein it encodes was named the IbCEIL1 protein or protein IbCEIL1. The amino acid sequence was as shown in sequence 2 of the sequence listing.

[0089] Example 2: Regulating sweet potato vine blight resistance using a substance that regulates the expression of the gene encoding the protein IbCEIL1.

[0090] I. Construction of recombinant plasmids encoding the gene that regulates the expression of the protein IbCEIL1

[0091] A. Construction of the recombinant plasmid pCambia1300-IbCEIL1-GFP for upregulating the expression of the gene encoding the protein IbCEIL1.

[0092] 1. A synthetically produced double-stranded DNA molecule as shown in Sequence 1 of the sequence listing. Using this double-stranded DNA molecule as a template, IbCEIL1-OE-F:5'-GG GGTACC ATGGAAGGATCATCTGATGATCG-3' (underlined part is the KpnI restriction site), and IbCEIL1-OE-R: 5'-ACGC GTCGAC Using primers GGGATCGGGGAGCACG' (the underlined part is the Sal I restriction site) for PCR amplification, a double-stranded DNA molecule containing restriction endonuclease KpnI at one end and restriction endonuclease SalI at the other end was obtained.

[0093] 2. The vector pCambia1300-GFP was digested with restriction endonucleases KpnI and SalI to recover the large fragment. At the same time, the double-stranded DNA molecule obtained in step 1 was digested with restriction endonucleases KpnI and SalI to recover the small fragment.

[0094] 3. The large fragment was ligated with the small fragment to obtain the recombinant plasmid pCambia1300-IbCEIL1-GFP.

[0095] Based on sequencing results, the structure of the recombinant plasmid pCambia1300-IbCEIL1-GFP is described as follows: The small fragment between the restriction endonuclease KpnI and SalI recognition sequences of the recombinant plasmid pCambia1300-GFP was replaced with the DNA molecule shown in Sequence 1 of the sequence listing. The recombinant plasmid pCambia1300-IbCEIL1-GFP expresses the IbCEIL1 protein shown in Sequence 2 of the sequence listing. The recombinant plasmid pCambia1300-IbCEIL1-GFP contains an expression cassette of the IbCEIL1 gene, and the promoter in this cassette that initiates transcription of the IbCEIL1 gene is... CaMV35S starter .

[0096] B. Construction of the recombinant plasmid pFGC5941-IbCEIL1 for downregulating the expression of the gene encoding the protein IbCEIL1.

[0097] 1. Using sequence 1 as a template, primer IbCEIL1-Ri-UF: 5'-TTTGGAGAGGACACG CTCGAG TTTCTTTGATGATGATATCGAGAAA-3' (underlined part is the XhoI restriction site) and IbCEIL1-Ri-UR: 5'-AGAAATTCTTACAC ATTTAAAT The DNA fragment A was obtained by PCR amplification of the fragment CCGCATGGAGTTCTCCACACAAGAG' (the underlined part is the SwaI restriction site).

[0098] 2. After completing step 1, digest DNA fragment A with restriction endonucleases XhoI and SwaI, and recover fragment 1 of 160 bp.

[0099] 3. The vector pFGC5941 was digested with restriction endonucleases XhoI and SwaI to recover approximately 10 kb of the vector backbone.

[0100] 4. Connect fragment 1 to vector backbone 1 to obtain recombinant plasmid pFGC5941-U.

[0101] 5. The vector pFGC5941-U was digested with restriction endonucleases BamHI and XbaI, and approximately 10 kb of the vector backbone was recovered.

[0102] 6. Using sequence 1 as a template, use primer IbCEIL1-Ri-DF: 5'-AATTTGCAGGTATTT GGATCC CCGCATGGAGTTCTCCACACAAGAG-3' (underlined part is the BamHI restriction site) and IbCEIL1-Ri-DR: 5'-GGTCTTAATTAACTC TCTAGA PCR amplification was performed on TTTCTTTGATGATGATATCGAGAAA' (the underlined part is the XbaI restriction site) to obtain DNA fragment B.

[0103] 7. After completing step 6, digest DNA fragment B with restriction endonucleases BamHI and XbaI, and recover fragment 2 of 160 bp.

[0104] 8. The vector pFGC5941-U was digested with restriction endonucleases BamHI and XbaI, and approximately 10 kb of the vector backbone was recovered.

[0105] 9. Connect fragment B to vector backbone 2 to obtain recombinant plasmid pFGC5941-IbCEIL1.

[0106] Based on the sequencing results, the structure of the recombinant plasmid pFGC5941-IbCEIL1 is described as follows: The small fragment between the recognition sites of restriction endonucleases BamHI and XbaI in the vector pFGC5941 is replaced with the reverse complementary sequence of the DNA molecule shown in positions 291 to 450 from the 5′ end of Sequence 1 in the sequence listing; the small fragment between the recognition sites of restriction endonucleases XhoI and SwaI is replaced with the DNA molecule shown in positions 291 to 450 of Sequence 1 in the sequence listing.

[0107] The recombinant plasmid pFGC5941-IbCEIL1 contains an shRNA gene expression cassette for silencing the IbCEIL1 gene, and the promoter that initiates shRNA gene transcription in this cassette is the CaMV35S promoter.

[0108] The shRNA gene is encoded by the formula (I): SEQ forward-X-SEQ reverse (I);

[0109] The forward nucleotide sequence of the SEQ is positions 291 to 450 of sequence 1 in the sequence listing; the reverse nucleotide sequence of the SEQ is reverse complementary to the forward nucleotide sequence of the SEQ. X is a spacer sequence between the forward and reverse SEQ sequences, and X is not complementary to either the forward or reverse SEQ sequences. X causes the RNA molecule transcribed from the DNA molecule as shown in formula (I) to form a stem-loop structure.

[0110] II. Obtaining Recombinant Agrobacterium and Obtaining Transgenic Sweet Potato Plants

[0111] A. Obtaining transgenic positive sweet potato plants

[0112] 1. Transform Agrobacterium tumefaciens EHA105 with the recombinant plasmid pCambia1300-IbCEIL1-GFP to obtain recombinant Agrobacterium tumefaciens A, which is named EHA105 / pCambia1300-IbCEIL1-GFP.

[0113] 2. Extract meristems from the shoot tips of wild-type sweet potato (approximately 0.5 mm in length) and place them on MS solid medium (containing 2.0 mg / L 2,4-D and 3.0% sucrose) for embryogenic callus induction. Culture at 27±1℃ for 8 weeks to obtain embryogenic callus. Then, place the embryogenic callus in MS liquid medium (containing 2.0 mg / L 2,4-D and 3.0% sucrose) and culture on a horizontal shaker with alternating light and dark conditions for 3 days (specific conditions: 100 r / min; 27℃; light-dark cycle: 13 h light time, 11 h dark time; light intensity: 500 lx) to obtain embryogenic cell clusters with a diameter of 0.7-1.3 mm.

[0114] 3. After completing step 2, EHA105 / pCambia1300-IbCEIL1 was transformed into embryogenic cell clusters using Agrobacterium-mediated transformation, and then placed on co-medium (MS solid medium containing 30 mg / L AS and 2.0 mg / L 2,4-D) and cultured in the dark at 28°C for 3 days.

[0115] 4. After completing step 3, wash the embryonic cell mass twice with MS liquid medium containing 900 mg / L cefotaxime sodium (CS) and 2.0 mg / L 2,4-D, and then place it on selective medium (solid MS medium containing 2.0 mg / L 2,4-D, 300 mg / L CS and 0.25 mg / L or 0.5 mg / L hygromycin) and incubate in the dark at 27±1℃ for 10-12 weeks (the selective medium needs to be replaced every 2 weeks).

[0116] 5. After completing step 4, place the embryogenic cell mass on somatic embryo induction medium (containing 1.0 mg / L ABA and 300 mg / L CS MS solid medium) and culture at 27±1℃ with alternating light and dark conditions (the alternating light and dark culture cycle is: 13 h light time and 11 h dark time; light intensity is 3000 lx) for 2-4 weeks to obtain resistant callus tissue.

[0117] 6. After completing step 5, place the resistant callus on MS solid medium and culture at 27±1℃ with alternating light and dark (13h light time, 11h dark time; 3000lx light intensity) for 4-8 weeks to obtain 32 sweet potato transgenic plants, named OE-1 to OE-32 respectively.

[0118] 7. Extract genomic DNA from the young leaf organs of the sweet potato transgenic plants obtained in step 6. Using this genomic DNA as a template, perform PCR amplification using primers 35S-F: 5′-AGGAAGTTCATTTCATTTGGAGA-3′ (corresponding to the 35S promoter of the IbCEIL1 gene in pCambia1300-IbCEIL1-GFP) and IbCEIL1-TR: 5′-CTAGGGATCGGGGAGCACG-3′ (corresponding to the 3′ end of sequence 1). If the PCR amplification product contains a band of approximately 1000 bp, the corresponding sweet potato transgenic plant is a positive transgenic plant. Replace the genomic DNA from the young leaf organs of the sweet potato transgenic plants with an equal volume of water as a negative control. Replace the genomic DNA from the young leaf organs of the wild-type sweet potato variety Chestnut Fragrance as a control. The recombinant plasmid pCambia1300-IbCEIL1-GFP was used to replace the genomic DNA of the young leaf organs of the sweet potato transgenic plant and was used for PCR amplification as a positive control.

[0119] The experimental results are shown in Figure 1 In the data, A (M is the DNA molecular marker, W is the negative control, and P is the positive control), WT is the genomic DNA of the young leaf organs of wild-type sweet potato cultivar Chestnut Fragrance, and OE-3, OE-4, OE-5, OE-6, OE-11, OE-12, OE-13, OE-14, OE-18, OE-19, OE-21, OE-22, OE-23, OE-24, OE-25, OE-26, OE-27, OE-28, OE-29, and OE-31 are all transgenic positive sweet potato plants.

[0120] 8. The transcriptional level of IbCEIL1 in different transgenic lines was detected by RT-qPCR, and the results are as follows: Figure 2 As shown, the transcription level of IbCEIL1 was significantly increased in all transgenic lines. The RT-qPCR primers for the IbCEIL1 gene were qPCR-F: 5′-GTGTGGAGAACTCCATGCG-3′ and IbCEIL1-TR: 5′-TCGTGTGCCCACATTTCGT-3′. Three lines with high expression levels, OE-4, OE-27, and OE-31, were selected for subsequent vine pruning disease inoculation experiments.

[0121] Total RNA was extracted from transgenic positive sweet potato plants, and cDNA was obtained by reverse transcription. qRT-PCR was then performed, with wild-type sweet potato plants as a control. The constitutively expressed sweet potato actin gene was used as an internal control to homogenize the cDNA concentration in the samples. Real-time quantitative PCR (RT-qPCR) analysis was then performed using gene-specific primers. -△△CT Method (Livak KJ,Schmittgen TD.2001.Analysis of relative gene expression data using real-timequantitative PCR and the 2 -△△CT Methods. 25:402-408) was used to analyze the expression of the IbCEIL1 gene, with each sample repeated three times. The specific primer sequences for the sweet potato actin gene were:

[0122] IbActin-F: 5′-AGCAGCATGAAGATTAAGGTTGTAGCAC-3′

[0123] IbActin-R: 5′-TGGAAAATTAGAAGCACTTCCTGTGAAC-3′

[0124] (Please modify this experimental method according to the actual situation.)

[0125] Data were processed using Prism 8 statistical software. Experimental results are expressed as mean ± standard deviation. A one-way ANOVA was performed followed by a post-hoc Tukey test. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference. Different letters indicate statistical significance.

[0126] B. Obtaining sweet potato RNAi-positive plants

[0127] 1. The recombinant plasmid pFGC5941-IbCEIL1 was transformed into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens B, which was named EHA105 / pFGC5941-IbCEIL1.

[0128] 2. Following the steps 2 to 6 in step A, replace EHA105 / pCambia1300-IbCEIL1 with EHA105 / pFGC5941-IbCEIL1, keeping all other steps unchanged, to obtain two sweet potato RNAi plants, named Ri-2 and Ri-5 respectively.

[0129] 3. Extract genomic DNA from the young leaf organs of the sweet potato RNAi plants obtained in step 2. Using this genomic DNA as a template, perform PCR amplification with primers int-F:5′-CAACCACAAAAGTATCTATGAGCCT-3′ and int-R:5′-TTCACATGTCAGAAACATTCTGATG-3′ to obtain PCR amplification products. If the PCR amplification product contains an 848bp band, the corresponding sweet potato RNAi plant is a positive sweet potato RNAi plant. Replace the genomic DNA of the young leaf organs of the sweet potato RNAi plants with an equal volume of water as a negative control. Replace the genomic DNA of the young leaf organs of the wild-type sweet potato variety Chestnut Fragrance with the genomic DNA of the young leaf organs of the sweet potato RNAi plants as a control. Replace the genomic DNA of the young leaf organs of the sweet potato RNAi plants with the recombinant plasmid pFGC5941-IbCEIL1 as a positive control.

[0130] The experimental results are shown in Figure 1 In the middle B (M is the DNA molecular marker, W is the negative control, and P is the positive control), WT is the genomic DNA of the young leaf organs of the wild-type sweet potato variety Chestnut Fragrance, and Ri-5 and Ri-2 are both sweet potato RNAi positive plants.

[0131] The expression of the IbCEIL1 gene in Ri-2 and Ri-5 was detected according to the method in step A, 8. The results are as follows: Figure 2 As shown, the transcriptional level of the IbCEIL1 gene in Ri-2 and Ri-5 was significantly lower than that in the wild type of Chestnut Fragrance.

[0132] The transgenic positive sweet potato plants OE-4, OE-27, and OE-31 were propagated asexually. Plants obtained from the propagation of a single transgenic seedling were used as a line to obtain IbCEIL1 overexpression lines OE-4, OE-27, and OE-31 (hereinafter referred to as overexpression lines OE-4, OE-27, and OE-31).

[0133] The sweet potato RNAi-positive plants Ri-2 and Ri-5 were propagated asexually. Plants propagated from a single transgenic seedling were used as a line to obtain the interference lines Ri-2 and Ri-5.

[0134] III. Identification of Climbing Disease Resistance in Transgenic Plants

[0135] The sweet potato lines to be tested were ND98, the sweet potato variety Chestnut Fragrance (WT), overexpression lines OE-4, OE-27, and OE-31, and interference lines Ri-2 and Ri-5. The experiment was repeated three times, with the following steps for each repetition:

[0136] 1. Inoculation for vine disease (dip method)

[0137] a. Inoculate the isolated vine-cutting pathogen onto PDA medium and incubate at 28°C for 5-7 days to promote conidia production. Once the mycelium has covered the surface of the culture dish, it is ready for use.

[0138] b. Using an inoculation needle, scrape off the mycelium from the surface of the colony and transfer it to an Erlenmeyer flask. Add an appropriate amount of sterile distilled water, shake at 100 rpm for 30 minutes to mix the bacterial suspension, then filter through double-layered sterile gauze. Count the filtrate using a hemocytometer under a microscope, and adjust the spore suspension concentration to 1 × 10⁻⁶. 7 cfu / ml, used as inoculation solution for later use.

[0139] c. After aligning the cuts of potato seedlings with uniform growth, immerse them in a suspension of vine-cutting pathogens for 30 minutes. After removing them, insert them into sterile sandy loam soil for cultivation, with 3 seedlings per pot. During this period, pay attention to watering and maintaining moisture.

[0140] d. Observe the growth of the plants and count the disease index after 9 days.

[0141] See results Figure 3 In the A-group, WT and IbCEIL1 overexpression lines showed obvious yellowing of leaves and disease symptoms 5 days after inoculation, with the yellowing being more pronounced in the IbCEIL1 overexpression lines. ND98 and the interference lines showed good growth. 7 days after inoculation, the lower leaves of the IbCEIL1 overexpression lines began to fall off, the leaves of the interference lines began to turn yellow, and a few leaves of ND98 began to turn yellow. 9 days after inoculation, most leaves of the overexpression lines withered and fell off, and some stem segments turned brown and softened. Some older leaves of the WT lines withered and fell off, and the stem segments showed a slight browning. ND98 grew normally, and some leaves of the interference lines turned yellow. Statistical results showed that the number of infected leaves and the length of browned stem segments in the overexpression lines were significantly higher than those in the WT lines, while the interference lines showed the opposite trend. Figure 3 Among the B and C varieties, ND98 had the lowest number of infected leaves and the lowest length of browned stem segments.

[0142] 2. Inoculation for vine disease (strip method)

[0143] a. Inoculate the isolated vine-cutting pathogen onto PDA medium and incubate at 28°C for 5-7 days to promote conidia production. Once the mycelium has covered the surface of the culture dish, it is ready for use.

[0144] b. Using an inoculation needle, scrape off the mycelium from the surface of the colony and transfer it to an Erlenmeyer flask. Add an appropriate amount of sterile distilled water, shake at 100 rpm for 30 minutes to mix the bacterial suspension, and then filter through double-layered sterile gauze. Count the filtrate using a hemocytometer under a microscope, and adjust the spore suspension concentration to approximately 1 × 10⁻⁶. 7 cfu / ml, to be used as inoculation solution;

[0145] c. Soak sterile cotton pads in the inoculation solution prepared in the previous step. Use a sterile blade to make a 1cm long wound on the sweet potato stem segment. Wrap the wound with the soaked cotton pad and cover it with sealing film to keep it moist. Insert all the inoculated stem segments into sterile floral foam. During this period, pay attention to watering and keeping the soil moist.

[0146] d. Observe the disease status of the stem segments, and measure the length of the diseased stem segments after 7 days.

[0147] See results Figure 4 In the A-group, stem segments of WT and IbCEIL1 overexpressing lines developed symptoms from the wound site, gradually turning brown, with vascular bundle rupture and hollowing. Stem segments of ND98 and the interference lines showed good growth. The length of diseased stem segments in the IbCEIL1 overexpressing lines OE-27 and OE-31 was significantly longer than that in WT. The length of diseased stem segments in the ND98 and interference lines was significantly shorter than that in the WT and IbCEIL1 overexpressing lines. Figure 4 (B)

[0148] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A vine disease resistance-related protein, IbCEIL1, characterized in that, Its amino acid sequence is shown in Sequence 2.

2. A biomaterial related to the protein IbCEIL1 of claim 1, characterized in that, The biomaterial is any one of the following: B1), an RNA molecule that inhibits, reduces, or downregulates the expression of the gene encoding the protein IbCEIL1, or an RNA molecule that inhibits, reduces, or downregulates the activity or content of the protein IbCEIL1; said RNA molecule is RNA transcribed from a DNA molecule as shown in formula (I): SEQ forward - X - SEQ reverse (I); The forward SEQ is positions 291-450 of sequence 1; the reverse SEQ is the reverse complementary sequence to the forward SEQ; X is the spacer sequence between the forward SEQ and the reverse SEQ, such that the RNA molecule transcribed from the DNA molecule as shown in formula (I) forms a stem-loop structure. B2) The gene encoding the RNA molecule described in B1); B3), an expression cassette containing the gene described in B2); B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3); The carrier is pFGC5941; B5), recombinant Agrobacterium containing the gene described in B2), or recombinant Agrobacterium containing the expression cassette described in B3), or recombinant Agrobacterium containing the recombinant vector described in B4); B6) A transgenic plant cell line containing the gene described in B2), or a transgenic plant cell line containing the expression cassette described in B3), or a transgenic plant cell line containing the recombinant vector described in B4); B7) Transgenic plant tissue containing the gene described in B2), or transgenic plant tissue containing the expression cassette described in B3), or transgenic plant tissue containing the recombinant vector described in B4); B8) Transgenic plant organs containing the gene described in B2), or transgenic plant organs containing the expression cassette described in B3), or transgenic plant organs containing the recombinant vector described in B4); B9), a nucleic acid molecule encoding the protein IbCEIL1; B10), an expression cassette containing the nucleic acid molecule described in B9); B11), a recombinant vector containing the nucleic acid molecule described in B9), or a recombinant vector containing the expression cassette described in B10; B12) recombinant microorganisms containing the nucleic acid molecules described in B9), or recombinant microorganisms containing the expression cassette described in B10), or recombinant microorganisms containing the recombinant vector described in B11); B13), a transgenic plant cell line containing the nucleic acid molecule described in B9), or a transgenic plant cell line containing the expression cassette described in B10), or a transgenic plant cell line containing the recombinant vector described in B11; B14) Transgenic plant tissue containing the nucleic acid molecule described in B9), or transgenic plant tissue containing the expression cassette described in B10), or transgenic plant tissue containing the recombinant vector described in B11; B15), a transgenic plant organ containing the nucleic acid molecule described in B9), or a transgenic plant organ containing the expression cassette described in B10), or a transgenic plant organ containing the recombinant vector described in B11).

3. The biomaterial according to claim 2, characterized in that, B9) The coding sequence of the nucleic acid molecule is the DNA molecule shown in Sequence 1.

4. The use of any of the following materials in improving sweet potato vine blight resistance, preparing products that improve sweet potato vine blight resistance, or cultivating vine blight-resistant sweet potatoes: C1) A substance that inhibits, reduces, or downregulates the expression of the gene encoding the protein IbCEIL1 of claim 1; C2) A substance that inhibits, reduces, or downregulates the activity or content of the protein IbCEIL1 as described in claim 1.

5. The use according to claim 4, characterized in that: The substance described in C1) or C2) is the biomaterial B1)-B8 as described in claim 2.

6. A method for improving plant resistance to vine blight, characterized in that, The method includes improving plant resistance to vine vine disease by inhibiting or reducing or downregulating the expression of the gene encoding the protein IbCEIL1 of claim 1, or inhibiting or reducing or downregulating the activity or content of the protein IbCEIL1 of claim 1; the plant is sweet potato.

7. A method for cultivating vine-resistant plants, comprising downregulating, inhibiting, or reducing the expression level of the gene encoding the protein IbCEIL1 of claim 1 in a target plant to obtain vine-resistant plants, wherein the vine-resistant plants exhibit higher resistance to vine disease than the target plant; wherein the plant is sweet potato.

Images