Application of lncRNA as target spot in tissue damage repair

Abstract

The invention relates to the technical field of biological medicine, in particular to application of lncRNA as a target spot in tissue damage repair. Experimental exploration finds that lncRNA Brip1os participates in repair after tissue injury, particularly participates in early repair after liver and skeletal muscle injury, and possibly regulates regeneration of skeletal muscle through an interferon (IFN) related mechanism.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of lncRNA as a target in tissue damage repair. Background Art

[0002] Long noncoding RNA (LncRNA) is a class of long noncoding RNA with a length greater than 200 nt, and is an important component of the noncoding genome. The biogenesis site of lncRNA is the cell nucleus, and most lncRNAs can be transcribed from intergenic, exon or distal protein coding regions of the genome by RNA polymerase II. To improve its stability, immature lncRNAs undergo post-transcriptional processing, i.e. polyadenylation at the 3' end and capping at the 5' end. Subsequently, 98% of lncRNAs undergo alternative splicing, which is essential for the generation of protein diversity. lncRNAs contain fewer exons, so shorter transcripts are produced after splicing. The last step of lncRNA biogenesis is to form a thermodynamically stable structure that enables it to interact with proteins, DNA and other RNA molecules. Mature lncRNAs can exist in the nucleus or cytoplasm. lncRNAs in the nucleus control the expression of nuclear genes by interacting with DNA, chromatin modification complexes and / or various transcriptional regulatory factors; cytoplasmic lncRNAs can act as sponges for other transcripts or proteins, or as protein templates, or regulate the degradation and translation of mRNA. In addition, lncRNAs can also be secreted into the extracellular matrix. A large number of studies have shown that lncRNAs are involved in a variety of biological processes, including DNA methylation, histone modification, RNA post-transcriptional regulation, and protein translation regulation, and are also involved in the regulation of various physiological and pathological processes. Summary of the invention

[0003] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a use of a lncRNA as a target in the preparation of a drug for treating tissue damage and repair, wherein the lncRNA is lncRNA Brip1os.

[0004] To achieve the above purpose, the technical solution adopted by the present invention is:

[0005] In a first aspect, the present invention provides a use of a lncRNA as a target in the preparation of a drug for treating tissue damage and repair, wherein the lncRNA is lncRNA Brip1os.

[0006] The present invention has found through data analysis and experimental research that during the growth and development of mice, the expression level of lncRNA Brip1os in the liver, muscle, and heart tissues of mice before and after birth has changed significantly; at the same time, the present invention has also found that during the repair of liver and skeletal muscle damage, the expression level of lncRNA Brip1os shows an upward trend. This indicates that lncRNA Brip1os is involved in the repair of tissue damage, especially in the early repair of liver and skeletal muscle damage.

[0007] Preferably, the tissue damage repair includes liver damage repair and muscle damage repair.

[0008] Preferably, the tissue damage repair includes early repair after tissue damage.

[0009] Preferably, the lncRNA Brip1os participates in tissue damage repair by regulating IFN-related response genes.

[0010] The present invention found in experimental research that after CTX injection caused muscle damage in mice, Ki67 was highly expressed, indicating that MuSCs proliferated rapidly at this stage. At the same time, IFN-related response genes Ifit1, Ifit3, and Ifit3b were upregulated. This suggests that lncRNABrip1os may regulate skeletal muscle regeneration through interferon (IFN)-related mechanisms.

[0011] Preferably, the IFN-related response genes include Ifit1, Ifit3, and Ifit3b.

[0012] In a second aspect, the present invention provides the use of a substance that increases the expression level of lncRNA Brip1os in the preparation of a drug for treating early repair of tissue damage.

[0013] In a third aspect, the present invention provides a drug for treating tissue damage and repair, comprising a substance that increases the expression level of lncRNA Brip1os.

[0014] The beneficial effects of the present invention are:

[0015] Epigenetic regulation has always been an important issue that has been pursued and explored in the field of RNA research. This study took lncRNA Brip1os as the entry point and found that Brip1os was significantly upregulated during the repair of liver and muscle damage, suggesting that Brip1os is involved in the process of post-injury repair. This will help to more comprehensively understand the molecular mechanism of lncRNA participating in the process of post-tissue repair, and is innovative in theory. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1These are the results of the expression test of Brip1os in the liver, muscle, and heart tissues at various stages of mouse development; Figure A shows the expression of Brip1os in liver tissue; Figure B shows the expression of Brip1os in muscle tissue; and Figure C shows the expression of Brip1os in heart tissue.

[0017] Figure 2 Figure 2 is the result of Brip1os participating in the liver injury and repair process; Figure A is a schematic diagram of constructing a mouse 2 / 3 liver resection model and taking samples on the 7th day after surgery (PHx-D7); Figure B is the expression detection result of Brip1os on the 7th day after liver resection surgery.

[0018] Figure 3 Figure 2 is the result of Brip1os participating in the early muscle damage repair process; Figure A is a schematic diagram of constructing a muscle damage repair model; Figures BD are the results of detecting Brip1os expression in damaged muscles on days 3, 5, and 7. The numbers on the far right represent different experimental mouse samples.

[0019] Figure 4 The results of RNA-seq analysis after knocking down lncRNA Brip1os; Figures AC are heat maps showing the significantly differentially expressed RNAs before and after three different siRNAs knocked down Brip1os; Figure D is a Venn diagram showing the differentially expressed RNAs detected in the three cells after knocking down lncRNA Brip1os.

[0020] Figure 5 This is an experimental verification of the results of RNA with significant differential expression before and after knocking down Brip1os; Figure A shows the Brip1os knockdown efficiency of two stable primary muscle cell lines with Brip1os knockdown; Figure B shows the qPCR verification results of the top 8 significantly changed RNAs selected from the RNA-seq data.

[0021] Figure 6 Figure 5 shows the qPCR test results of damaged muscles on the third day after CTX treatment; Figure A shows the RNA expression level test results of Ki67; Figure B shows the RNA expression level test results of IFN-related response genes Ifit1, Ifit3, and Ifit3b. DETAILED DESCRIPTION

[0022] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0023] Example 1: Detection of the expression of Brip1os in various tissues of mice after birth

[0024] Liver, muscle, and heart tissue samples were collected from embryonic day 12.5 (e12.5) to week 8 (8W) after birth, and the expression of lncRNABrip1o was detected and analyzed by qPCR.

[0025] Test results such as Figure 1 As shown, the liver of mice at various time points during embryonic development ( Figure 1 A) Muscles Figure 1 B) Heart Figure 1 C) In all tissues, Brip1os tends to be downregulated after birth, which suggests that Brip1os may be involved in the growth and development of tissues.

[0026] Example 2: Brip1os is involved in the liver damage and repair process

[0027] In order to explore the role of Briplos in regeneration and repair after liver injury, this example established a mouse 2 / 3 liver resection model. After anesthesia, the mice underwent liver resection surgery, and the left liver lobes and middle lobes were removed by laparotomy. After the abdomen was closed, the mice were fed normally, and samples were collected on the 7th day after surgery (PHx-D7). Figure 2 A).

[0028] Specific process of liver resection:

[0029] A. Before surgery, mice were not treated with special care and were allowed to drink water and eat freely. Mice (3 months old) were weighed and intraperitoneally injected with the anesthetic Avertin at 0.1 mL / 10 g body weight. After anesthesia, the hair at the surgical site of the abdomen was trimmed and the mice were placed on an operating table made of a foam board. Two "U"-shaped filaments were inserted into the foam board to fix the tail of the mouse.

[0030] B. Disinfect the skin with 75% alcohol and make an incision of approximately 3 cm along the midline of the abdomen from the xiphoid process downward to expose the xiphoid process.

[0031] C. Insert two sewing needles on the foam board on both sides of the mouse's shoulder, with the top of the needle slightly higher than the xiphoid process. Stretch the rubber band and tie it to the two needles, then put the rubber band on the xiphoid process to make it tilt up and expose the liver.

[0032] D. Use two small hooks to hook the peritoneum and skin on both sides of the incision, pull them parallel to both sides, fix the peritoneum, and expose the liver. Place a small stick with a diameter of 1 cm on the upper edge of the liver on the back of the mouse to fully expose the liver. Observe whether the anatomical structure of the mouse liver is normal.

[0033] E. Use a cotton swab moistened with saline to push aside the central leaflet and cut the catenary ligament with minimally invasive surgical scissors.

[0034] F. Use a moistened cotton swab to place the central lobe and the left lobule on the thoracic diaphragm to expose the hepatogastric ligament connecting the caudal lobule and the left lobule, and gently cut the ligament with minimally invasive surgical scissors.

[0035] G. Place a 4-0 suture at the root of the left hepatic lobule and use a cotton swab to restore the left lobule to its original position.

[0036] H. Tie the two ends of the thread at the base of the left lobule. Sometimes, the color of the left part of the central lobule will also change, but this phenomenon has no significant effect and will slowly return to normal.

[0037] I. Use small curved scissors to cut off the ligated part before the node. Only the removed part will bleed a small amount, and the remaining liver will not bleed.

[0038] J. Perform a second ligation and resection in the middle of the central lobule. Place a 4-0 suture in the middle of the central lobule of the liver, use a cotton swab to restore the central lobule to its original position, and tie a knot between the two ends of the thread. The second knot should not be too close to the hepatic vein, otherwise it will cause venous blockage, hinder blood circulation, lead to gangrene and regeneration failure. Place the knot next to the gallbladder, about 2 mm away from the hepatic vein.

[0039] K. When the second ligature is made, the suture will be embedded in the liver tissue, but there is usually no bleeding. The ligated central lobule is cut off outside the knot.

[0040] L. Use cotton balls to wipe the blood in the abdominal cavity, and then use 4-0 sutures to suture the peritoneum and skin in sequence.

[0041] M. After suturing, wipe the incision and surrounding skin with alcohol for disinfection, and place the mouse at room temperature to recover.

[0042] Testing of samples before and after liver regeneration revealed that lncRNABrip1os was upregulated on the seventh day after liver resection, indicating that it is involved in the process of liver regeneration and repair after liver injury ( Figure 2 B).

[0043] Example 3: Brip1os is involved in the early muscle damage repair process

[0044] In order to determine the function of lncRNABrip1os in vivo, this example detected the expression profile of lncRNABrip1os during acute skeletal muscle regeneration after cardiotoxin (CTX) injection. 25 μL of 10 μM CTX was injected into the tibialis anterior muscle of the left lower limb of mice to induce muscle damage and establish a muscle damage repair model; 25 μL of normal saline was injected into the right lower limb as a negative control. After mice were treated with CTX, muscle tissues and control muscle tissues were collected on days 3, 5, and 7 after injection ( Figure 3A), and then qPCR was used to detect the expression of Brip1os.

[0045] The results are as follows Figure 3 As shown in B-3D, the expression level of lncRNABrip1os was significantly upregulated in the CTX injection group, indicating that it is involved in the early muscle damage repair process.

[0046] Example 4: Knockdown of lncRNA Brip1os can significantly change the expression of a series of genes

[0047] This embodiment designs three pairs of different siRNAs targeting lncRNA Bripols (si-Brip1os-#1, si-Brip1os-#2, si-Brip1os-#3, respectively), and a pair of siRNAs not targeting any sequence (si-NC) as controls, which are transfected into C2C12 cells respectively, and cell RNA is collected 48 hours after transfection, and efficiency is detected by qPCR. After verifying the knockdown efficiency, RNA-seq detection was performed on three muscle cells with knockdown lncRNA Bripols and their control groups. The designed siRNA and qPCR primer sequences are shown in Table 1.

[0048] Table 1

[0049] Primer name Sequence(5’-3’) si-NC-F UUCUCCGAACGUGUCACGUTT si-NC-R ACGUGACACGUUCGGAGAATT si-Brip1os-#1-F GCUGCAUAUGAGCCUGAUATT si-Brip1os-#1-R UAUCAGGCUCAUAUGCAGCTT si-Brip1os-#2-F GCAGACCCAGAGUUACCAATT si-Brip1os-#2-R UUGGUAACUCUGGGUCUGCTT si-Brip1os-#3-F GCACAGUUCAGAUUAUAAUTT si-Brip1os-#3-R AUUAUAAUCUGAACUGUGCTT m-Brip1os-F TCCTCTTCCCAGAATGTCCCA m-Brip1os-R CAGTTCTTGGGGGCAGACTT

[0050] RNA-seq results show that knocking down lncRNA Brip1os can significantly change the expression of a series of genes. After analyzing the gene changes before and after different siRNA treatments, the present invention obtained a batch of RNAs with significant differential expression before and after knocking down Brip1os ( Figure 4 A-4C). After cross-comparison, 20 genes with significant differential expression in different siRNA treatments were screened ( Figure 4 D) conduct further research.

[0051] Example 5: Experimental verification of RNAs with significant differential expression before and after knockdown of Brip1os

[0052] Furthermore, this example screened the above RNA-seq data, selected the top RNAs differentially expressed in the three cell lines (including Ifit1, Ifit3, Ifit3b, Isg15, Ddx60, Apol9a, Rsad2, Gbp7), and performed qPCR experiments in two primary muscle cell stable strains with knockdown of Brip1os ( Figure 5)(primer sequences are shown in Table 2), the results were consistent with the sequencing results, among which Ifit1, Ifit3, and Ifit3b are interferon (IFN)-related response genes and are also downstream genes of Briplos. Therefore, the present invention confirms the changes in downstream genes in the sequencing results.

[0053] Table 2

[0054] Primer name Sequence(5’-3’) m-Ifit1-F CTGAGATGTCACTTCACATGGAA m-Ifit1-R GTGCATCCCCAATGGGTTCT m-Ifit3-F CTGAACTGCTCAGCCCACA m-Ifit3-R TTCCCGGTTGACCTCACTCA m-Ifit3b-F CCATGTTCCGCCTAGAAGAA m-Ifit3b-R TCTCCCATCCTCAGCAGTTT m-Isg15-F GGTGTCCGTGACTAACTCCAT m-Isg15-R TGGAAAGGGTAAGACCGTCCT m-Ddx60-F TTCCACTGCCCAAAATAGGAAAA m-Ddx60-R GCCAGCAACATGAGTCTTAGGAT m-Apol9a-F TCTGACATCCTGAGCCTCCTTGG m-Apol9a-R GCCAGTCGGAGCAGCTTCAAC m-Rsad2-F TGCTGGCTGAGAATAGCATTAGG m-Rsad2-R GCTGAGTGCTGTTCCCATCT m-Gbp7-F TCCTGTGTGCCTAGTGGAAAA m-Gbp7-R CAAGCGGTTCATCAAGTAGGAT

[0055] Example 6: Brip1os may regulate skeletal muscle regeneration through interferon (IFN)-related mechanisms

[0056] In previous studies, the present invention found that the expression of lncRNA Brip1os was significantly upregulated in the CTX injection group, indicating that it was involved in the regeneration process ( Figure 3 B). The early stage of muscle damage repair is the most intense period of inflammatory response. Among the downstream genes of Briplos, there is a group of genes that are interferon (IFN)-related response genes, such as Ifit1, Ifit3, and Ifit3b. This example detects the levels of proliferation-related genes and IFN-related response genes in the RNA of mouse muscle tissue on the third day of CTX injury.

[0057] The results are as follows Figure 5 As shown in Figure 2, Ki67, a proliferation marker, was highly expressed in the CTX-injected group, indicating that MuSCs proliferated rapidly at this stage ( Figure 6 A). At the same time, IFN-related response genes Ifit1, Ifit3, and Ifit3b were upregulated ( Figure 6 B).

[0058] These data suggest that lncRNA Brip1os is involved in the early stages of muscle regeneration and may be involved in the activation and proliferation of MuSCs through an IFN-related mechanism.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A use of lncRNA as a target in the preparation of a drug for treating tissue damage and repair, characterized in that: The lncRNA is lncRNA Brip1os.

2. The use according to claim 1, characterized in that The tissue damage repair includes liver damage repair and muscle damage repair.

3. The use according to claim 1, characterized in that The tissue damage repair includes early repair after tissue damage.

4. The use according to claim 1, characterized in that The lncRNA Brip1os participates in tissue damage repair by regulating IFN-related response genes.

5. The use according to claim 4, characterized in that The IFN-related response genes include Ifit1, Ifit3, and Ifit3b.

6. Use of substances that increase the expression level of lncRNA Brip1os in the preparation of drugs for treating early repair of tissue damage.

7. A drug for treating tissue damage and repair, characterized in that: Including substances that increase the expression level of lncRNA Brip1os.

Images