Marker for detecting hand-foot-and-mouth disease complicated nerve injury and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a marker for detecting hand-foot-and-mouth disease complicated nerve injury and application of the marker. According to the invention, the application of the miR-29b-3p as the marker in predicting the hand-foot-and-mouth disease complicated nerve injury is found for the first time. In an external verification queue, the existence of the marker cannot be completely detected in a serum sample of a patient with a nerve injury symptom, and the area under an ROC curve of the marker is 1, so that the marker can be used as the marker of the hand-foot-and-mouth disease complicated with the nerve injury and has excellent specificity and sensitivity. Furthermore, the invention finds that EV71 infection inhibits growth of Schwann cells and myelin sheath formation damage, resulting in significant injury of a nervous system, which is possibly related to an hsacirc0069335 / miR-29b-3p / PMP22 pathway. The discovery may provide a key molecular target for early warning and treatment of the severe hand-foot-and-mouth disease, so that the development progress of treatment drugs is accelerated.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a marker for detecting nerve damage complicated by hand, foot and mouth disease and an application thereof. Background Art

[0002] Enterovirus 71 (EV71) is a neurotropic, single-stranded, positive-sense RNA virus and the main causative agent of hand, foot and mouth disease (HFMD). It has caused large-scale epidemics many times around the world, bringing huge disease and economic burdens to the world.

[0003] The main symptoms of hand, foot and mouth disease are rash or herpes on the hands, feet, mouth and other parts, as well as fever. Some severe cases may be complicated by meningitis, encephalitis, acute flaccid paralysis and myocarditis. A small number of extremely seriously ill children have rapid disease progression and a high risk of death. Although the main symptoms of most children with HFMD are oral ulcerative blisters and viral rashes on the hands and feet, a small number of patients may develop cardiopulmonary or neurological complications, including aseptic meningitis, encephalitis, acute transverse myelitis, poliomyelitis-like syndrome, Guillain-Barré syndrome, acute cerebellar ataxia, etc. These complications are the main factors leading to death in patients with hand, foot and mouth disease.

[0004] Considering that most HFMD patients have no neurological symptoms or have hidden symptoms, and once neurological symptoms are found, they often progress to critical illness or even death in a short time. It is challenging to guide the early diagnosis, degree judgment and timing of initiation of protective treatment of nerve damage based solely on clinical manifestations. Therefore, it is necessary to find reliable biomarkers to assist in making early clinical decisions. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide the use of miR-29b-3p as a marker in predicting hand, foot and mouth disease complicated with nerve damage.

[0006] The purpose of the second aspect of the present invention is to provide the use of a substance for detecting miR-29b-3p in the preparation of a product for predicting nerve damage complicated by hand, foot and mouth disease.

[0007] The third aspect of the present invention aims to provide a primer for detecting miR-29b-3p.

[0008] The fourth aspect of the present invention aims to provide a kit for predicting nerve damage complicated by hand, foot and mouth disease.

[0009] The purpose of the fifth aspect of the present invention is to provide the use of miR-29b-3p activator or mimetic in the preparation of treatment for hand, foot and mouth disease complicated with nerve damage.

[0010] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides the use of miR-29b-3p as a marker in predicting hand, foot and mouth disease complicated with nerve damage; the sequence of the miR-29b-3p is: UAGCACCAUUUGAAAUCAGUGUU (SEQ ID NO: 1).

[0012] Preferably, the hand, foot and mouth disease includes hand, foot and mouth disease caused by enterovirus 71 (EV71) infection.

[0013] Preferably, the neurological damage includes neurological damage to the brain and spinal cord; specifically, it may include aseptic meningitis, encephalitis, brainstem encephalitis, acute transverse myelitis, poliomyelitis-like syndrome, Guillain-Barré syndrome, acute cerebellar ataxia, and cause neurological sequelae of varying degrees.

[0014] The second aspect of the present invention provides the use of a substance for detecting miR-29b-3p in the preparation of a product for predicting nerve damage complicated by hand, foot and mouth disease.

[0015] Preferably, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip method, nucleic acid sequencing method;

[0016] Preferably, the substance is selected from: one or more of a miR-29b-3p specific probe, a gene chip, and a PCR primer.

[0017] Preferably, the probe is an RNA probe.

[0018] Preferably, the probe comprises at least one of an isotope probe, a luciferase probe, and a chemiluminescent probe.

[0019] Preferably, the PCR primers include small RNA primers.

[0020] Preferably, the small RNA primer includes at least one of a stem-loop primer or a polyA tailing primer.

[0021] Preferably, the sequence of the small RNA primer is as shown in SEQ ID NO: 2, 3.

[0022] Preferably, the test sample of the product comprises blood.

[0023] Preferably, the blood comprises at least one of serum, plasma and whole blood.

[0024] Preferably, the test sample is derived from a mammal.

[0025] Preferably, the product also contains substances that are markers for detecting nerve damage associated with hand, foot and mouth disease.

[0026] Preferably, the product comprises at least one of a reagent, a test kit, a test paper, and a chip.

[0027] In a third aspect of the present invention, a primer for detecting miR-29b-3p is provided, and the sequence of the primer is shown in SEQ ID NO: 2, 3.

[0028] A fourth aspect of the present invention provides a kit for predicting nerve damage complicated by hand, foot and mouth disease.

[0029] Preferably, the kit comprises the primers described in the third aspect of the present invention.

[0030] Preferably, the kit comprises a reaction buffer.

[0031] Preferably, the kit further comprises a positive control standard and a negative control standard.

[0032] The fifth aspect of the present invention provides the use of a miR-29b-3p activator in the preparation of a product for treating hand, foot and mouth disease complicated with nerve damage.

[0033] Preferably, the miR-29b-3p activator includes at least one of a substance that increases the content of miR-29b-3p, a substance that increases the activity of miR-29b-3p, or a substance that inhibits the degradation of miR-29b-3p.

[0034] Preferably, the substance that increases the miR-29b-3p content includes at least one of miR-29b-3p, a miR-29b-3p mimic, an overexpression vector of miR-29b-3p, and a circular RNA targeting miR-29b-3p.

[0035] Preferably, the circular RNA targeting miR-29b-3p includes hsa_circ_0069335.

[0036] Preferably, the miR-29b-3p mimics include rno-miR-29b-1-5p mimic (MedchemExpress, catalog number HY-R04332) and the like.

[0037] In some embodiments of the present invention, the drug further comprises a pharmaceutically acceptable excipient. The excipient is generally recognized for this purpose and as an inactive ingredient of the medicament. A compilation of pharmaceutically acceptable excipients can be found in Handbook of Pharmaceutical Excipients (2nd edition, edited by A. Wade and PJ Weller; published by American Pharmaceutical Association, Washington and The Pharmaceutical 6 Gess, London, 1994); Pharmacopoeia of the People's Republic of China - Catalog of Pharmaceutical Excipients and other reference books.

[0038] Preferably, the drug is administered by one or more methods selected from the following groups: oral, injection, gold-coated gene gun bombardment, reproduction-defective bacteria carrying plasmid DNA, replication-defective adenovirus carrying target DNA or target gene encoded protein, electroporation, intravenous, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, and transdermal administration.

[0039] Preferably, the dosage form of the drug comprises at least one of capsules, tablets, microcapsule preparations, lyophilized powder injection preparations, injections, suppositories, sprays, powders, soft capsules, and sustained-release preparations.

[0040] The beneficial effects of the present invention are:

[0041] The present invention discovered for the first time the application of miR-29b-3p as a marker in predicting hand, foot and mouth disease complicated with nerve damage. Among hand, foot and mouth disease patients who were also infected with the EV71 virus, the miR-29b-3p expression level of patients with nerve damage symptoms was significantly downregulated compared with patients without nerve damage symptoms. Furthermore, in the external validation cohort, the presence of miR-29b-3p was completely undetectable in the blood samples of patients with nerve damage symptoms, and the area under the ROC curve was 1, indicating that the patient's blood miR-29b-3p level as a marker of hand, foot and mouth disease complicated with nerve damage has excellent specificity and sensitivity.

[0042] Further, the present invention confirms that EV71 infection can cause pathological damage to the nervous system, such as neuronal vacuolar degeneration, partial neuronal atrophy, hippocampal brain tissue edema, and a decrease in the number of Nissl bodies in the infarct area. In addition, EV71 infection causes significant structural damage to Schwann cells, including a decrease in the number of organelles and severe damage to the rough endoplasmic reticulum and mitochondria. However, as the EV71 viral load decreases, the degree of pathological damage is alleviated. In vitro cell experiments show that EV71 infection can significantly reduce ATP levels, promote Schwann cell apoptosis, and thus inhibit cell growth. With the extension of infection time and the reduction of viral load, the cell growth state gradually improves. At the same time, EV71 inhibits the expression of miR-29b at both mRNA and protein levels and promotes the expression of PMP22, with the most significant changes at 36h of infection. As the EV71 viral load decreases, the expression of miR-29b and PMP22 gradually recovers. In addition, EV71 can regulate the expression of hsa_circ_0069335, and hsa_circ_0069335 binds and co-localizes with miR-29b. Therefore, EV71 infection can cause significant damage to the nervous system, which may be related to the hsa_circ_0069335 / miR-29b / PMP22 pathway. The present invention provides a new therapeutic target for nerve damage caused by EV71 infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0044] Figure 1 This is the ROC curve result of miR-29b-3p in the external validation cohort of the present invention.

[0045] Figure 2 Results of pathological changes in brain tissue of mice infected with EV71; (A) Immunofluorescence images of EV71 detection. Nuclear staining (DAPI, blue fluorescence) and EV71 (green fluorescence) of brain tissue were observed under laser scanning confocal microscopy. Magnification, 20×; (B) Immunofluorescence staining to analyze the relative expression level of EV71; *P<0.05VSD1. #p<0.05D2 VS D3; (C) H&E staining to detect pathological changes in brain tissue. Magnification, 400×; (D) Nissl staining to detect Nissl bodies in brain tissue. Magnification, 400×; (E) Quantitative analysis of Nissl bodies in brain tissue; *P<0.05VSD1. #p<0.05D2VSD3.

[0046] Figure 3 The results of electron microscopy observation of pathological changes in Schwann cells and myelin sheaths in mice infected with EV71.

[0047] Figure 4The results of EV71 inhibiting the growth of Schwann cells, including: (A) Growth curve of Schwann cells, using MTS method to evaluate cell proliferation rate; (B) ATP detection kit to detect intracellular ATP content of Schwann cells; (C) Flow cytometry to detect cell apoptosis of Schwann cells. The lower left quadrant shows live cells (Annexin V- / PI-); the lower right quadrant is early apoptotic cells (Annexin V+ / PI-), and the upper right quadrant is late apoptotic cells and necrotic cells (Annexin V+ / PI+); (D) The apoptotic cell ratio of Schwann cells; the ratio is expressed as the percentage of Annexin V positive cells; *P<0.05, compared with normal value or 0 hours.

[0048] Figure 5 The results of EV71 enhancing Schwann cell apoptosis, including: (A) Schwann cell observation under fluorescence microscope; DNA fragments were detected by TUNEL method; green-stained cells have DNA fragments; cell nuclei (DAPI) are stained with blue fluorescence. The scale bar is 20μm; (B) The proportion of apoptotic cells in Schwann cells. The proportion is expressed as the percentage of DNA fragments; *P<0.05VS 0h.

[0049] Figure 6 The results of EV71 regulating the expression of miR-29b and PMP22, including: (A) mRNA expression level of miR-29b at different time points; (B) mRNA expression level of PMP22 at different time points; (C) protein electrophoresis image of PMP22; (D) protein quantitative analysis of PMP22; (E) quantitative analysis of the relative expression level of PMP22 by immunofluorescence staining; (F) representative images of EV71 and PMP22 staining detected by immunofluorescence; laser scanning confocal microscopy was used to observe Schwann cell nuclear staining (DAPI, blue fluorescence), EV71 (green fluorescence) and PMP22 (red fluorescence); scale bar, 20μm; *P<0.05VS 0h.

[0050] Figure 7 The results of miR-29b reversing the increase of PMP22 caused by EV71 infection, including: (A) mRNA expression levels of PMP22, cicrRNA and miR-29b. (B) Protein electrophoresis image of PMP22 expression; (C) Quantitative analysis of PMP22 expression level by immunoblotting. *P<0.05 vs EV71 infected cells.

[0051] Figure 8Figure 2 shows the relationship between hsa_circ_0069335 and miR-29b, including: (A) Schematic diagram of the potential binding site of miR-29b in the hsa_circ_0069335 sequence. In the mutated hsa_circ_0069335, 5'-AGGUGGUGC-3' in hsa_circ_0069335 becomes 5'-CAAGAAGAUG-3'; (B) Dual luciferase reporter gene detection of the binding relationship between hsa_circ_0069335 and miR-29b; (C) FISH detection of the intracellular localization of hsa_circ_0069335 and miR-29b. Laser scanning confocal microscopy was used to observe the staining methods of Schwann cells: nuclear staining (DAPI, fluorescent blue), miR-29b staining (fluorescent green), and hsa_circ_0069335 staining (fluorescent red); scale bar, 20 μm; *P<0.05, compared with psiCHECK-2. DETAILED DESCRIPTION

[0052] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0053] All experimental data are expressed as mean and standard deviation. SPSS22.0 software was used for statistical analysis. The LSD-t test was used for comparison between two groups, and one-way analysis of variance (ANOVA) was used for comparison between multiple groups. P<0.05 was considered statistically significant.

[0054] Example 1 Screening of markers

[0055] 1. Patient inclusion and exclusion criteria

[0056] 1.1 Differential gene screening cohort: Children with HFMD and critical brainstem encephalitis caused by enterovirus (EV) 71 infection were collected. Evidence of EV71 infection was based on positive reverse transcription polymerase chain reaction (RT-PCR) test results of EV71 in throat, anal swabs or cerebrospinal fluid (CSF) samples, and there was no other pathogen infection; a total of 3 cases were included. The control group consisted of 3 patients with EV71 infection without neurological symptoms during the same period. The two groups were matched by age to reduce bias. RNA sequencing differential analysis of the screening cohort was performed.

[0057] 1.2 External validation cohort: Randomly collect samples from children with positive results of EV reverse transcription polymerase chain reaction (RT-PCR) in throat, anal swabs or cerebrospinal fluid (CSF) samples from the unit's biobank, excluding those with incomplete data, non-EV infection, combined infection with other pathogens, and no neurological symptoms. A total of 7 samples of children infected with EV were collected. According to clinical test data, accompanied by neurological involvement such as brainstem encephalitis. Three children with positive results of EV reverse transcription polymerase chain reaction (RT-PCR) but no neurological symptoms, and 5 children with negative etiology and no other symptoms except fever were randomly selected as external test cases.

[0058] Informed consent was obtained from patients for all related experiments and approved by the Ethics Committee of Women and Children's Medical Center Affiliated to Guangzhou Medical University.

[0059] 2. RNA sequencing analysis

[0060] Three patients with EV71 infection and brainstem encephalitis were selected as the experimental group, and three patients with EV71 infection without neurological symptoms were selected as the control group. The two groups were matched by age to reduce bias.

[0061] RNA sequencing analysis was performed on an internal screening cohort.

[0062] Total RNA was extracted from blood samples using Magen Hipure Total RNA Mini Kit according to the manufacturer's instructions, and RNA concentration was then detected using Qubit3.0 and RNA integrity was detected using Agilent2100Bioanalyzer. Afterwards, RNA was used for library generation using QIAseq miRNA Library Kit. RNA sequencing was performed using NextSeq CN500 SE75 according to the manufacturer's protocol. Micro RNA-seq data analysis was then performed to identify genes that were significantly changed at the RNA level. The expression of each gene was examined by fragment length, which was mapped by read counts. They were normalized by the number of fragments per kilobase of transcript per million mapped fragments (FPKM) variation method. Finally, the differentially expressed genes were screened and ranked based on the log2FC of the differential distribution of RNA sequences (log2FC>0, up-regulated genes; log2FC<0, down-regulated genes), P value, FDR, etc.

[0063] 3. Experimental results

[0064] This embodiment collected blood samples from 3 patients with brainstem encephalitis infected by EV71 and a control group. Except for 1 sample in the experimental group due to low RNA concentration, the remaining 5 samples were successfully sequenced with micro RNA. All patients with brainstem encephalitis had acute onset, fever, and rapidly developed into respiratory failure on the 2nd-3rd day of onset, requiring mechanical ventilation. All 3 patients left serious neurological sequelae, including respiratory insufficiency, coma, and eventually died. The control group patients had a good prognosis. By comparing differentially expressed genes, this embodiment found that the expression level of miR-29b-3p was significantly lowered in patients with brainstem encephalitis infected by EV71 compared with patients without brainstem encephalitis (Table 1). This finding suggests that miR-29b-3p may be involved in the nervous system damage caused by EV71 infection.

[0065] Table 1 Differences in miR-29b-3p between EV71 infected patients and control group

[0066]

[0067]

[0068] Example 2 Validation of markers

[0069] 1. Sample collection

[0070] Clinical test samples of patients in the external validation set were collected. Due to differences in testing and treatment of different patients, the specific samples are as follows:

[0071] Seven patients with EV infection complicated by brainstem encephalitis (A1-A7): 2 whole blood cell sediment samples (A1-A2), 4 serum samples (A3-A6), and 1 cerebrospinal fluid sample (A7).

[0072] There were 3 patients in the control group with no neurological symptoms due to EV infection (B6-B8, cerebrospinal fluid).

[0073] There were 5 cases without neurological symptoms and negative etiology, among which 5 patients had 5 whole blood cell sedimentation and 5 serum samples collected (A1-A5, B1-B5).

[0074] 2. Experimental methods

[0075] PCR amplification was used to detect the expression of miR-29b-3p between the two groups.

[0076] The PCR primer sequences are as follows:

[0077] miR-29b-3p-F: 5'-ACACTCCAGCTGGGTAGCACCATTTGAAATCAG-3' (SEQ ID NO: 2).

[0078] miR-29b-3p-R: 5'-CTCAACTGGTGTCGTGGA-3' (SEQ ID NO: 3).

[0079] miR-29b-3p-RT: 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACT GA-3' (SEQ ID NO: 4).

[0080] 3. Experimental results

[0081] 1) Cerebrospinal fluid specimen

[0082] The expression of miR-29b-3p was not detected in the cerebrospinal fluid samples of both the experimental group and the control group.

[0083] 2) Cell precipitation

[0084] Table 2 Cell precipitation test results

[0085]

[0086]

[0087] In this group of external validation test standards, there were large differences between cell precipitation groups and high standard errors, and its analytical detection value could not be determined.

[0088] 3) Serum samples

[0089] Table 3 Serum sample test results

[0090]

[0091] In serum samples, the expression of miR-29b-3p in the EV71 infection experimental group was significantly lower than that in the control group, and no miR-29b-3p expression was detected in serum samples of the EV71 infection group.

[0092] Furthermore, the ROC curve was drawn for the validation data of the serum standard, and the results were as follows: Figure 1 shown.

[0093] Since miR-29b-3p could not be detected in the serum samples of the EV71-infected experimental group, its AUROC result was 100%, which can be used as a specific marker to determine whether there is neurological damage in HFMD patients infected with EV71.

[0094] Example 3 Phenotypic study of pathological changes in the nervous system caused by EV71 virus infection

[0095] 1. Experimental Materials

[0096] 1) Cell culture and viruses

[0097] African green monkey kidney cell line (Vero cells) were cultured in DMEM-high glucose medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2. Enterovirus A71 strain GZ203KL21 / GD / CHN / 2010 was isolated from a HFMD patient in Guangzhou, China (GenBank No.: MF362981). After infection, EV71 was amplified in Vero cells. Viruses were collected 3 days after infection, and the virus titers in Vero cells were routinely determined by microplate dilution method and calculated by Karber method.

[0098] 2) Animals

[0099] Sixteen pregnant ICR mice were purchased from the Laboratory Animal Center of Guangzhou University of Chinese Medicine and housed in individually ventilated and specific pathogen-free cages. All animal studies were approved by the Animal Care and Use Ethics Committee of the Women and Children's Medical Center of Guangzhou Medical University and complied with the requirements of the Guide for the Care and Use of Laboratory Animals.

[0100] Twelve mice were randomly selected for EV71 infection, and 4 mice were selected every 24 h for subsequent experiments. The EV71 strain was inoculated intracranially in ICR newborn mice and the experimental process was as follows: after anesthesia, a hole was drilled in the anterior bregma of the mice, and then 2 μL of virus (2×10 ^9 / ml) suspension at a rate of 0.2 μL / min.

[0101] 2. Experimental methods

[0102] Following EV71 virus infection of mice, brain tissues were analyzed 1-3 days after infection.

[0103] Hematoxylin-eosin (HE) staining: After euthanizing mice, the brain tissue was fixed with 4% paraformaldehyde for more than 24 hours, then dehydrated, embedded, and sliced. After the slices were dewaxed, hematoxylin was used for nuclear staining, and then eosin was used for cytoplasmic staining. After dehydration, the slices were sealed with neutral glue, and their histopathological changes were analyzed by taking pictures.

[0104] Nissl staining: After dewaxing, paraffin sections were stained with toluidine blue for 5 minutes, then washed and differentiated by adding 1% glacial acetic acid. Subsequently, the sections were treated with xylene for 5 minutes and then sealed with neutral gum. Finally, microscopic examination and image acquisition and analysis were performed.

[0105] Transmission electron microscopy (TEM) detection: Tissue samples were fixed with 2.5% glutaraldehyde and 1% osmium acid buffer at 4°C for 2 hours, and then dehydrated with different concentration gradients of ethanol and acetone. After soaking in 1:1 acetone and resin, the samples were embedded and polymerized with embedding agents. Ultrathin sections were then made and stained with uranyl acetate solution at room temperature for 10 to 20 minutes. After washing, the sections were stained with lead citrate solution for 15 minutes and finally observed with a transmission electron microscope.

[0106] Immunofluorescence: After paraffin sections were dewaxed with xylene and ethanol, citric acid antigen retrieval buffer was added for antigen retrieval. Then, the sections were treated with autofluorescence quencher for 5 min and incubated with BSA for 30 min. After removing the blocking solution, the sections were incubated with anti-enterovirus 71 antibody (1:500) at 4°C overnight, and then incubated with FITC-labeled secondary antibody (1:200) at room temperature in the dark for 50 min. Finally, the nuclei were fixed with DAPI, the sections were blocked with anti-fluorescence quencher sealant, and observed under a fluorescence microscope. A similar method was used to detect the levels of PMP22 and EV71 in mouse Schwann cells, and the cell slides were incubated with anti-PMP22 (1:500) or anti-enterovirus 71 antibodies at 4°C overnight.

[0107] 3. Experimental results

[0108] In order to observe the damage caused by EV71 to mice, this example injected EV71 into mice to observe the changes in their nervous system. Immunofluorescence detection of EV71-infected mice found that the fluorescence intensity of the hippocampus was the most significant on the first day of EV71 infection, and decreased with the increase of infection time ( Figure 2 AB), indicating that the viral load decreases with the extension of infection time. HE detection of hippocampus shows that EV71 infection can cause neuronal vacuolar degeneration, atrophy of some neurons, and brain tissue edema ( Figure 2 C). At the same time, Nissl staining results showed that EV71 infection reduced the number of Nissl bodies in the infarct area ( Figure 2 DE).

[0109] Then, the structural changes of Schwann cells and myelin sheath were observed under electron microscopy. EV71 infection caused obvious damage to the cell structure, with some cells swelling and dissolving; the number of organelles decreased, the rough endoplasmic reticulum degranulated, the mitochondria swelled severely, and the mitochondrial cristae ruptured and dissolved ( Figure 3 ). However, as the EV71 viral load decreased, the degree of cell structure damage decreased. The myelin sheaths of EV71-uninfected cells were intact, densely structured, and had clear boundaries; the number of myelin sheaths between EV71-infected myelin cells was reduced, the myelin sheath layer structure was unclear, the myelinated nerve fibers were irregular in shape, loosely arranged, and the myelin sheath thickness was significantly thinner ( Figure 3 ).

[0110] As the EV71 viral load decreased, the pathological changes of myelin sheath were improved. This data shows that as the EV71 viral load decreased, the pathological damage of brain tissue gradually decreased.

[0111] Example 4EV71 infection inhibits the growth of Schwann cells

[0112] 1. Experimental methods

[0113] 1) Preliminary isolation and culture of Schwann cells

[0114] Ganglia were isolated from the brains of ICR mice 1-3 days after birth, digested with trypsin, and then cultured in DMEM medium containing 10% fetal bovine serum and 2 mM glutamine for 30 min. After removing the attached fibroblasts, 2 mL of cell suspension was taken and the seeding density was 0.2×10 5 Cells / mL were inoculated into 35mm plastic culture dishes coated with rat tail glue and cultured at 37°C in an incubator containing 10% CO2. On the third day of cell culture, cell division inhibitors 5-fluoro-2-deoxyuridine (15μg / mL) and uridine (35μg / mL) were added to further remove fibroblasts. After continuous culture for 48h, fresh culture medium was replaced, and then replaced twice a week, with half of the fresh culture medium replaced each time. After 15 days of culture, Schwann cells with a high purity of 95% were obtained, and S-100 immunohistochemical staining was positive (Table 4).

[0115] Table 4 The proportion of S-100 positive cells in cultured mouse Schwann cells

[0116]

[0117] 2) MTS analysis

[0118] The cell concentration was adjusted to 1 × 10 5 / mL, and then inoculated into a 96-well plate, 100μL per well. After cell attachment, cells at different time points (0, 24, 48 and 72h) were collected and cell proliferation was detected using cellTiter96AQ single solution cell proliferation detection reagent (Promega). After incubation with the detection solution for 4h, the optical density (OD) value at 490nm was read using a microplate reader (multiscan MK3).

[0119] 3) Determination of intracellular ATP content

[0120] The intracellular ATP content was detected using an ATP detection kit (Beyotime). First, 200 μL of lysis buffer was added to each well of a 6-well plate to lyse the cells, and then centrifuged at 4°C, 12,000 g for 5 min. 100 μL of ATP detection working solution was added to the supernatant, left at room temperature for 3-5 min, and then the relative light unit (RLU) value was measured using a photometer.

[0121] 4) Flow cytometry detection of cell apoptosis

[0122] Annexin V-FITC apoptosis detection kit (KeyGEN) and DeadEnd TM Cell apoptosis was detected by fluorescent TUNEL system (Promega). First, cells (including cells detached from the culture medium) were collected and resuspended, and the cell density was adjusted to 1×10 6 Then 0.5 ml of cell suspension (5×10 5 Cells were mixed with 1.25 μL Annexin V-FITC and reacted at room temperature in the dark for 15 min. Then, the cell pellet obtained by centrifugation at 1000×g for 5 min was resuspended, mixed with 10 μL propidium iodide, and then analyzed by flow cytometry. The experimental steps for detecting cell apoptosis using the TUNEL kit (Promega) are as follows: fix with 4% formaldehyde solution at 4°C for 25 min, incubate with 0.2% Triton X-100 at room temperature for 5 min; after washing with PBS, equilibrate with 100 μL equilibration buffer at room temperature for 10 min, and then incubate with 50 μL TdT working solution at 37°C in a wet box in the dark for 60 min. Wash the cells with 2XSSC solution and PBS respectively, incubate with DAPI staining solution at room temperature in the dark for 10 min, and observe the cells under a fluorescence microscope after blocking with fluorescent antifader.

[0123] 2. Experimental results

[0124] Schwann cells are an important component of myelin. In order to study the damage of EV71 to myelin, we infected Schwann cells with EV71 in vitro and observed the changes in Schwann cells. MTS test showed that EV71 infection significantly inhibited cell proliferation, but this inhibitory effect weakened over time ( Figure 4 EV71 infection significantly reduced ATP production at 48h, 60h, and 72h. However, at 84h after infection, there was no difference in ATP production between EV71-infected cells and the control group ( Figure 4 Middle B). EV71 infection promotes cell apoptosis in a time-dependent manner. The apoptosis level is highest at 36h after infection, and then gradually decreases with the extension of time ( Figure 4After 60h of infection, the level of apoptosis was not significantly different from that of the uninfected group. At the same time, these results were confirmed by TUNEL experiments. At 36h of EV71 infection, the level of apoptosis reached a peak and gradually decreased with time ( Figure 5 This result indicates that the cell growth status gradually improves as the EV71 viral load decreases.

[0125] Example 5EV71 infection downregulates miR-29b expression and promotes PMP22 expression

[0126] 1. Experimental methods

[0127] 1) Fluorescence quantitative PCR

[0128] Total RNA was extracted from mouse Schwann cells using Trizol and then reverse transcribed into cDNA using the EasyScript First-StrandcDNA Synthesis SuperMix Kit. Specific primers were added for reverse transcription to detect miR-29b, PMP22, and cicrRNA. Quantitative PCR was performed using SYBR Green qPCR SuperMix (Vazyme), with 3 replicates for each sample. -ΔΔCt The relative expression of each gene was calculated by the method. The specific primer sequences are as follows:

[0129] miR-29b-3p-F: 5'-ACACTCCAGCTGGGTAGCACCATTTGAAATCAG-3' (SEQ ID NO: 2).

[0130] miR-29b-3p-R: 5'-CTCAACTGGTGTCGTGGA-3' (SEQ ID NO: 3).

[0131] miR-29b-3p-RT: 5'CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACTGA 3' (SEQ ID NO: 4).

[0132] PMP22-F: 5'-CTGCCAGCTCTTCACTCTCA-3' (SEQ ID NO: 5).

[0133] PMP22-R: 5'-GTTGACATGCCACTCACTGT 3' (SEQ ID NO: 6).

[0134] mmu_circRNA-F: 5'-CACAGCAGAAATATCACCGGATCGTC-3' (SEQ ID NO: 7).

[0135] mmu_circRNA-R: 5'-TTATTTGTAGGTGTTCATTCAGTGGC-3' (SEQ ID NO: 8).

[0136] 2) Western Blot

[0137] Mouse Schwann cells were lysed with RIPA buffer (Beyotime) to obtain total protein. Then, the protein concentration was determined using the Micro BCA protein assay kit (Thermo Fisher). Subsequently, the proteins were subjected to SDS-PAGE and transferred to the membrane. After removing the transfer solution, the membrane was incubated with anti-pmp22 antibody (1:500; Bioss) or anti-GAPDH antibody (1:1000; Bioss) at 4°C overnight, and then horseradish peroxidase (HRP)-labeled secondary antibody (1:4000; Southern Biotech) was added and incubated for 2 hours at room temperature. Next, protein bands were detected using BeyoECL Plus (Beyotime) and analyzed using a gel image processing system. Densitometric analysis was performed using Quantity One (Bio-Rad).

[0138] 3) Overexpression of miRNA-29b

[0139] Chemically synthesized miRNA-29b was purchased from Guangzhou Ruibo Company (Cat. No. MIMATO000100). After EV71 infected the cells, the miR-29b fragment was transfected into Schwann cells.

[0140] 2. Experimental results

[0141] Studies have found that EV71 infection is related to PMP22, and miR-29a can target and regulate the expression of PMP22. Sequencing analysis shows that in the miR-29 family, miR-29b has a higher match with PMP22. Therefore, this example further explores the relationship between EV71 and miR-29b-3p / PMP22. EV71 inhibits the expression of miR-29b-3p and promotes the expression of PMP22. At 36h of EV71 infection, the expression level of miR-29b was the lowest, while the expression level of PMP22 was the highest. After 36h of EV71 infection, the expression of miR-29b gradually increased, while the expression of PMP22 gradually decreased (Figure 6A-B). Western blot analysis also showed similar results ( Figure 6CD). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly with the extension of infection time. ( Figure 6 Therefore, this data suggests that EV71 can regulate the expression of miR-29b-3p / PMP22 in Schwann cells.

[0142] Furthermore, this example tests whether the increase in miR-29b expression can reduce the increase in PMP22 caused by EV71 infection. At the mRNA level, the expression of PMP22 and cicrRNA in EV71-infected cells increased significantly, while overexpression of miR-29b-3p reversed this phenomenon, resulting in downregulation of PMP22 and cicrRNA expression in EV71-infected cells ( Figure 7 The expression of PMP22 at the protein level also showed similar results ( Figure 7 Therefore, the high expression of miR-29b-3p can reduce the high expression of PMP22 caused by EV71 infection.

[0143] Experimental example: EV71 can affect the expression of hsa_circ_0069335

[0144] 1. Experimental methods

[0145] 1) Luciferase reporter gene analysis

[0146] The Hsa_circ_0069335 sequence was cloned into the psiCHECK-2 vector (Promega), and the potential miR-29b binding site was mutated to obtain expression vectors containing the wild-type or mutant Hsa_circ_0069335 sequence. These vectors were co-transfected with relevant miRNAs, and then the luciferase activity was detected using the luciferase reporter assay system (Promega).

[0147] 2) Fluorescence in situ hybridization (FISH)

[0148] The cell slides were incubated with PBS containing 0.3% Trition X-100 at room temperature for 20 min, and then incubated with 4% paraformaldehyde at room temperature for 20 min. After washing with PBS, incubated with RNA hybridization buffer at 55°C for 2 h, and then 20 μL of denatured probe working solution was added and hybridized overnight at 37°C. Washed with PBS three times and stained with DAPI at room temperature for 5 min. Finally, the slides were sealed with fluorescent antifade and observed under a microscope.

[0149] 2. Experimental results

[0150] This example further screened circRNAs that may target miR-29b-3p, and identified differentially expressed circRNAs in EV71 infection based on the RNA sequencing results in Example 1. At the same time, software was used to analyze circRNAs that can bind to miR-29b. A total of 6 circRNAs that may target miR-29-3p were screened, and the intersection of the two circRNAs was selected, among which hsa_circ_0069335 had the highest match with miR-29b. The results are shown in Table 5.

[0151] Table 5 Screening of targeted circRNAs of miR-29b-3p

[0152]

[0153] The sequences of the above circRNAs have been published in the database cicrbank (http: / / www.circbank.cn / ), and can be queried according to circBank ID or circBase ID. The relevant sequences exist uniquely.

[0154] Dual luciferase reporter gene experiments showed that miR-29b could bind to hsa_circ_0069335, thereby significantly reducing luciferase activity ( Figure 8 FISH detection found that miR-29b co-localized with hsa_circ_0069335 and was mainly localized in the cytoplasm ( Figure 8 (C). Therefore, the function of hsa_circ_0069335 is related to miR-29b and is regulated by EV71.

[0155] In summary, EV71 infection inhibits Schwann cell growth and impairs myelination, leading to significant damage to the nervous system, which may be related to the hsa_circ_0069335 / miR-29b / PMP22 pathway. This discovery may provide a key molecular target for early warning and treatment of severe HFMD, thereby accelerating the development of drugs for the treatment of severe HFMD patients.

Claims

1. Application of miR-29b-3p as a marker in predicting hand, foot and mouth disease complicated with nerve damage.

2. The use according to claim 1, characterized in that: The hand, foot and mouth disease includes hand, foot and mouth disease caused by enterovirus 71 infection.

3. Application of substances for detecting miR-29b-3p in the preparation of products for predicting nerve damage associated with hand, foot and mouth disease.

4. The use according to claim 3, characterized in that: The substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip method, and nucleic acid sequencing method; Preferably, the substance is selected from: one or more of a miR-29b-3p specific probe, a gene chip, and a PCR primer.

5. The use according to claim 4, characterized in that: The test sample of the product includes blood; Preferably, the blood includes at least one of serum, plasma and whole blood.

6. A primer for detecting miR-29b-3p, characterized in that: The sequences of the primers are shown in SEQ ID NOs: 2 and 3.

7. A kit for predicting hand, foot and mouth disease complicated with nerve damage, characterized in that: The kit comprises the primer according to claim 6; Preferably, the kit further comprises a reaction buffer.

8. Application of miR-29b-3p activator in the preparation and treatment of hand, foot and mouth disease complicated with nerve damage.

9. The product according to claim 8, characterized in that: The miR-29b-3p activator includes at least one of a substance that increases the content of miR-29b-3p, a substance that increases the activity of miR-29b-3p, or a substance that inhibits the degradation of miR-29b-3p.

10. The product according to claim 9, characterized in that: The substance that increases the miR-29b-3p content includes at least one of miR-29b-3p, miR-29b-3p mimics, and a miR-29b-3p overexpression vector.

Images