Recombinant escherichia coli for producing N-acetylneuraminic acid as well as construction method and application of recombinant escherichia coli

Abstract

The invention discloses recombinant escherichia coli for producing N-acetylneuraminic acid as well as a construction method and application of the recombinant escherichia coli, and belongs to the technical field of genetic engineering. According to the invention, 6-phosphofructokinase is knocked out, glycerol kinase is introduced into a glycerol kinase mutant, a diffusion transporter is promoted by glucose to replace PTS phosphotransferase I, and a promoter is optimized, so that recombinant escherichia coli can grow by double carbon sources of glucose and glycerol, N-acetylneuraminic acid is synthesized, and meanwhile, the generation amount of acetic acid is extremely low. On the basis, a 6-phosphofructokinase coding gene pfkB is knocked out, a heterologous ED pathway from pseudomonas mobilis is introduced, and the yield under the pore plate level is further increased to 9.44 g / L through copy number optimization and RBS strength optimization.

Description

Technical Field

[0001] The invention relates to a recombinant Escherichia coli producing N-acetylneuraminic acid and a construction method and application thereof, belonging to the technical field of genetic engineering. Background Art

[0002] N-acetylneuraminic acid is a functional monosaccharide with very important application value. In the human body, N-acetylneuraminic acid participates in important physiological processes such as intercellular signal transduction and recognition. Therefore, N-acetylneuraminic acid is widely used to promote brain development in infants of appropriate age, maintain brain function and health in the elderly, resist influenza virus, enhance immunity, etc. At present, natural extraction, enzyme catalysis and whole cell catalysis are the main industrial production methods of NeuAc, but there are problems such as high cost and environmental pollution. With the development of synthetic biology and metabolic engineering, analyzing and regulating the metabolic pathways in microorganisms to achieve efficient accumulation of target products has become a reality and is easy to operate. As a greener, more efficient and sustainable method, microbial fermentation has great advantages in the de novo synthesis of NeuAc and is a more promising synthetic strategy.

[0003] Escherichia coli is a commonly used chassis microbial cell in industry. It has the advantages of simple cultivation and easy genetic manipulation, and has been widely used in the synthesis of various useful compounds. In addition, Escherichia coli already has fully functional genetic tools in metabolic engineering, and the raw material fermentation process is relatively mature and low-cost. Therefore, it is an effective strategy to use Escherichia coli as a host, through metabolic engineering, and with cheap carbon sources such as glucose as substrates, to efficiently synthesize N-acetylneuraminic acid from scratch.

[0004] At present, the production of N-acetylneuraminic acid in Escherichia coli uses the EMP pathway as a glycolysis pathway, but there is a problem of insufficient supply of phosphoenolpyruvate (PEP). There are many steps in producing pyruvate from the EMP pathway, and the intermediate process loss of carbon source is large, which limits the further increase of N-acetylneuraminic acid production. Therefore, it is very important to reduce the intermediate metabolic process, reduce the carbon source loss rate, and increase the supply of PEP. Summary of the invention

[0005] To solve the above problems, the present invention firstly realizes the production of N-acetylneuraminic acid from dual carbon sources of glucose and glycerol through three-step combined transformation of the genome and promoter optimization, and greatly reduces the generation of byproduct acetic acid. Secondly, the ED pathway is constructed in the strain as the main glycolysis pathway, and the 10-step reaction of the EMP pathway can be realized through 4-step reactions to supply the precursor pyruvate, thereby reducing intermediate steps, having a lower protein metabolic burden, and reducing carbon source loss. The rapid supply of pyruvate can promote its conversion into PEP, thereby coping with the problem of insufficient PEP supply during the growth process and realizing the efficient synthesis of N-acetylneuraminic acid.

[0006] The first object of the present invention is to provide a recombinant Escherichia coli, wherein the recombinant Escherichia coli comprises the following modifications:

[0007] Knockout of 6-phosphofructokinase encoding gene pfkA, 6-phosphofructokinase encoding gene pfkB and glycerol kinase encoding gene (GlpK), overexpression of glycerol kinase mutant encoding gene (GlpK22), knockout of PTS phosphotransferase I encoding gene (ptsI) and integration expression of glucose facilitated diffusion transporter encoding gene (glf) at this site, integration expression of expression cassette containing 6-PG dehydratase encoding gene (EDD) and KDPG aldolase encoding gene (EDA) on the genome and at least one copy is integrated at the gene ymgF site;

[0008] The glucose facilitated diffusion transporter encoding gene is expressed by a promoter whose nucleotide sequence is shown in SEQ ID NO.10, and the amino acid sequence of the glycerol kinase mutant is shown in SEQ ID NO.1.

[0009] Furthermore, two copies of expression cassettes containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene were integrated and expressed, and the integration sites were located at the end of the ettA gene and the end of the ymgF gene, respectively.

[0010] Furthermore, the GeneID of the ettA gene is 948909; the GeneID of the ymgF gene is 1450253.

[0011] Furthermore, the expression frame containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene also includes a promoter and / or a regulatory element RBS, the promoter includes but is not limited to a T7 promoter, and the regulatory element RBS includes but is not limited to the sequences shown in SEQ ID NO.16-21. Preferably, the RBS regulating the 6-PG dehydratase encoding gene is the sequence shown in SEQ ID NO.18, and the RBS regulating the KDPG aldolase encoding gene is the sequence shown in SEQ ID NO.20.

[0012] Furthermore, the overexpression is integrated expression and / or free expression. Preferably, the glycerol kinase encoding gene is knocked out and the glycerol kinase mutant encoding gene is integrated and expressed at the site. The promoter used in the present invention is the glpk in situ promoter.

[0013] Furthermore, the host bacteria of the recombinant Escherichia coli include Escherichia coli

[0014] BL21(DE3)ΔcheW::P6-glmSA,overexpression ofneuC gene in the temminator locus ofpspG gene under the control ofpromoter Pl,ΔmotA::P1-glmM-P4-glmUglmSA,overexpression ofNemneuB gene in the terminator locus ofyahOgene under the control ofpromoter Pl,ΔwecBΔmanAΔpykA,ΔnagΔnanATEΔmanXYZ.

[0015] Further, the GeneID of the 6-phosphofructokinase encoding gene pfkA is 948412; the GeneID of the 6-phosphofructokinase encoding gene pfkB is 946230; the GeneID of the glycerol kinase encoding gene is 948423; the Gene ID of the PTS phosphotransferase I encoding gene is 946879; the amino acid sequence of the glucose facilitated diffusion transporter is shown in SEQ ID NO.3; the amino acid sequence of the 6-PG dehydratase is shown in SEQ ID NO.11; the amino acid sequence of the KDPG aldolase is shown in SEQ ID NO.13;

[0016] The nucleotide sequence of the gene encoding the glycerol kinase mutant is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the glucose-facilitated diffusion transporter is shown in SEQ ID NO.4; the nucleotide sequence of the 6-PG dehydratase is shown in SEQ ID NO.12; and the nucleotide sequence of the KDPG aldolase is shown in SEQ ID NO.14.

[0017] The second object of the present invention is to provide a method for constructing the recombinant Escherichia coli, comprising the following steps:

[0018] Using Escherichia coli BL21 (DE3) ΔcheW::P6-glmSA, overexpression of neuC gene in the terminator locus of pspG gene under the control of promoter Pl, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus of yahO gene under the control of promoter Pl, ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ as the host bacteria, the 6-phosphofructokinase encoding gene pfkA, the 6-phosphofructokinase encoding gene pfkB and the glycerol kinase encoding gene (GlpK) were knocked out, the glycerol kinase mutant encoding gene (GlpK22) with the amino acid sequence shown in SEQ ID NO.1 was integrated into the genome, the PTS phosphotransferase I encoding gene (ptsI) was knocked out and the gene containing SEQ ID NO. The expression cassette of the glucose-facilitated diffusion transporter encoding gene (glf) of the promoter shown in NO.10 is integrated into one copy at the ymgF site and the ettA site respectively by homologous recombination, and also contains the expression cassettes of the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene.

[0019] The third object of the present invention is to provide the use of the recombinant Escherichia coli in the preparation of N-acetylneuraminic acid or its derivatives.

[0020] Furthermore, derivative products include but are not limited to medicines or health products.

[0021] The fourth object of the present invention is to provide a method for producing N-acetylneuraminic acid, comprising the step of using the recombinant Escherichia coli for fermentation production; the fermentation production comprises fermentation with a composite carbon source, and the composite carbon source contains glucose and glycerol.

[0022] Furthermore, in the composite carbon source, the mass ratio of glycerol to glucose is 1:(8-16).

[0023] Furthermore, the fermentation medium used in the fermentation production contains: 20-40 g / L complex carbon source, 3-9 g / L urea, 1-6 mg / L zinc sulfate heptahydrate, 0.01-1 g / L manganese sulfate monohydrate, 1-10 g / L iron sulfate heptahydrate, 0.01-1 g / L copper sulfate pentahydrate, 0.01-1 g / L cobalt chloride hexahydrate, 1-10 g / L yeast powder, 1-5 g / L tryptone, 1-10 g / L potassium dihydrogen phosphate, 1-10 g / L dipotassium hydrogen phosphate trihydrate, 1-10 g / L citric acid monohydrate, 1-10 g / L magnesium sulfate heptahydrate, and 1-10 g / L ammonium sulfate.

[0024] Furthermore, the fermentation production includes culturing at 35-37° C. and 180-280 rpm.

[0025] Beneficial effects of the present invention:

[0026] The invention uses Escherichia coli BL21 (DE3) ΔcheW::P6-glmSA, overexpression of neuC gene in the temminator locus of pspG gene under the control of promoter Pl, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus of yahO gene under the control of promoter Pl. ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ, ΔpfkA, ΔglpK::glpK22, ΔptsI::glf (ZG01) as a host, knocks out a 6-phosphofructokinase encoding gene pfkB, introduces a heterologous ED pathway from Pseudomonas mobilis, performs copy number optimization and RBS strength optimization, thereby improving the N-acetylneuraminic acid synthesis ability of the recombinant Escherichia coli and reducing the synthesis of by-products. Among them, copy number optimization is specifically to integrate edd and eda combinations at different sites of the genome; RBS optimization is specifically to integrate edd and eda combinations of RBS of different strengths at the end of the ymgF gene. Through the above optimization, the yield at the well plate level when using a composite carbon source reached 9.44g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the dual-carbon source metabolism flow chart of N-acetylneuraminic acid.

[0028] Figure 2 Comparison of fermentation yield and acetic acid production of different engineered strains.

[0029] Figure 3 Fermentation yield of engineered strains integrating different copies of ED pathway gene fragments.

[0030] Figure 4 Effect of optimized combinatorial expression of the second copy of the ED pathway on NeuAc synthesis. DETAILED DESCRIPTION

[0031] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0032] 1. The genes and sequences involved in the present invention are as follows:

[0033] The amino acid sequence of the glycerol kinase mutant GlpK22 is shown in SEQ ID NO.1, encoding GlpK22

[0034] The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0035] The amino acid sequence of the glucose facilitated diffusion transporter Glf is shown in SEQ ID NO.3, and the codon-optimized nucleotide sequence encoding the Glf gene is shown in SEQ ID NO.4.

[0036] The P1 promoter nucleotide sequence is shown in SEQ ID NO.5; the P2 promoter nucleotide sequence is shown in SEQ ID NO.6; the P3 promoter nucleotide sequence is shown in SEQ ID NO.7; the P4 promoter nucleotide sequence is shown in SEQ ID NO.8; the P5 promoter nucleotide sequence is shown in SEQ ID NO.9; and the P6 promoter nucleotide sequence is shown in SEQ ID NO.10.

[0037] The amino acid sequence of 6-PG dehydratase EDD is shown in SEQ ID NO.11, the codon-optimized edd nucleotide sequence is shown in SEQ ID NO.12, the amino acid sequence of KDPG aldolase EDA is shown in SEQ ID NO.13, and the codon-optimized eda nucleotide sequence is shown in SEQ ID NO.14.

[0038] The T7 promoter sequence is shown in SEQ ID NO.15; the RBS1 nucleotide sequence is shown in SEQ ID NO.16; the RBS2 nucleotide sequence is shown in SEQ ID NO.17; the RBS3 nucleotide sequence is shown in SEQ ID NO.18; the RBS4 nucleotide sequence is shown in SEQ ID NO.19; the RBS5 nucleotide sequence is shown in SEQ ID NO.20; and the RBS6 nucleotide sequence is shown in SEQ ID NO.21.

[0039] 2. The materials and methods of the present invention are as follows:

[0040] Starting strain NBC45: recorded in "Metabolic Engineering of Escherichia coli for Increased Bioproduction of N-Acetylneuraminic Acid", the genotype is Escherichia coli BL21 (DE3) ΔcheW::P6-glmSA, overexpression ofneuC gene in the temminator locus ofpspG gene under the control of promoter Pl, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression ofNemneuB gene in the terminator locus ofyahO gene under the control of promoter Pl, ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ.

[0041] The formula of seed liquid culture medium is: 10g / L tryptone, 10g / L sodium chloride, 5g / L yeast powder.

[0042] The fermentation medium formula is: 30g / L carbon source (glycerol: glucose = 1:12), 6g / L urea, 3.8mg / L zinc sulfate heptahydrate, 0.33g / L manganese sulfate monohydrate, 5g / L ferric sulfate heptahydrate, 0.1g / L copper sulfate pentahydrate, 0.1g / L cobalt chloride hexahydrate, 4.8g / L yeast powder, 2.4g / L tryptone, 5.336g / L potassium dihydrogen phosphate, 3.284g / L potassium hydrogen phosphate trihydrate, 2.84g / L citric acid monohydrate, 2g / L magnesium sulfate heptahydrate, 4g / L ammonium sulfate, and the pH is adjusted to 7.

[0043] Culture conditions: The recombinant E. coli was inoculated into LB medium and cultured at 37°C 220 rpm for 12-14 h to obtain seed solution, which was then transferred to fermentation medium at an inoculum rate of 1-2% for fermentation (if necessary, 2‰ 0.5 M IPTG was added for induction when OD ≈ 0.5 at 2 h) and reacted at 37°C 220 rpm for 48 h.

[0044] Sample detection method: N-acetylneuraminic acid was detected by Waters liquid chromatography, the chromatographic column was Aminex HPX-87H column (300×7.8mm), the absorption peak was detected at UV 210nm, the mobile phase was 10mM sulfuric acid, the flow rate was 0.5mL / min, and the elution time of N-acetylneuraminic acid was about 9.8 minutes.

[0045] Example 1 Construction of recombinant strains

[0046] (1) Knockout of pfkA and glpK

[0047] The CRISPER / Cpf1 gene editing technology was used to knock out the 6-phosphofructokinase encoding gene pfkA (GeneID: 948412) and the glycerol kinase encoding gene glpK (GeneID: 948423) in the genome of the starting Escherichia coli strain. The N23 sequence of pfkA is

[0048] TGACATGATCAACCGTGGCGGTA, the N23 sequence of glpK is

[0049] TACGCGACAACCTG CTTCAGGAT. First, the Cpf1 plasmid containing the Cas12 cleavage protein was transformed into the Escherichia coli host bacteria by chemical transformation. Using Escherichia coli BL21 (DE3) as a template, PCR amplified the upstream and downstream fragments of the knockout site, each about 800 bp. After the fragments were obtained by PCR amplification, they were connected to the targeted cutting plasmid pcrEG vector in the CRISPER / Cpf1 system through the Gibson assembly kit. After the plasmid was constructed and sequenced, Escherichia coli competent cells containing Cpf1 were made to achieve the knockout of the target gene. After transformation, the transformants were spread on the resistant plate, and single colonies were picked for colony PCR verification of positive transformants and sequencing. The strain with pfkA knocked out was named DC1, and the strain with glpK knocked out on the basis of DC1 was named DC2.

[0050] (2) Construction of genomic recombinant integration glpK22 fragment

[0051] A glycerol kinase mutant enzyme GlpK22 (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2) was selected, and the integration site of glpK22 was selected at the position where glpK was located.

[0052] Using Escherichia coli BL21 (DE3) as a template, primers BL-glpK-3F and BL-glpK-3R were designed to amplify the recombinant integrated NeuC left arm gene and the first half of the glpK mutation fragment.

[0053] BL-glpK-3F:GTTAGCTTGGCCAATCGTTACCGTCAGTTCGCTCAAC

[0054] BL-glpK-3R:TATGCGTTGGAAAGTGCGGTGTT

[0055] Using Escherichia coli BL21 (DE3) as a template, primers PCREG-glpK-4F-2k and BL-glpK-4R-1.5k were designed to amplify the recombinant integrated NeuC right arm gene fragment and the second half of the glpK mutation fragment.

[0056] BL-glpK-4F:ACACCGCACTTTCCAACGCATAG

[0057] BL-glpK-4R:TCGACTTCGAGCAGACTCATCACATTG

[0058] The amplified glpK22 left arm gene fragment, the glpK mutation front half fragment, the glpK mutation second half fragment, and the right arm fragment were constructed by fusion PCR technology to obtain a glpK22 gene fragment with introduced mutations.

[0059] (3) Construction of genomic recombinant integrated glf fragment

[0060] According to the glucose facilitated diffusion transporter gene glf of Pseudomonas mobilis (amino acid sequence as shown in SEQ ID NO.3), a nucleotide sequence encoding the gene glf after codon optimization was synthesized (as shown in SEQ ID NO.4), and the integration site of glf was selected at the location of the PTS phosphotransferase I ptsI gene (GeneID: 946879) and the end of the dadX gene (GeneID: 945754) for knock-in integration.

[0061] Using Escherichia coli BL21 (DE3) as a template, primers BL-glf-ptsI-3F and BL-glf-ptsI-3R were designed to amplify and recombinantly integrate the glf left arm gene.

[0062] BL-glf-ptsI-3F:gttAGCTTGGCCattgattcagcctgtcggaactgg

[0063] BL-glf-ptsI-3R:aaccctaccttacttgtgactgatttttaaaagaac

[0064] Using Escherichia coli BL21 (DE3) as a template, primers BL-glf-ptsI-4F and BL-glf-ptsI-4R were designed to amplify the recombinant integration glf right arm gene fragment.

[0065] BL-glf-ptsI-4F:GCCAGAAGTAATAAtccacgagatgcggcccaattta

[0066] BL-glf-ptsI-4R:agatctaaccagcagcatgagagcgatgaattg

[0067] The glf gene fragment with a nucleotide sequence as shown in SEQ ID NO.4 and the P1 promoter fragment with a nucleotide sequence as shown in SEQ ID NO.5 were synthesized.

[0068] The amplified glf left arm gene fragment, glf right arm gene fragment, P1 promoter fragment and glf gene were constructed and integrated by fusion PCR technology to obtain the recombinant integrated glf gene fragment P1-ptsI-glf.

[0069] Using Escherichia coli BL21 (DE3) as a template, primers BL-glf-dadX-3F and BL-glf-dadX-3R were designed to amplify and recombinantly integrate the left arm gene of glf-dadX.

[0070] BL-glf-dadX-3F:ggcattattttgtatggcgcttcgc

[0071] BL-glf-dadX-3R:gcgtaagcgttttatgtagaacgcc

[0072] Using Escherichia coli BL21 (DE3) as a template, primers BL-glf-dadX-4F and BL-glf-dadX-4R were designed to amplify and recombinantly integrate the glf-dadX right arm gene fragment.

[0073] BL-glf-dadX-4F:cacgctttacccttgatggagcct

[0074] BL-glf-dadX-4R:cgcgtattgcggcactgtttcgt

[0075] The synthetic nucleotide sequences are as shown in SEQ ID NO.4 for the glf gene fragment and SEQ ID NO.5 for the P1 promoter fragment.

[0076] The amplified glf-dadX left arm gene fragment, glf-dadX right arm gene fragment, P1 promoter fragment and glf gene were constructed and integrated by fusion PCR technology to obtain the recombinant integrated glf gene fragment P1-dadX-glf.

[0077] (4) Gene integration

[0078] The fusion fragment glpK22 constructed in step (2) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (gggactaccggatgcggcataaa) in the CRISPER / Cpf1 system through the Gibson assembly kit, and then the constructed plasmid was transformed into the Escherichia coli DC2 competent cells constructed in step (1) containing the Cpf1 plasmid by chemical transformation to obtain a recombinant strain in which glpK22 was integrated at Δglpk, which was named DC3 after verification.

[0079] The fusion fragment P1-ptsI-glf constructed in step (3) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (acgcagtacactctggcagttga) in the CRISPER / Cpf1 system through the Gibson assembly kit, and then the constructed plasmid was transformed into wild-type Escherichia coli BL21 (DE3) competent cells and Escherichia coli DC1, DC3 competent cells by chemical transformation to obtain a recombinant strain in which P1-ptsI-glf was integrated at ΔptsI. The transformants were taken for colony PCR verification, and the strains after successful integration were named DC4, DC5 and DC6-1 respectively. Similarly, after P1-dadX-glf was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (tctgaagtcgagttcgagtcaac) in the CRISPER / Cpf1 system, the constructed plasmid was transformed into DC3 competent cells using the chemical transformation method to obtain a recombinant strain with P1-dadX-glf integrated at the end of dadX, which was named DC7-1 after verification.

[0080] Example 2: Construction of Escherichia coli with glf gene regulated by constitutive promoters of different strengths

[0081] The promoter fragments P2 to P6 shown in SEQ ID NOs. 6 to 10 were synthesized.

[0082] The glf left arm gene fragment, glf right arm fragment, and glf gene obtained in step (3) of Example 1 were fused with the synthetic promoter fragment to obtain Promoter2-6-ptsI-glf fusion fragment.

[0083] The constructed Promoter2~6-ptsI-glf fusion fragment was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (acgcagtacactctggcagttga) in the CRISPER / Cpf1 system using the Gibson assembly kit, and then the constructed plasmid was transformed into DC3 using the chemical transformation method to obtain DC6-2~DC6-6.

[0084] The glf-dadX left arm gene fragment, glf-dadX right arm fragment, and glf gene obtained in step (3) of Example 1 were fused with the synthetic promoter fragment to obtain Promoter2~6-dadX-glf fusion fragments. The constructed Promoter2~6-dadX-glf fusion fragments were connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (tctgaagtcgagttcgagtcaac) in the CRISPER / Cpf1 system through the Gibson assembly kit, and the constructed plasmid was transformed into DC3 by chemical transformation to obtain DC7-2~DC7-6.

[0085] After eliminating the tool plasmid in the gene editing system, the culture was cultured in a fermentation medium (glycerol: glucose = 1:12) at 37°C and 220 rpm for 48 h, and the concentration of the product in the supernatant was determined by high performance liquid chromatography. Figure 2 The strain in which the ptsI system was knocked out and regulated by the P6 promoter showed the highest N-acetylneuraminic acid (NeuAc) production of 8.2 g / L, and the acetic acid production was less than 0.2 g / L. The strain was named ZG01.

[0086] Example 3: Construction of recombinant strains

[0087] (1) Knockout of pfkB

[0088] The 6-phosphofructokinase encoding gene pfkB (GeneID: 946230) was realized on the Escherichia coli ZG01 genome by CRISPER / Cpf1 gene editing technology. The N23 sequence of pfkB is TCCCGAAGGAAAACTGCGCTGTA. First, the Cpf1 plasmid containing Cas12 cleavage protein was transformed into the Escherichia coli host bacteria by chemical transformation. Escherichia coli BL21 (DE3) was used as a template to PCR amplify the upstream and downstream fragments of the knockout site of about 800 bp each. After the fragments were obtained by PCR amplification, they were connected to the targeted cutting plasmid pcrEG vector in the CRISPER / Cpf1 system through the Gibson assembly kit. After the plasmid was constructed and sequenced, Escherichia coli competent cells containing Cpf1 were made to achieve the knockout of the target gene. After transformation, the transformants were spread on the resistant plate, and single colonies were picked for colony PCR verification of positive transformants and sequencing. The strain with pfkB knockout was named ED01.

[0089] (2) Construction of genomic recombinant integrated ED fragment

[0090] The key enzymes of the ED pathway, 6-PG dehydratase EDD and KDPG aldolase EDA, from Pseudomonas mobilis were selected, and the ED pathway integration site was selected at the terminal position of the ettA gene (GeneID: 948909).

[0091] Using Escherichia coli BL21 (DE3) as template, primers BL-edd-3F and BL-edd-3R were designed to amplify the recombinant integration of the left arm gene of the ED pathway.

[0092] BL-edd-3F:

[0093] TCAAACTTAGTTAGCTTGGCCAACCCGTTCCGCTACTGGGAATATATTC

[0094] BL-edd-3R:

[0095] GCGTTGCCAGTTATCTAACGCTGGTTTTCAACTCATCAAAAAACTTATT

[0096] TTATACCTCGCC

[0097] Using E. coli BL21 (DE3) as a template, primers BL-edd-6F and BL-edd-6R were designed to amplify the recombinant integrated ED pathway right arm gene fragment.

[0098] BL-edd-6F:TGATCTGGTTAAACAAGGTTTGAAAAAAACCTGCACGGGBL-edd-6R:

[0099] ATAACAGGGTAATAGATCTAAGGTTGATCAGTTCCGTGACTCAATGG

[0100] Synthesize the codon-optimized EDD and EDA gene fragments, design primers EDD-4F1, EDD-4F2, EDD-4R using EDD as a template, introduce T7 promoter and RBS2 and RBS4 nucleotide sequences to obtain the EDD fragment, and then design primers EDA-5F and EDA-5R using EDA as a template to obtain the EDA fragment

[0101] EDD-4F1:AGCGTTAGATAACTGGCAACGCATGAGAAAGCCCCCGGA AGATCACCTTCCGGGGGCTTTTTTATTGCGCAGTTAGCTCACTCATTAGG C

[0102] EDD-4F2:TGCGCAGTTAGCTCACTCATTAGGCACCGGGATCTTAATACGACTCACTATAGGGGAATTGTGAGCG

[0103] EDD-4R:CCCATCTAGTAGTCCTGTGTGACTCTAGAATTAAAGTTAAA CAAAATTATTTCTACAGGTTAGATGCCTGCACCGCTGAAGATC

[0104] EDA-5F:TCTAGAGTCACACAGGACTACTAGATGGGGATGCGTGATAT CGATTCTGTTATGCGTCTG

[0105] EDA-5R:GGTTTTTTCAAACCTTGTTTAACCAGATCAATACAAATAATA AACGCATGAGAAAGCC

[0106] The amplified ED pathway left arm, right arm, EDD, and EDA fragments were constructed and recombined through fusion PCR technology to obtain the recombinant integrated ED gene fragment T7-RBS2-EDD-RBS4-EDA.

[0107] (3) Gene integration

[0108] The fusion fragment T7-RBS2-EDD-RBS4-EDA constructed in step (2) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (ATCTCGACAGCCTCTTCCAGAGA) in the CRISPER / Cpf1 system using the Gibson assembly kit, and then the constructed plasmid was transformed into the Escherichia coli ED01 competent cells constructed in step (1) containing the Cpf1 plasmid using the chemical transformation method to obtain a recombinant strain with ED integrated at the end of ettA, which was named ED02 after verification.

[0109] Example 4: Construction of Escherichia coli with different ED pathway copy numbers

[0110] (1) Construction of the second copy fragment of the ED pathway for genome recombination integration

[0111] Using Escherichia coli BL21 (DE3) as a template, primers BL-ymgF-3F and BL--ymgF-3R were designed to amplify the second copy of the left arm gene of the recombinant integrated ED pathway.

[0112] BL-ymgF-3F:CCAGAATCAACCCGAATTCTGGATTG

[0113] BL--ymgF-3R:GCCAGCAACCCATTCAGCCG

[0114] Using Escherichia coli BL21 (DE3) as a template, primers BL-ymgF-3F and BL-ymgF-3R were designed to amplify the second copy of the right arm gene of the recombinant integrated ED pathway.

[0115] BL-ymgF-3F: GAAAGGCATTATTGCGCAAATAGTTGTCAAC

[0116] BL-ymgF-3R:

[0117] gtagggataacagggtaatagatctaaTCACCATTCATAAAGATGGTGCCACC

[0118] Using the T7-RBS2-EDD-RBS4-EDA recombinant fragment constructed in step (2) of Example 3 as a template, primers ymgF-ED-F and ymgF-ED-R were designed to amplify the edd-eda fragment.

[0119] ymgF-ED-F:GCTGAATGGGTTGCTGGCagcgttagataactggcaacgcat

[0120] ymgF-ED-R:

[0121] ACTATTTGCGCAATAATGCCTTTCaccagatcaatacaaataataaacgcatgagAAAG

[0122] The amplified second copy left arm, right arm, and edd-eda fragments of the ED pathway were constructed and recombinantly integrated through fusion PCR technology to obtain the recombinant integrated ED second copy gene fragment ymgF-edd-eda.

[0123] (2) Construction of the third copy of the ED pathway for genome recombination integration

[0124] Using Escherichia coli BL21 (DE3) as a template, primers BL-espX5-3F and BL-espX5-3R were designed to amplify the third copy of the left arm gene of the recombinant integrated ED pathway.

[0125] BL-espX5-3F:CCAGAATCAACCCGAATTCTGGATTG

[0126] BL--espX5-3R:GCCAGCAACCCATTCAGCCG

[0127] Using Escherichia coli BL21 (DE3) as a template, primers BL-espX5-3F and BL-espX5-3R were designed to amplify the third copy of the right arm gene of the recombinant integrated ED pathway.

[0128] BL-espX5-3F:aatcgaccctaacgtcgaaatctggat

[0129] BL-espX5-3R:

[0130] acacgcagattgaggttaagtcgaccagatcaatacaaataataaacgcatgagAAAG

[0131] Using the T7-RBS2-EDD-RBS4-EDA recombinant fragment constructed in step (2) of Example 3 as a template, primers espX5-ED-F and espX5-ED-R were designed to amplify the edd-eda fragment.

[0132] espX5-ED-F:cgacttaacctcaatctgcgtgttgc

[0133] espX5-ED-R:gtagggataacagggtaatagatctaagacggaactctaaattcatgttccgctatgc

[0134] The amplified second copy left arm, right arm, and edd-eda fragments of the ED pathway were constructed and recombinantly integrated through fusion PCR technology to obtain the recombinant integrated ED second copy gene fragment espX5-edd-eda.

[0135] (3) Gene integration

[0136] The fusion fragment ymgF-edd-eda in step (1) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (CTTCAATGATCCAGGCGTTCACT) in the CRISPER / Cpf1 system using the Gibson assembly kit, and then the constructed plasmid was transformed into the Escherichia coli ED02 competent cells containing the Cpf1 plasmid by chemical transformation to obtain a recombinant strain with ED integrated at the end of ymgF, which was named ED03 after verification.

[0137] The fusion fragment espX5-edd-eda in step (2) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (agattacctcgggcctggttacg) in the CRISPER / Cpf1 system using the Gibson assembly kit, and then the constructed plasmid was transformed into the Escherichia coli ED03 competent cells containing the Cpf1 plasmid by chemical transformation to obtain a recombinant strain with ED integrated at the end of espX5, which was named ED04 after verification.

[0138] (4) Fermentation verification

[0139] After eliminating the tool plasmid in the gene editing system, ZG01 and ED01-ED04 strains were cultured in a fermentation medium (glycerol: glucose = 1:12) at 37°C and 220 rpm for 2 h, and then 2‰ 0.5 M IPTG was added. After further culturing for 46 h, the concentration of the product in the supernatant was determined by high performance liquid chromatography. Figure 3 It showed that after knocking out pfkB, OD decreased by 28.8% and yield decreased by 22.3%. When the second copy was integrated, the yield and OD recovered and NeuAc reached 5.9 g / L.

[0140] Example 5: RBS optimization of the second copy of the ED pathway

[0141] (1) Construction of a second copy of the ED pathway with different RBS strengths by genome recombination

[0142] Primers were designed to amplify EDD fragments containing RBS fragments as shown in SEQ ID NOs. 16 to 18 and EDA fragments containing RBS fragments as shown in SEQ ID NOs. 19 to 21. By combining them in pairs, nine edd-eda fragment combinations were obtained (among which, in EDD-RBS, the intensities of SEQ ID NOs. 16 to 18 increased sequentially; in EDA-RBS, the intensities of SEQ ID NOs. 19 to 21 increased sequentially).

[0143] The second copy left arm fragment, right arm fragment, edd fragment and eda fragment in step (1) of Example 4 were recombinantly integrated by fusion PCR technology to obtain the recombinant integrated ED second copy gene fragment ymgF-edd-eda-1~9.

[0144] (2) Gene integration

[0145] The fusion fragment ymgF-edd-eda in step (1) was connected to the targeted cutting plasmid pcrEG vector containing the N23 recognition sequence (CTTCAATGATCCAGGCGTTCACT) in the CRISPER / Cpf1 system using the Gibson assembly kit, and then the constructed plasmid was transformed into the Escherichia coli ED02 competent cells containing the Cpf1 plasmid by chemical transformation to obtain the recombinant strain with ED integrated at the end of ymgF. After verification, the recombinant strain was named ED05-1~9.

[0146] (3) Fermentation verification

[0147] After eliminating the tool plasmid in the gene editing system of ZG01 and ED05-1~9 strains (i.e., ED05-1~8 and ED03 in the figure), they were cultured in a fermentation medium (glycerol: glucose = 1:12) at 37°C, 220rpm for 2h, and then 2‰ 0.5M IPTG was added. After further culturing for 46h, the concentration of the product in the supernatant was determined by high performance liquid chromatography, as shown in FIG. Figure 4 It shows that when edd is at high intensity and eda is at medium intensity (ED05-5, i.e., EDD-RBS is SEQ ID NO.18, EDA-RBS is SEQ ID NO.20), NeuAc increases by 1.42 g / L (17.7%) to 9.44 g / L (the yield of ZG01 in this batch is 8.02 g / L, which is slightly different from the yield in the above example due to batch problems, so the yield recorded in the full text is the yield of the batch to which the strain belongs).

[0148] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli comprises the following transformations: Knock out the 6-phosphofructokinase encoding gene pfkA, the 6-phosphofructokinase encoding gene pfkB and the glycerol kinase encoding gene, overexpress the glycerol kinase mutant encoding gene, knock out the PTS phosphotransferase I encoding gene and integrate the glucose facilitated diffusion transporter encoding gene at this site, integrate the expression cassette containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene on the genome and at least one copy is integrated at the gene ymgF site; The glucose facilitated diffusion transporter encoding gene is expressed by a promoter whose nucleotide sequence is shown in SEQ ID NO.10, and the amino acid sequence of the glycerol kinase mutant is shown in SEQ ID NO.

1.

2. The recombinant Escherichia coli according to claim 1, characterized in that Contains at least one of the following characteristics: (1) The host bacteria of the recombinant Escherichia coli include Escherichia coli BL21 (DE3) ΔcheW::P6-glmSA, overexpression of neuC gene in the temminator locus of pspG gene under the control of promoter Pl, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuBgene in the terminator locus of yahO gene under the control of promoter Pl, ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ; (2) integrating and expressing two copies of the expression cassette containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene, with the integration sites located in the ettA gene and the ymgF gene, respectively; (3) The overexpression is integrated expression and / or free expression.

3. The recombinant Escherichia coli according to claim 2, characterized in that Contains at least one of the following characteristics: (1) The GeneID of ettA gene is 948909; the GeneID of ymgF gene is 1450253; (2) Knock out the glycerol kinase encoding gene and integrate and express the glycerol kinase mutant encoding gene at this site.

4. The recombinant Escherichia coli according to claim 1, characterized in that The expression frame containing the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene also includes a promoter and / or a regulatory element RBS; The regulatory element RBS includes the sequences shown in SEQ ID NO.16-21; Promoters include T7 promoter; Preferably, the RBS regulating the 6-PG dehydratase encoding gene is the sequence shown in SEQ ID NO.18, and the RBS regulating the KDPG aldolase encoding gene is the sequence shown in SEQ ID NO.

20.

5. The recombinant Escherichia coli according to claim 1, characterized in that The GeneID of the 6-phosphofructokinase encoding gene pfkA is 948412; the GeneID of the 6-phosphofructokinase encoding gene pfkB is 946230; the GeneID of the glycerol kinase encoding gene is 948423; the Gene ID of the PTS phosphotransferase I encoding gene is 946879; the amino acid sequence of the glucose facilitated diffusion transporter is shown in SEQ ID NO.3; the amino acid sequence of the 6-PG dehydratase is shown in SEQ ID NO.11; the amino acid sequence of the KDPG aldolase is shown in SEQ ID NO.13; The nucleotide sequence of the gene encoding the glycerol kinase mutant is shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the glucose-facilitated diffusion transporter is shown in SEQ ID NO.4; the nucleotide sequence of the 6-PG dehydratase is shown in SEQ ID NO.12; and the nucleotide sequence of the KDPG aldolase is shown in SEQ ID NO.

14.

6. A method for constructing a recombinant Escherichia coli, characterized in that: The following steps are involved: Using Escherichia coli BL21 (DE3) ΔcheW::P6-glmSA, overexpression ofneuC gene in the terminator locus of pspG gene under the control of promoter Pl, ΔmotA::P1-glmM-P4-glmUglmSA, overexpression of NemneuB gene in the terminator locus ofyahO gene under the control of promoter Pl, ΔwecBΔmanAΔpykA, ΔnagΔnanATEΔmanXYZ as host bacteria, 6-phosphofructokinase encoding gene pfkA, 6-phosphofructokinase encoding gene pfkB and glycerol kinase encoding gene were knocked out, and the glycerol kinase mutant encoding gene with the amino acid sequence shown in SEQ ID NO.1 was integrated into the genome, the PTS phosphotransferase I encoding gene was knocked out, and the gene containing SEQ ID NO.1 was integrated into the locus by homologous recombination. The glucose-facilitated diffusion transporter encoding gene expression cassette of the promoter shown in NO.10 is integrated into one copy at the ymgF site and the ettA site respectively by homologous recombination, and also contains the expression cassettes of the 6-PG dehydratase encoding gene and the KDPG aldolase encoding gene.

7. Use of the recombinant Escherichia coli according to any one of claims 1 to 5 or the recombinant Escherichia coli obtained by the construction method according to claim 6 in the preparation of N-acetylneuraminic acid or its derivatives.

8. A method for producing N-acetylneuraminic acid, characterized in that: The method comprises the step of fermenting and producing by using the recombinant Escherichia coli described in any one of claims 1 to 5 or the recombinant Escherichia coli obtained by the construction method of claim 6.

9. The production method according to claim 8, characterized in that: The fermentation production comprises fermentation with a composite carbon source, wherein the composite carbon source contains glucose and glycerol.

10. The production method according to claim 9, characterized in that: Contains at least one of the following characteristics: (1) In the composite carbon source, the mass ratio of glycerol to glucose is 1:(8-16); (2) The fermentation medium used in the fermentation production contains: 20-40 g / L composite carbon source, 3-9 g / L urea, 1-6 mg / L zinc sulfate heptahydrate, 0.01-1 g / L manganese sulfate monohydrate, 1-10 g / L iron sulfate heptahydrate, 0.01-1 g / L copper sulfate pentahydrate, 0.01-1 g / L cobalt chloride hexahydrate, 1-10 g / L yeast powder, 1-5 g / L tryptone, 1-10 g / L potassium dihydrogen phosphate, 1-10 g / L potassium hydrogen phosphate trihydrate, 1-10 g / L citric acid monohydrate, 1-10 g / L magnesium sulfate heptahydrate, and 1-10 g / L ammonium sulfate; (3) Fermentation production includes culturing at 35-37°C and 180-280 rpm.

Images