KASP molecular marker closely linked with capsicum fruit color gene CaCHL1 as well as primer, kit, obtaining method and application of KASP molecular marker closely linked with capsicum fruit color gene CaCHL1

Abstract

The invention belongs to the field of pepper breeding and molecular biology, and discloses a KASP molecular marker closely linked with a pepper fruit color gene CaCHL1, the gene of pepper zunla-1 is used as a reference gene, and the single nucleotide polymorphism at the 13072545th basic group on a pepper chromosome 5 is subjected to basic group G-C replacement. The invention further discloses a primer and a kit for identifying the KASP molecular marker closely linked with the pepper fruit color gene CaCHL1 and application of the primer and the kit in identifying pepper fruit color types or molecular assisted breeding. The screened KASP molecular marker can be directly used for identifying the pepper fruit color, then auxiliary breeding is carried out by depending on the molecular marker, the problems that conventional breeding is long in period and prone to being influenced by the environment can be effectively solved, and the KASP molecular marker has important significance in pepper fruit color breeding practice and research on fruit color change and regulation and control mechanisms.

Description

Technical Field

[0001] The invention belongs to the field of pepper breeding and molecular biology, and particularly relates to a KASP molecular marker tightly linked to a pepper fruit color gene CaCHL1 and its primers, a kit, an acquisition method and its application in predicting pepper fruit color changes and molecular assisted breeding. Background Art

[0002] chili( Capsicum annuum L. ) belongs to the genus Capsicum in the Solanaceae family and is one of the most important vegetable crops in China. The fruit is the most important economic output of pepper. Pepper fruit has rich colors. In the green fruit stage, the carotenoid content is low, and chlorophyll, as the main pigment, determines the color of pepper fruit; immature fruits have a variety of colors such as dark green, light green, yellow-green, milky white, purple, and black. Pepper fruit color is an important appearance economic trait that affects consumer choice, and it is also one of the important goals of breeding.

[0003] The development of gene sequencing technology and the publication of the pepper genome sequence have promoted the application of molecular breeding technology in peppers and the rapid development of pepper genomics. The positioning and cloning of genes related to a series of important breeding traits have laid the foundation for the development of molecular markers and their application in pepper breeding. In terms of yield traits, researchers have identified about 215 fruit-related QTLs sites through natural populations or hybrid populations, of which 17 sites have a genetic effect greater than 20%. Using 94 pepper materials for genome-wide association analysis (GWAS), 16 SNP sites were identified to be associated with fruit weight, of which 7 SNPs were located on known fruit weight genes, such as STYLOSA , FASCIATED , WUSCHEL and CLAVATA1 Isogenic. C. annuum x C. frutescens Several QTLs for flesh thickness were identified on chromosome 4 of the material, and QTLNloLG25.1 was found to be associated with the number of ovaries. C. annuum Two QTLs for flesh thickness were identified in the population. Qpt.iivr-2.1 , Qpt.iivr-3.1 , ftd2.1 and other QTLs loci, and found that QTL NloLG25.1 was associated with ovary number. Ma et al. (2022) used C. annuum cv. GS6 x C. annuum cv. Qiemen The constructed F2 and F2:3 genetic populations identified key QTLs controlling fruit length, fruit width, fruit shape, fruit weight and number of ventricles: ftl2.1 , ftd2.1 , fts1.1 , ftw2.1 and lcn1.1Although some relevant gene QTLs have been discovered in pepper fruit trait research, the action modes of these regulatory factors are still poorly understood, and their application is still limited and inefficient.

[0004] At present, the research on the mechanism of pepper fruit color mainly focuses on the synthetic metabolic mechanism of capsanthin, and the breeding goal is concentrated on breeding new pepper varieties with high capsanthin; less attention has been paid to the analysis of the genetic mechanism of pepper chlorophyll.

[0005] Therefore, exploring the key genes or QTL functions of important agronomic traits of pepper, such as fruit color, and developing molecular markers related to fruit color will be beneficial to the breeding of pepper fruit color, and lay the foundation for cloning stay-green genes and studying the molecular mechanism of chlorophyll degradation. Summary of the invention

[0006] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 and its primers, kit, acquisition method and application.

[0007] In order to solve the above technical problems, the technical solution proposed by the present invention is: A KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, with the pepper zunla-1 gene as the reference gene, and a single nucleotide polymorphism at base 13072545 on pepper chromosome 5, where a base substitution from G to C occurred.

[0008] The above-mentioned KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, preferably, the pepper fruit color gene CaCHL1 The CDS nucleotide sequence of the coding region is shown in SEQ ID NO: 1: [G / C]AGAATAGAGACATCGTCTCGCGGACATTGTCAAGTGGTTAGAGGAGAAAATAAGGATGGGTAACTCAAGGCTAGAGAGGCAACAAAAGCAAGCAAATGATCAAAAAATCAGCAGCAGTTAG。

[0009] The above-mentioned KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 preferably has a nucleotide sequence as shown in SEQ ID NO: 2: GCTCTCCTACGGTGAATTTCCACAGAATAGAGACATCGTCTTCGCGGACATTGTCAAGTGGTTAGAGGAGAAAATAAGGATGGGTAACTCAAGGCTAGAGAGGCAACAAAAGCAAGCAAATGATCA.

[0010] As a general inventive concept, the present invention also provides a primer for identifying a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, comprising: Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′ (as shown in SEQ ID NO: 3); Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′ (as shown in SEQ ID NO: 4); Reverse primer: 5'-TGATCATTTGCTTGCTTTTGTTGC-3' (as shown in SEQ ID NO: 5).

[0011] The above primers, preferably, the two forward primers are connected to different fluorescent linker sequences respectively, the linker sequence matching FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT (as shown in SEQ ID NO: 6), and the linker sequence matching HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT (as shown in SEQ ID NO: 7).

[0012] As a general inventive concept, the present invention also provides a kit for identifying KASP molecular markers tightly linked to pepper fruit color gene CaCHL1, comprising the above-mentioned primers.

[0013] As a general inventive concept, the present invention also provides a method for screening a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, comprising the following steps: (1) Resequencing pepper materials, and conducting genome-wide association analysis on pepper fruit color traits based on the resequencing results. On this basis, a high-generation inbred line with light green fruit was used as the male parent, and a high-generation inbred line with dark green fruit was used as the female parent to construct an F2 population; (2) The fruit color phenotype of the F2 population was identified, and a light green fruit pool and a dark green fruit pool were obtained by using a mixed pool separation analysis population positioning method, and RNA-seq sequencing was performed. After bioinformatics analysis of the sequencing results, candidate chromosome regions linked to pepper fruit color were obtained; (3) Developing molecular marker technology for single base substitution / insertion / deletion in the candidate region of the chromosome to narrow the candidate interval and ultimately obtain the KASP molecular marker that is closely linked to the pepper fruit color gene.

[0014] As a general inventive concept, the present invention also provides an application of the above-mentioned KASP molecular marker or the above-mentioned primer or the above-mentioned kit in identifying pepper fruit color types or molecular-assisted breeding, which is beneficial to the rapid identification and breeding of pepper fruit color genes, and is for cloning the major effect gene controlling fruit color, laying a foundation for studying the regulatory mechanism of fruit color changes.

[0015] The above application preferably comprises the following steps: (1) Extracting DNA from pepper samples to be tested as a template; (2) adding the above-mentioned primers or the above-mentioned kit to perform PCR amplification; (3) Perform genotyping on the amplified products and read the genotyping results.

[0016] In the above application, preferably, in step (2), the PCR amplification program is: Preincubation 94°C 900S; 94°C 20S, 78°C 10S, TD 62°C, 0 Cyc->57 (-0°C), 10 cycles; 94°C 20S, 57°C 60S, 35 cycles; Cooling 37°C 30S.

[0017] In the above application, PARMS PCR amplification is performed using a quantitative PCR device; when the distance between the fluorescent group and the corresponding fluorescent quenching group is close, the fluorescence emitted by the fluorescent group will be absorbed by the quenching group, emitting fluorescence with a longer wavelength or releasing heat. At this time, the fluorescent signal of the group cannot be detected within the wavelength corresponding to this fluorescence. Once the two are separated, the fluorescent signal can be detected. PARMS uses the FRET principle to detect the amplification signals of FAM and HEX fluorescent primers. When the corresponding allele is amplified, the corresponding fluorescent signal will appear. When performing genotyping on the amplified products, if only the fluorescent signal (blue) corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected in the amplified products, the detection site is the G:G genotype, and the pepper fruit is judged to be a light green dominant plant; if only the fluorescent signal (green) corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected in the amplified products, the detection site is the C:C genotype, and the pepper fruit is judged to be a dark green recessive plant; if the fluorescent signals (red) corresponding to the forward primers 1 and 2 connected to the fluorescent linker sequence are detected in the amplified products at the same time, the detection site is the G:C genotype, and the pepper fruit is judged to be a light green heterozygous plant.

[0018] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention screened a KASP molecular marker that can be directly used for the identification of pepper fruit color, and then relied on this molecular marker for assisted breeding, which can effectively solve the problems of long conventional breeding cycles and susceptibility to environmental influences. It is of great significance in the practice of pepper fruit color breeding and the study of fruit color change and regulation mechanism. The marker was used to identify the genotypes of 90 randomly sampled individual plants in the F2 population, and the coincidence rate reached 100%. This result not only helps in the identification of pepper fruit color and assisted breeding, but also lays a foundation for the map-based cloning of fruit color genes and the analysis of the molecular mechanism of pepper fruit color change.

[0019] (2) The present invention can quickly screen satisfactory plants by using the KASP molecular marker at an early stage, effectively reducing the planting scale, reducing the workload of later identification, and improving the efficiency and accuracy of selection, which is of great significance for studying the color formation mechanism of fruit color. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The dark green and light green fruit parent phenotypes of pepper in the embodiment of the present invention; Figure 2 for CaCHL1 The initial chromosome location; Figure 3 Partial results of genotyping in the F2 population constructed from “19CL148” and “LY116”. DETAILED DESCRIPTION

[0021] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0022] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0023] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0024] Embodiment 1: In this example, two highly homozygous materials were used to construct an F2 population. The chromosome region that is closely linked to pepper fruit color (light green) was obtained by using the pool segregation analysis (BSA) population positioning method, and molecular markers were developed within the candidate interval to determine the candidate gene. CaCHL1 The nucleotide sequence is shown in SEQ ID NO: 1. A KASP molecular marker screened based on the base mutation of the candidate gene can be directly used for the identification of pepper fruit color, and then relying on the molecular marker for assisted breeding can effectively solve the problem of long conventional breeding cycle and susceptibility to environmental influences. By using the molecular marker in the early stage, satisfactory plants can be quickly screened, effectively reducing the planting scale, reducing the workload of later identification, and improving the efficiency and accuracy of selection.

[0025] Pepper fruit color gene CaCHL1 The method for obtaining the linked molecular marker KASP molecular marker is as follows: Construction of genetic populations In the early stage of this invention, a mutant resource "LY116" with dark green pepper (high chlorophyll content) at the green and ripe stage that can be stably inherited was screened from the '19CL148' mutant library. Through phenotypic observation and physical and chemical index determination, it was found that except for the chlorophyll content of the green and ripe fruit of the mutant being significantly higher than that of the wild type, the other traits were basically the same. The mutant and its wild type were used as parents (such as Figure 1 The F1 and F2 populations were constructed and planted. The results of genetic analysis showed that the phenotype of the green-ripe fruit in the F1 population was light green; there were 359 low-chlorophyll (light green) and 126 high-chlorophyll (dark green) mutant plants in the F2 population, with a separation ratio of 2.84:1. The chi-square test 2=0.186 was in line with the separation ratio of 3:1 (2<3.86). The above genetic analysis results showed that the high-chlorophyll content mutant phenotype was controlled by a pair of single recessive genes.

[0026] 2. Fruit color identification The chlorophyll content of green pepper fruits of mutant "LY116" and wild type "19CL148" 30 days after flowering was determined.

[0027] 3. Fruit color gene location 25 dark green and light green fruit plants were selected, and leaf DNA was extracted from each plant. After the sample DNA passed the quality inspection, the light green pool and dark green pool DNA were mixed in equal amounts. The whole genome resequencing of the two mixed pools (sequencing depth of 30×) and the two parents (sequencing depth of 10×) was performed using the Illumina sequencing platform. The F2 segregation population was further expanded to 1,000 plants, and the recombinant plant F3 selected from the first round of F2 was added. Then, based on the initial positioning CaCHL1 SNP information on both sides of the gene, such as Figure 2 As shown, Geneious software was used to develop KASP marker primers, and the selected markers and typing results were used together for linkage analysis using join map 4.0. Combined with the genetic map, the software map-QTL was used for QTL prediction and fine positioning. CaCHL1 .

[0028] 4. Development of molecular markers linked to dark green fruit color Analyze the annotation information of genes in the fine-positioned interval to find functionally related genes. Extract total RNA from different tissues of chlorophyll mutants and wild types, mix the RNAs and reverse transcribe them into cDNA. Based on the candidate gene sequence in the reference genome, use Geneious to design primers, use the parental cDNA as a template, perform PCR amplification, purify the amplified product, and perform TA cloning and sequencing. The sequencing alignment is correct, and the full-length CDS cloning of the candidate gene is completed. CaCHL1 The CDS nucleotide sequence of the coding region is shown in SEQ ID NO: 1, and the sequence of the gene was further cloned. Through sequencing, it was found that the gene had a 1-base variation, and the KASP marker primers were designed for the site markers. It was found that they could well distinguish the dark green, light green and F1 of the parents, and 90 random single plants in the F2 population were genotyped. The gene of pepper zunla-1 was used as the reference gene. The KASP molecular marker was a single nucleotide polymorphism at the 13072545th base on pepper chromosome 5, where a base G to C substitution occurred. The nucleotide sequence of the marker KASP is shown in SEQ ID NO: 2, and the 23rd base in SEQ ID NO: 2 was replaced by G to C.

[0029] 5. Application of molecular markers linked to dark green fruit color (1) CTAB method was used to extract DNA from 90 individual plants in the F2 population a. Add dithiothreitol (DTT, 0.2%) to the CTAB extraction solution; b. Add 2 fresh leaves the same size as the cap of the centrifuge tube into a 2.0 ml centrifuge tube; grind them into powder with liquid nitrogen, add 800 µL CTAAB buffer and mix well; c. 65℃ water bath for 45min, gently shake 3 times during the period, and cool to 4℃ or room temperature to below 15℃ after water bath; d. Add 500 chloroform / isoamyl alcohol (24:1) and mix up and down for 5 minutes to ensure that the sample and chloroform are fully mixed; e. Centrifuge at 12,000 rpm for 10 min; take 500 µL of the supernatant and add it to a 1.5 ml centrifuge tube pre-added with 500 µL of isopropanol, gently invert upside down to mix; let stand at 4°C or -20°C for 30 min; f. Centrifuge at 12,000 rpm for 20 min and discard the supernatant; wash the precipitate with 500 ul of 75% alcohol, centrifuge at 12,000 rpm for 5 min and discard the supernatant; g. Air-dry the DNA to allow the alcohol to evaporate completely; add 100µL of pure water (containing a final concentration of 1% RNase) to dissolve the DNA; h. Remove RNA in a 37℃ water bath or at room temperature for 1 hour; take DNA for electrophoresis. After the band is confirmed to be intact, use a micro-spectrophotometer to measure the DNA concentration. The ratios of 260 / 280 and 260 / 230 must be greater than 1.8. Dilute the DNA to 100 ng and place at -20℃ for later use.

[0030] (2) KASP marker typing of individual plants in the F2 population a. KASP primer reagent is generally composed of 3 primers, 2 of which are allele-specific forward primers; 1 is a universal reverse primer; the 2 allele-specific forward primers only differ in the 3' end base, corresponding to different alleles. Allele-specific forward primers will produce different fluorescent signals through competitive PCR reaction. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT; KASP primers were designed by SNPWay ( http: / / www.snpway.com / ): Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′; Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′; Reverse primer: 5′-TGATCATTTGCTTGCTTTTTGTTGC-3′; b. KASP primer synthesis was from Qingke Biotechnology (PAGE purification); c. The typing system is shown in Table 1 below: Table 1: Classification system

[0031] Amplification Procedure: Preincubation 94℃ 900s; 94℃ 20s, 78℃ 10s, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20s, 57℃ 60s, 35 cycles; Cooling 37℃ 30s.

[0032] (3) Typing results The KASP marker was used to perform phenotypic identification of the fruit color of individual plants in the F2 population. If only the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent linker sequence was detected in the amplified product (blue), the detection site was the G:G genotype, and the pepper fruit was determined to be a light green dominant plant; if only the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent linker sequence was detected in the amplified product (green), the detection site was the C:C genotype, and the pepper fruit was determined to be a dark green recessive plant; if the fluorescent signals corresponding to both forward primers 1 and 2 connected to the fluorescent linker sequence were detected in the amplified product (red), the detection site was the G:C genotype, and the pepper fruit was determined to be a light green heterozygous plant.

[0033] The fruit color and genotype of 90 individual plants in the F2 population constructed by 19CL148 and LY116 using KASP marker are shown in Table 2. Some of the results are shown in Figure 3 As shown, the genotyping results were 100% consistent with the phenotyping results.

[0034] Table 2: Fruit color and genotype of 90 individual plants in the F2 population constructed by 19CL148 and LY116 using KASP marker

[0035] The above identification results show that by retaining the material in which the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected through molecular marker identification and screening in breeding, a homozygous material with a green ripe fruit color of light green can be bred. By retaining the material in which the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected, a homozygous material with a green ripe fruit color of dark green can be bred. By retaining the material in which both the fluorescent signals of the forward primer 1 and the forward primer 2 connected to the fluorescent linker sequence are detected, a heterozygous material with a green ripe fruit color of light green can be bred. The screening of molecular markers in the early stage can reduce the workload of the later screening and identification, and accelerate the breeding process.

Claims

1. A KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1, characterized in that: Taking the gene of pepper zunla-1 as the reference gene, the single nucleotide polymorphism at the 13072545th base on chromosome 5 of pepper, where the base substitution from G to C occurred.

2. The KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 according to claim 1, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

2.

3. A primer for identifying the KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 as claimed in claim 1 or 2, characterized in that: include: Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTGCTCTCCTACGGTGAATTTCCA-3′; Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTGCTCTCCTACGGTGAATTTCCAC-3′; Reverse primer: 5′-TGATCATTTGCTTGCTTTTGTTGC-3′.

4. The primer according to claim 3, characterized in that The two forward primers are connected to different fluorescent linker sequences respectively, wherein the linker sequence matching the FAM fluorescence in forward primer 1 is GAAGGTGACCAAGTTCATGCT, and the linker sequence matching the HEX fluorescence in forward primer 2 is GAAGGTCGGAGTCAACGGATT.

5. A kit for identifying the KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 as claimed in claim 1 or 2, characterized in that: Comprising the primers as claimed in claim 3 or 4.

6. A method for screening a KASP molecular marker tightly linked to the pepper fruit color gene CaCHL1 as claimed in claim 1 or 2, characterized in that: The following steps are involved: (1) Resequencing pepper materials, and conducting genome-wide association analysis on pepper fruit color traits based on the resequencing results. On this basis, a high-generation inbred line with light green fruit was used as the male parent, and a high-generation inbred line with dark green fruit was used as the female parent to construct an F2 population; (2) The fruit color phenotype of the F2 population was identified, and a light green fruit pool and a dark green fruit pool were obtained by using a mixed pool separation analysis population positioning method, and RNA-seq sequencing was performed. After bioinformatics analysis of the sequencing results, candidate chromosome regions linked to pepper fruit color were obtained; (3) Developing molecular marker technology for single base substitution / insertion / deletion in the candidate region of the chromosome to narrow the candidate interval and ultimately obtain the KASP molecular marker that is closely linked to the pepper fruit color gene.

7. Use of the KASP molecular marker according to claim 1 or 2, the primer according to claim 3 or 4, or the kit according to claim 5 in identifying pepper fruit color types or molecular assisted breeding.

8. The use according to claim 7, characterized in that The following steps are involved: (1) Extracting DNA from pepper samples to be tested as a template; (2) adding the primers described in claim 3 or 4 or the kit described in claim 5 to perform PCR amplification; (3) Perform genotyping on the amplified products and read the genotyping results.

9. The use according to claim 8, characterized in that In step (2), the PCR amplification program is: Preincubation 94℃ 900S; 94℃ 20S, 78℃ 10S, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20S, 57℃ 60S, 35 cycles; Cooling 37℃ 30S.

10. The use according to claim 8, characterized in that When performing genotyping on the amplified product, if only the fluorescent signal corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is a G:G genotype, and the pepper fruit is determined to be a light green dominant plant; if only the fluorescent signal corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected in the amplified product, the detection site is a C:C genotype, and the pepper fruit is determined to be a dark green recessive plant; if the fluorescent signals corresponding to the forward primers 1 and 2 connected to the fluorescent linker sequence are detected in the amplified product at the same time, the detection site is a G:C genotype, and the pepper fruit is determined to be a light green heterozygous plant.

Images