Catharanthus roseus EIN3-EILs transcription factor and application thereof

Abstract

The invention discloses a catharanthus roseus EIN3-EILs transcription factor and application thereof, and relates to the technical field of biology, the nucleotide sequence of the transcription factor CrEIN3 is shown as SEQ ID NO: 1, and the protein coding sequence is shown as SEQ ID NO: 2; the overexpression method comprises the following steps: cloning a catharanthus roseus CrEIN3 gene; constructing an overexpression vector; through agrobacterium tumefaciens mediation, an agrobacterium tumefaciens engineering strain is obtained; and instantaneously converting the Catharanthus roseus petals. The Catharanthus roseus EIN3-EILs transcription factor CrEIN3 is applied to increase of the content of vinblastine in Catharanthus roseus. The CrEIN3 is instantly overexpressed in the catharanthus roseus petals, so that the synthesis of the vinblastine in the catharanthus roseus petals can be remarkably improved, and the method has important significance for efficiently producing the vinblastine in the catharanthus roseus.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Catharanthus roseus EIN3-EILs transcription factor and an application thereof. Background Art

[0002] Catharanthus roseus (L.) G. Don, as one of the model plants for studying terpenoid indole alkaloids (TIAs), can produce nearly 200 terpenoid indole alkaloids. TIAs are a type of secondary metabolites produced by plants in the long-term process of adapting to the ecological environment to protect themselves. Some of them have strong pharmacological activity and are mainly used in the clinical treatment of various diseases. Terpenoid indole alkaloids in Catharanthus roseus include ajmalicine, vindoline, catharanthine, serpentine, vinblastine and vincristine. The bi-indole alkaloids vincristine and vinblastine occupy an indispensable position in most chemotherapy for Hodgkin's lymphoma, lymphosarcoma, neuroblastoma, breast cancer, lung cancer and childhood leukemia. At present, the United States has approved a number of commercial drugs using vincristine as raw materials, such as vinorelbine, which is the sulfate of vincristine and is very effective in treating cancers such as acute leukemia, breast cancer, neuroblastoma, ovarian cancer, chronic lymphocytic leukemia, etc. In addition, studies have shown that amaline and snakeroot alkaloids are used to treat circulatory system diseases, especially to relieve cerebrovascular mental disorders and allergic reactions. Vindoline and vincristine have certain effects in lowering blood lipids and can be used to treat diseases such as diabetes.

[0003] Currently, only Catharanthus roseus is the only plant source for producing vinblastine and vincristine, and the dry weight of Catharanthus roseus plants contains only one ten-thousandth of bisindole alkaloids (nearly 500-750 kg of dry leaves only produce 1.0 gram of vinblastine), and the extraction cost is high. It is difficult for cells cultured in vitro to synthesize alkaloids, and it is difficult to produce TIAs without specific induction. At present, it has been reported that artificial semi-synthesis can be used, but the substrate still needs to be extracted from Catharanthus roseus, and the industrial production efficiency is very low. So far, there is no other more economical way to obtain bisindole TIAs, and metabolic engineering and other means are currently the most effective way to increase the production of TIAs. Therefore, in-depth research on the molecular regulatory mechanism of vinca alkaloid synthesis is the basis for increasing the production of TIAs.

[0004] All TIAs of Catharanthus roseus are derived from the intermediate precursor 3α(S)-stritosidine. The upstream of TIAs biosynthesis is divided into the iridoid pathway (multiple enzymatic reactions to synthesize secologanin) and the shikimic acid pathway (multiple enzymatic reactions to synthesize tryptamine). Among them, secologanin is derived from isopentenyl diphosphate (IPP). In the presence of IPP, indole alkaloids are mainly synthesized in the plastids through the MEP pathway. Further, secologanin and tryptamine are condensed by isostractosidine synthase (STR) to form isostractosidine. Subsequently, in the downstream pathway, 3α(S)-isostractosidine is converted into strictosidine aglycone under the action of isostractosidine β-D-glucosidase (SGD), which can be used to synthesize various TIAs. Further, dihydroprecondylcarpine acetate is formed through multi-step enzymatic reactions, and then catharanthine synthase (CS) and tabersonine synthase (TS) are used to form catharanthine and tabersonine. Tabersonine undergoes seven-step reactions to form vinblastine. Finally, catharanthine and vinblastine form vinblastine under the action of peroxidase 1 (PRX1), generating the intermediate product α-3', 4'-anhydrovinblastine, and then anhydrovinblastine, vinblastine and vincristine are generated through multiple steps. Among them, DXS1, TDC, 7-DLGT, 7DLH, LAMT, SLS, Asα, and STR are upstream synthetic genes, and SGD, REDOX2, SAT, HL1, HL2, DAT, and PRX1 are downstream synthetic genes.

[0005] EIN3 / EILs transcription factors are important nuclear transcription factors in the ethylene signal transduction pathway. They have been isolated from a variety of higher plants and belong to a small family of transcription factors. This type of transcription factor is highly conserved at the N-terminus of the amino acid sequence and regulates the expression of related genes by directly binding to the primary ethylene response element (PERE). It is not only involved in important life activities such as fruit ripening, flower senescence, salt resistance, frost resistance, and mechanical injury resistance, but also participates in regulating the synthesis of plant secondary metabolites.

[0006] CrEIN3 is an EIN3 / EILs transcription factor isolated from Catharanthus roseus. Transient expression in the petals of Catharanthus roseus significantly increased the content of vinblastine, indicating that this is a potential transcription factor that promotes the biosynthesis of vinblastine. Therefore, this transcription factor is of great significance for promoting the efficient synthesis of vinblastine. In known studies, the CrERF5 transcription factor that responds to ethylene signals in Catharanthus roseus has a regulatory effect on the synthesis of terpenoid indole alkaloids, while the gene function of EIN3 / EIL1 transcription factors in the ethylene signaling pathway in Catharanthus roseus has rarely been reported.

[0007] Therefore, technicians in this field are committed to developing a Catharanthus roseus EIN3 / EILs transcription factor CrEIN3 that can positively regulate the expression of key genes in the vinblastine biosynthesis pathway, thereby promoting the biosynthesis of vinblastine. Summary of the invention

[0008] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is to develop a Catharanthus roseus EIN3 / EILs transcription factor CrEIN3, which can positively regulate the expression of key genes in the vinblastine biosynthesis pathway, thereby promoting the biosynthesis of vinblastine.

[0009] To achieve the above object, the present invention provides a Catharanthus roseus EIN3-EILs transcription factor CrEIN3, the nucleotide sequence of the transcription factor CrEIN3 is shown in SEQ ID NO: 1, and the protein coding sequence is shown in SEQ ID NO: 2.

[0010] Furthermore, the full-length sequence and related information of the Catharanthus roseus EIN3 / EILs-type transcription factor CrEIN3 gene.

[0011] Furthermore, the CrEIN3 transcription factor can positively regulate the synthesis of vinblastine in Catharanthus roseus.

[0012] Furthermore, CrEIN3 positively regulates the biosynthesis of vinblastine by activating the transcription of key enzyme genes DXS1, SGD, and PRX1 in the vinblastine biosynthesis pathway, increasing the gene expression of DXS1, SGD, and PRX1.

[0013] The present invention also provides a method for overexpressing the Catharanthus roseus EIN3-EILsCrEIN3 gene, comprising the following steps:

[0014] Step 1, cloning Catharanthus roseus CrEIN3 gene;

[0015] Step 2, constructing an overexpression vector containing the CrEIN3 gene obtained in step 1;

[0016] Step 3, the overexpression vector obtained in step 2 is mediated by Agrobacterium to obtain an Agrobacterium engineering strain containing the CrEIN3 gene overexpression vector;

[0017] Step 4: transiently transform Catharanthus roseus petals with the positive strain of the Agrobacterium engineering strain obtained in step 3.

[0018] Furthermore, step 3 also includes transferring into Agrobacterium by freeze-thaw method, and the Agrobacterium is Agrobacterium tumefaciens GV3101.

[0019] Furthermore, step 4 also includes using the leaf disc method to transiently transform Catharanthus roseus petals.

[0020] Further, the steps of transiently transforming Catharanthus roseus petals are:

[0021] The positive strain of the Agrobacterium engineering strain was inoculated in a liquid culture medium for expansion and cultured overnight at 28°C; the bacteria were collected by centrifugation at 4500rpm for 10min; the bacteria were resuspended in a liquid culture medium, and each bacterial solution was diluted to an OD600 of 0.6 with a liquid culture medium; acetosyringone (AS) and MES were added, and after standing at room temperature for 3h, they were injected into the petals of Catharanthus roseus by injection infection with a needleless syringe, first cultured in the dark for 1 day, and then cultured in the light for 3 days.

[0022] Further, the steps of transiently transforming Catharanthus roseus petals are:

[0023] The inoculation ratio was 1:100; the liquid culture medium was MS liquid culture medium for resuspending the bacteria, the final concentration of acetosyringone was 200 μmol / L; the concentration of MES was 10 mmol / L, and the pH value was 5.7.

[0024] Furthermore, the method also includes the determination of the content of TIAs in transiently overexpressed Catharanthus roseus petals.

[0025] Furthermore, the determination of the content of TIAs also includes: extracting Catharanthus roseus petals to obtain an extract, and determining the content of vinblastine and intermediate products in the synthetic pathway by LC-MS.

[0026] Furthermore, vinblastine is amarine, vinblastine, vinblastine, vinblastine, and anhydrovinblastine; and the intermediate products of the synthesis pathway are tryptophan and tryptamine.

[0027] The present invention also provides an application of the Catharanthus roseus EIN3-EILs transcription factor CrEIN3 in increasing the content of vinblastine in Catharanthus roseus.

[0028] In the preferred embodiment 1 of the present invention, the cloning process of Catharanthus roseus CrEIN3 gene is described in detail;

[0029] In another preferred embodiment 2 of the present invention, the construction process of the plant expression vector containing the CrEIN3 gene is described in detail;

[0030] In another preferred embodiment 3 of the present invention, the construction process of the dual-fluorescein reporter vector of the key enzyme genes DXS1, TDC, STR, SGD, and PRX1 promoter of vinblastine biosynthesis is described in detail;

[0031] In another preferred embodiment 4 of the present invention, the activation effect of the tobacco transient transformation detection transcription factor CrEIN3 on the promoters of key enzyme genes DXS1, TDC, STR, SGD, and PRX1 is described in detail;

[0032] In another preferred embodiment 5 of the present invention, the construction process of the CrEIN3 overexpression vector is described in detail;

[0033] In another preferred embodiment 6 of the present invention, the process of promoting vinblastine synthesis in Catharanthus roseus petals by overexpression of CrEIN3 mediated by Agrobacterium tumefaciens is described in detail;

[0034] In another preferred embodiment 7 of the present invention, the process of determining the content of TIAs in transiently overexpressed Catharanthus roseus petals by LC-MS is described in detail.

[0035] The beneficial technical effects of the present invention are as follows:

[0036] The present invention provides a Catharanthus roseus CrEIN3 gene and its use. The gene encodes the Catharanthus roseus EIN3 / EILs transcription factor CrEIN3, which can activate the activities of multiple key enzymes DXS1, SGD, 7-DLGT, 7DLH, ASα, REDOX2, SAT, HL2 and transcription factor CrORCA3 in the vinblastine biosynthesis pathway, positively regulate the expression of corresponding genes, and thus promote the biosynthesis of vinblastine. By transiently overexpressing CrEIN3 in Catharanthus roseus petals, the synthesis of vinblastine in the petals of Catharanthus roseus can be significantly improved, which is of great significance for the efficient production of vinblastine in Catharanthus roseus.

[0037] The present invention cloned and obtained the full-length sequence of the CrEIN3 gene from Catharanthus roseus for the first time by analyzing the EIN3 / EILs transcription factor in the Catharanthus roseus transcriptome database. The important transcription factor CrEIN3 for ethylene signal-induced vinblastine synthesis was found, which can be applied to metabolic engineering to increase the yield of vinblastine, providing a new strategy for metabolic regulation to increase the yield of vinblastine; it provides a basis for using genetic engineering methods to change the expression of corresponding genes in Catharanthus roseus plants and increase the yield of vinblastine; the CrEIN3 transcription factor can be used to increase the yield of vinblastine by overexpression, which is of great significance for genetic engineering breeding of Catharanthus roseus and large-scale production of vinblastine.

[0038] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is a diagram showing the activity detection result of the promoter of the key enzyme gene in the vinblastine synthesis pathway activated by transiently transformed tobacco CrEIN3 according to a preferred embodiment 4 of the present invention;

[0040] Figure 2 is a standard curve of vinblastine and anhydrovinblastine according to a preferred embodiment 7 of the present invention;

[0041] Figure 3 This is a result diagram of the CrEIN3 transcription factor of a preferred embodiment 7 of the present invention regulating the expression of vinblastine and intermediate products of the synthesis pathway in Catharanthus roseus. DETAILED DESCRIPTION

[0042] The following describes several preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0043] The experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer.

[0044] The Agrobacterium involved in the present invention is Agrobacterium tumefaciens, and the strain is GV3101 (pSoup19), which can be purchased from the market.

[0045] Example 1: Cloning of Catharanthus roseus CrEIN3 gene

[0046] 1. Extraction of total RNA from Catharanthus roseus genome

[0047] The extracted total RNA of Catharanthus roseus was used as a template, the dosage was calculated according to the RNA concentration, and cDNA was obtained under the action of PowerScript reverse transcriptase; according to the nucleotide sequence of the CrEIN3 gene (SEQ ID NO: 1), the sequence was obtained from the sequencing results of the Catharanthus roseus genome. Gene-specific primers were designed, and the CrEIN3 gene was amplified from the total cDNA by PCR. After the PCR product was recovered and purified, it was connected to the blunt-end pLB vector (product of Tiangen Biochemical Co., Ltd.) and sequenced to obtain the pLB-CrEIN3 plasmid vector, and the plasmid was extracted and sequenced.

[0048] Through the above steps, the coding sequence of the CrEIN3 transcription factor in Catharanthus roseus was obtained (SEQ ID NO: 1) and its protein coding sequence (SEQ ID NO: 2) was deduced, wherein the start codon was ATG and the stop codon was TAA.

[0049] Example 2: Construction of a plant expression vector containing the CrEIN3 gene

[0050] 1. Construction of overexpression vector pHB-CrEIN3-GFP

[0051] The CrEIN3 gene was amplified from the correctly sequenced flat-end vector pLB and constructed on the plant expression vector pHB-GFP. To facilitate the construction of the expression vector, the forward primer introduced a BamHI restriction site and the reverse primer introduced a SpeI restriction site. The primer sequences are as follows:

[0052] Forward primer pHB-CrEIN3-GFP-FP:

[0053] CTCAAGCTTGGATCCATGATGATGTTTGAGGAAAT, which is SEQ ID NO.3

[0054] Reverse primer pHB-CrEIN3-GFP-RP:

[0055] GCTCACCATACTAGTCGGATACCAGATTGGAATAT, which is SEQ ID NO.4.

[0056] Example 3: Construction of dual-fluorescein reporter vectors for promoters of key enzyme genes DXS1, TDC, STR, SGD, and PRX1 in vinblastine biosynthesis

[0057] 1. PCR amplified the promoters of key enzyme genes DXS1, TDC, STR, SGD, and PRX1 in vinblastine biosynthesis.

[0058] According to the sequence information of key enzyme genes in vinca alkaloid biosynthesis in the NCBI database, specific primers for promoter amplification of DXS1, TDC, STR, SGD, and PRX1 were designed. The amplification was performed using genomic DNA of Catharanthus roseus as a template, and HindIII and PstI restriction sites were added upstream and downstream of the primers, respectively.

[0059] Table 1 Promoter amplification specific primers

[0060]

[0061]

[0062] 2. Connect the promoter fragment to the dual fluorescence reporter vector

[0063] Using the homologous recombination method, the amplified promoter sequences of DXS1, TDC, STR, SGD, and PRX1 were constructed into the pGreenII0800-LUC vector using the ClonExpress II One Step Cloning Kit (Nanogene, Nanjing) to obtain the plant dual fluorescein detection reporter vectors pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, and pGreenII0800-ProPRX1.

[0064] Example 4: Tobacco transient transformation detection of the activation effect of transcription factor CrEIN3 on the promoters of key enzyme genes DXS1, TDC, STR, SGD, and PRX1

[0065] 1. Obtaining Agrobacterium engineered strains

[0066] The pHB-GFP empty vector and the plant expression vector pHB-CrEIN3-GFP containing CrEIN3 in Example 2 were transferred into the pSoup19 auxiliary plasmid Agrobacterium tumefaciens GV3101 by freeze-thaw method, and the plant dual fluorescein detection reporter vectors pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, and pGreenII0800-ProPRX1 in Example 3 were transferred into the Agrobacterium tumefaciens GV3101 with the pSoup19 auxiliary plasmid by freeze-thaw method to obtain Agrobacterium engineering strains containing the empty vector, CrEIN3 gene and promoter, respectively.

[0067] 2. Transient Transformation of Tobacco

[0068] The positive strains of the above-mentioned Agrobacterium engineering strains were inoculated into 10 ml liquid culture medium at a ratio of 1:100 for expansion culture, and cultured at 28°C overnight; the bacteria were collected by centrifugation at 4500 rpm for 10 min; the bacteria were resuspended in MS liquid culture medium, and the concentration of each bacterial solution was diluted to OD600 of 0.6 with MS liquid culture medium; acetosyringone (AS) with a final concentration of 200 μmol / L and 10 mmol / L MES (pH 5.7) were added, and the culture was allowed to stand at room temperature for 3 h for use.

[0069] The Agrobacterium engineering strain containing pHB-CrEIN3-GFP and an empty vector was mixed with the Agrobacterium engineering strain containing pGreenII0800-ProDXS1, pGreenII0800-ProTDC, pGreenII0800-ProSTR, pGreenII0800-ProSGD, and pGreenII0800-ProPRX1 plant dual fluorescein detection reporter vectors in a 1:1 ratio, and then injected into tobacco leaves grown for 4-5 weeks using a 1mL needle-free syringe for infection. The leaves were cultured in the dark for 1 day and then in the light for 1 day.

[0070] 3.Dual-Luciferase Assay

[0071] Take tobacco leaves that have been cultured for 2 days, freeze them quickly with liquid nitrogen, and grind them into powder. Use Promega's Dual-Luciferase Reporter Assay System kit and GloMax 20 / 20 Luminometer fluorescence detector to detect fluorescence intensity, and operate according to the instructions of the kit. The results of the activity detection of the key enzyme gene promoter of the vinblastine biosynthesis pathway activated by transient transformation of tobacco CrEIN3 are shown in the figure. Figure 1 As shown, Dual-LUC analysis of candidate transcription factors on TIAs synthase genes, where A is not divided into DXS1, B is TDC, C is STR, D is SGD, and E is the activation result of PRX1 promoter; pHB-GFP empty vector was used as a control, and it can be seen that transcription factor CrEIN3 significantly activated the activity of DXS1, SGD, and PRX1 promoters.

[0072] Example 5. Construction of CrEIN3 overexpression vector

[0073] The CrEIN3 gene was amplified from the correctly sequenced flat-end vector pLB and constructed on the plant expression vector p2300. To facilitate the construction of the expression vector, the forward primer introduced the BcuI restriction site and the reverse primer introduced the Eco91I restriction site. The primer sequences are as follows:

[0074] Forward Primer:

[0075] p2300-CrEIN3-FP:GTAGATCTGACTAGTATGATGATGTTTGAGGAAAT

[0076] Reverse Primer:

[0077] p2300-CrEIN3-RP:TTCGAGCTGGTCACCTTACGGATACCAGATTGGAA.

[0078] Example 6: Agrobacterium tumefaciens-mediated overexpression of CrEIN3 promotes vinblastine synthesis in Catharanthus roseus petals

[0079] 1. Obtaining Agrobacterium engineered strains

[0080] The overexpression vector p2300-CrEIN3 was transferred into the pSoup19 helper plasmid Agrobacterium tumefaciens GV3101 by freeze-thaw method to obtain the Agrobacterium engineering strain containing the target vector.

[0081] 2. Transient Transformation of Catharanthus roseus Petals

[0082] The positive strains of the above-mentioned Agrobacterium engineering strains were inoculated into 10 ml liquid culture medium at a ratio of 1:100 for expansion culture, and cultured at 28°C overnight; the bacteria were collected by centrifugation at 4500 rpm for 10 min; the bacteria were resuspended in MS liquid culture medium, and the concentration of each bacterial solution was diluted to OD600 of 0.6 with MS liquid culture medium; acetosyringone (AS) with a final concentration of 200 μmol / L and 10 mmol / L MES (pH 5.7) were added, and the culture was allowed to stand at room temperature for 3 h for use.

[0083] The engineered Agrobacterium strain and P19 Agrobacterium were mixed at a ratio of 1:1 and injected into the petals of Catharanthus roseus by injection infection with a 1 mL needle-free syringe. The mixture was first cultured in the dark for 1 day and then cultured in the light for 3 days.

[0084] 3. Extraction of Vinca roseus petals

[0085] Cut the petals of the cultured Catharanthus roseus, freeze them in liquid nitrogen and grind them into powder. Put the powder sample in an EP tube, add 800 μL of methanol solution, place it in an oscillator for 2 minutes, mix it thoroughly until the sample can no longer be dissolved, sonicate the powder sample for 45 minutes (the sonicator is set at 55W), centrifuge the sonicated sample at 12000 rpm for 10 minutes at 4°C, aspirate the supernatant, filter it with a 0.22 μm filter, place it in a new centrifuge tube, and seal it with a sealing film.

[0086] Example 7: LC-MS determination of TIAs content in transiently overexpressed Catharanthus roseus petals

[0087] 1. LC-MS conditions and preparation of standard solutions

[0088] The LC-MS experiment used an ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometer Waters BEH C18 (2.1mm*100mm, 1.7μm) column, mobile phase A: formic acid / water 1 / 1000 (v), B: formic acid / acetonitrile 1 / 1000 (v), detection wavelength 254nm, flow rate 0.35mL / min, injection volume 2μL. Ionization mode was ESI+.

[0089] Table 2 Standard sample concentration gradient configuration

[0090]

[0091] 2. Preparation of standard curve

[0092] Record the spectrum and chromatographic parameters, and perform regression analysis on the standard content (X, μg) using the peak area (Y). The standard curve of vinblastine and anhydrovinblastine is as follows: Figure 2 shown.

[0093] 3. Determination of the content of vinblastine and intermediates in the synthetic pathway

[0094] LC-MS was used to determine the accumulation of TIAs (amarine, vindoline, vinblastine, vinblastine, anhydrovinblastine) and their intermediates (tryptophan, tryptamine), and the artemisinin content (mg) in the sample was calculated by substituting the peak area into the linear regression equation, and then divided by the dry weight of the vinca rosea petals of the sample (g), thereby calculating the content of amarine, vindoline, vindoline, vinblastine, anhydrovinblastine, tryptophan, and tryptamine in the vinca rosea petals. In this example, LC-MS was used to determine the content of amarine, vindoline, vinblastine, vinblastine, anhydrovinblastine, tryptophan, and tryptamine in the vinca rosea petals, and a metabolic engineering strategy of transforming the CrEIN3 overexpression vector was used to find that the overexpression of the CrEIN3 gene can significantly increase the content of anhydrovinblastine and vinblastine in the vinca rosea petals, providing strong experimental evidence for using the gene for transcriptional regulation research and thus increasing the content of vinblastine in vinca rosea.

[0095] The Catharanthus roseus EIN3 / EILs transcription factor CrEIN3 disclosed by the present invention can increase the content of vinblastine in Catharanthus roseus. The coding sequence of the transcription factor is connected to a plant expression regulatory vector to construct a plant expression vector containing the coding sequence; the expression vector is transferred into Agrobacterium, and the Agrobacterium is transferred into Catharanthus roseus petals; the content of vinblastine in the Catharanthus roseus petals obtained by the present invention is significantly regulated, and the expression amount of vinblastine and the intermediate product of the synthetic pathway of the CrEIN3 transcription factor in Catharanthus roseus is regulated as follows: Figure 3As shown, ** indicates significant difference from the control, *** indicates extremely significant difference from the control; compared with the control group, for the CrEIN3-overexpressing Catharanthus roseus petal sample, dehydrated vinblastine significantly increased by 37.60%, and vinblastine significantly increased by 46.18%. Catharanthus roseus petals overexpressing CrEIN3 significantly increased the content of dehydrated vinblastine and vinblastine. The present invention provides a transcription factor coding sequence for regulating the content of vinblastine in Catharanthus roseus, laying a solid foundation for the efficient production of vinblastine using the coding sequence.

[0096] The preferred specific embodiments of the present invention are described in detail above. It should be understood that ordinary technicians in the field can make many modifications and changes based on the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by technicians in the technical field based on the concept of the present invention through logical analysis, reasoning or limited experiments on the basis of the prior art should be within the scope of protection determined by the claims.

Claims

1. A Catharanthus roseus EIN3-EILs transcription factor CrEIN3, characterized in that The nucleotide sequence of the transcription factor CrEIN3 is shown in SEQ ID NO: 1, and the protein coding sequence is shown in SEQ ID NO:

2.

2. A method for overexpressing the CrEIN3 gene according to claim 1, characterized in that: The method comprises the following steps: Step 1, cloning Catharanthus roseus CrEIN3 gene; Step 2, constructing an overexpression vector containing the CrEIN3 gene obtained in step 1; Step 3, the overexpression vector obtained in step 2 is mediated by Agrobacterium to obtain an Agrobacterium engineering strain containing the CrEIN3 gene overexpression vector; Step 4: transiently transform Catharanthus roseus petals with the positive strain of the Agrobacterium engineering strain obtained in step 3.

3. The method according to claim 2, characterized in that The step 3 also includes transferring the Agrobacterium by freeze-thaw method, wherein the Agrobacterium is Agrobacterium tumefaciens.

4. The method according to claim 2, characterized in that The step 4 also includes using the leaf disc method to transiently transform the Catharanthus roseus petals.

5. The method according to claim 4, characterized in that The steps of transiently transforming Catharanthus roseus petals are: The positive strain of the Agrobacterium engineering strain was inoculated into a liquid culture medium for expansion and culture at 28°C overnight; the bacteria were collected by centrifugation at 4500 rpm for 10 min; the bacteria were resuspended in a liquid culture medium, and the concentration of each bacterial solution was diluted to OD 600 is 0.6; acetosyringone and MES were added, and after standing at room temperature for 3 hours, they were injected into the petals of Catharanthus roseus by injection with a needleless syringe, and cultured in the dark for 1 day and then in the light for 3 days.

6. The method according to claim 5, characterized in that The steps of transiently transforming Catharanthus roseus petals are: The inoculation ratio is 1:100; the liquid culture medium is MS liquid culture medium for resuspending the bacteria, the final concentration of acetosyringone is 200 μmol / L; the concentration of MES is 10 mmol / L, and the pH value is 5.

7.

7. The method according to claim 2, characterized in that The method also includes determining the content of TIAs in transiently overexpressed Catharanthus roseus petals.

8. The method according to claim 7, characterized in that The determination of the content of TIAs also includes: extracting Catharanthus roseus petals to obtain an extract, and determining the content of vinblastine and intermediate products in the synthetic pathway by LC-MS in the extract.

9. The method according to claim 8, characterized in that The vinblastines are amarine, vindoline, vinblastine, vinblastine, and anhydrovinblastine; and the intermediate products of the synthetic pathway are tryptophan and tryptamine.

10. Use of the Catharanthus roseus EIN3-EILs transcription factor CrEIN3 as claimed in claim 1 in increasing the content of vinblastine in Catharanthus roseus.

Images