Application of tomato gene or protein coded by tomato gene in regulation and control of low nitrogen stress tolerance of plants

Abstract

The invention discloses an application of a tomato gene or a protein coded by the tomato gene in regulating and controlling the tolerance of plants to low nitrogen stress, and relates to the technical field of biology. The RBOH1 gene in the tomato is knocked out, compared with a wild plant, the nitrogen absorption capacity is reduced, the expression of nitrate transporter genes NRT1.1 and NRT2.1 is limited, under low nitrogen stress, the expression of the RBOH1 gene is increased by 3.2 times after treatment for one day, and is continuously and remarkably increased within 1-3 days, which indicates that the RBOH1 positively regulates the nitrogen absorption of the tomato.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of a tomato gene or a protein encoded by the tomato gene in regulating plant tolerance to low nitrogen stress. Background Art

[0002] Reactive oxygen species (ROS) are key mediators in plant responses to stress. ROS can be produced in a variety of organelles, such as chloroplasts, mitochondria, peroxisomes, and oxidoreductase systems on the plasma membrane. In plants, NADPH oxidase / respiratory burst oxidase homolog (RBOH) proteins produce localized ROS bursts, which are essential for regulating plant growth, development, and stress responses. In Arabidopsis, the RBOH family includes 10 members (RBOHA to RBOHJ), each of which has a specific function in plant development and stress response. Among them, RBOHD and RBOHF are highly expressed in root tissues and play a key role in regulating root growth and environmental stimulus responses. RBOHF plays an important role in coping with abiotic stresses, such as the abscisic acid signaling pathway and salt stress tolerance. In tomato, the RBOH family includes 8 members (RBOH1, RBOHA-F, and RBOHH), of which RBOH1 (Solyc08g081690) is most similar to RBOHF of Arabidopsis. Tomato RBOH1 is highly expressed in roots and is activated by hydrogen peroxide (H 2 O 2 ) signaling pathway is involved in the plant's response to heat stress and oxidative stress.

[0003] Tomato (Solanum lycopersicum L.) belongs to the genus Solanum in the family Solanaceae and is an annual or perennial herb. As one of the most widely planted and consumed vegetable crops in the world, tomato has important economic value due to its short growth cycle and increasingly mature facility cultivation technology. In addition, as a typical respiratory climacteric fruit, tomato has gradually become an important model plant in plant molecular biology research.

[0004] Under stress conditions, the accumulation of ROS affects the redox state of a variety of proteins, including enzymes, receptors, and small molecules. The accumulation of ROS can activate, modify, or integrate multiple stress response signal transduction pathways, thereby altering gene expression and enhancing plant tolerance to stress. 2 O 2 It is the most stable ROS because of its relatively long half-life in living cells. 2 O 2Direct oxidation of proteins through oxidative post-translational modifications (Oxi-PTMs), mainly targeting methionine and cysteine ​​residues in proteins. These modifications can change the conformation, subcellular localization, and activity of proteins, including the activity of transcription factors, thereby triggering specific H 2 O 2 Signaling pathways. For example, H 2 O 2 It promoted the oxidation of C-REPEAT BINDING TRANSCRIPTIONFACTOR (CBF) oligomers and monomers and inhibited the expression of cold-responsive genes under low temperature stress. 2 O 2 The induced Oxi-PTMs enhance the transcriptional activity of BZR1, regulate plant growth, and promote its interaction with key regulators in the auxin signaling pathway and light signaling pathway, such as auxin response factor 6 (ARF6) and phytochrome interacting factor 4 (PIF4). 2 O 2 Whether the induced Oxi-PTMs affect the functions of proteins related to nitrogen absorption and metabolism under low nitrogen stress. Summary of the invention

[0005] The applicant found that H 2 O 2 The closely related RBOH1 gene and H 2 O 2 The rboh1 mutant has reduced tolerance to low nitrogen stress in tomato, revealing a H 2 O 2 The new mechanism involved in nitrogen absorption in tomatoes provides an important basis for accelerating the research on nitrogen absorption mechanism in tomatoes and the discovery of genes, which has very important scientific and practical significance. 2 O 2 It plays an important role in nitrogen absorption by plants.

[0006] The present study discovered a gene, RBOH1, that is closely related to the production of reactive oxygen species in tomato roots.

[0007] (Solyc08g081690), and the transcription factor TGA4 (Solyc04g054320) was determined to be regulated by H 2 O 2 Sensitive, H 2 O 2 Oxidatively modified TGA4 promotes the expression of NRT1.1 and NRT2.1 under low nitrogen conditions. 2 O2 Application in promoting nitrogen absorption in tomatoes.

[0008] The specific technical solutions are as follows:

[0009] The present invention provides application of a tomato gene or a protein encoded by the tomato gene in regulating the tolerance of a plant to low nitrogen stress. The tomato gene is a RBOH1 gene or a TGA4 gene.

[0010] Specifically, the rboh1 mutant tomato has a reduced nitrogen absorption capacity. The lower the expression of the RBOH1 gene in the plant, the weaker the tomato's nitrogen absorption capacity.

[0011] Specifically, the amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.4.

[0012] The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0013] The present invention also provides a method for regulating the tolerance of a plant to low nitrogen stress. When it is necessary to reduce the tolerance of the plant to low nitrogen stress, the RBOH1 gene or the TGA4 gene in the plant is silenced or knocked out; when it is necessary to increase the tolerance of the plant to low nitrogen stress, the RBOH1 gene or the TGA4 gene in the plant is overexpressed; the nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0014] Preferably, the plant is Arabidopsis thaliana, tomato or tobacco.

[0015] The present invention provides an application of a tomato gene or a protein encoded by the tomato gene in creating germplasm with high tolerance to low nitrogen stress. The tomato gene is an RBOH1 gene or a TGA4 gene. Germplasm with high tolerance to low nitrogen stress is obtained by screening germplasm with high expression of tomato genes or high expression of proteins encoded by tomato genes.

[0016] Specifically, the amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.4;

[0017] The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.2.

[0018] The present invention also provides a method for constructing germplasm with high tolerance to low nitrogen stress, comprising the following steps: overexpressing the RBOH1 gene in the germplasm, wherein the nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1.

[0019] The method for constructing germplasm with high tolerance to low nitrogen stress specifically comprises the following steps:

[0020] (1) constructing a vector for overexpressing the RBOH1 gene;

[0021] (2) The vector for overexpressing the RBOH1 gene constructed in step (1) is introduced into tomato explants to overexpress the RBOH1 gene having a nucleotide sequence as shown in SEQ ID NO.1, and the germplasm with high tolerance to low nitrogen stress is obtained after culturing. Specifically, in step (2), the vector for overexpressing the RBOH1 gene is transferred into Agrobacterium EHA105 and then infects the tomato explants.

[0022] Beneficial effects of the present invention:

[0023] By knocking out the RBOH1 gene in tomatoes, the present invention reduces the nitrogen absorption capacity compared with wild-type plants, and the expression of nitrate transporter genes NRT1.1 and NRT2.1 is restricted. Under low nitrogen stress, the expression of the RBOH1 gene is upregulated by 3.2 times after 1 day of treatment, and maintains a continuous and significant increase within 1 to 3 days, indicating that RBOH1 positively regulates the absorption of nitrogen by tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the construction of the CRISPR / Cas9 vector. It includes a structural diagram of the location of the vector sgRNAs, annotated with the sequences of the two sgRNAs on the tomato RBOH1 genome and the sequencing results of the tomato RBOH1 CRISPR / Cas9 knockout plants. The sgRNA specific recognition sequence is the red text part.

[0025] Figure 2 The expression of RBOHs genes in tomato roots. Figure 2 A shows the expression of eight RBOHs genes in tomato roots; Figure 2 B shows the expression changes of RBOH1 gene in tomato roots at 0d, 1d, 3d, 5d, 7d and 12d after treatment with full nutrient solution and low nitrogen nutrient solution (LN indicates low nitrogen stress). Figure 2 The data shown in are the mean of four replicates, and the standard error is shown by the vertical bar. Tukey test was used, and different lowercase letters indicate significant differences between different treatments at the 5% level.

[0026] Figure 3H of tomato roots after treatment with full nutrient solution and low nitrogen nutrient solution 2 O 2 Content and NADPH oxidase activity. Figure 3 A is the DAB staining phenotype of the roots of each plant after treatment with full nutrient solution and low nitrogen nutrient solution, scale bar = 300 μm; Figure 3 B is the DCF staining phenotype of the roots of each plant after treatment with full nutrient solution and low nitrogen nutrient solution, scale bar = 300 μm; Figure 3 C is the CeCl content of the root cells of each plant after treatment with full nutrient solution and low nitrogen nutrient solution. 3 Staining phenotype, scale bar = 0.5 μm; Figure 3 D is the root H of each plant after treatment with full nutrient solution and low nitrogen nutrient solution 2 O 2 Quantitative statistical graph of content; Figure 3 E is the quantitative statistical graph of NADPH oxidase activity in the roots of each strain after treatment with full nutrient solution and low nitrogen nutrient solution. Figure 3 The data shown in D and 3E are the mean of four replicates, and the standard error is shown by the vertical bar. Tukey test was used, and different lowercase letters indicate that the differences between different treatments reached a significant level of 5%. Among them, WT is the wild-type tomato Ailsa Craig without genetic modification; rboh1-1 and rboh1-2 are RBOH1 mutant plants.

[0027] Figure 4 The phenotypes of each strain after treatment with full nutrient solution and low nitrogen nutrient solution. Figure 4 A is the phenotype of each plant after treatment with full nutrient solution and low nitrogen nutrient solution, scale bar = 10 cm; Figure 4 B is the statistical graph of chlorophyll content and biomass of each strain after treatment with full nutrient solution and low nitrogen nutrient solution; Figure 4 C is a statistical chart of the nitrogen and carbon content in the roots of each plant system after treatment with full nutrient solution and low nitrogen nutrient solution. Figure 4 The data shown in B and 4C are the average of four replicates, and the standard error is shown by the vertical bar. Tukey test was used, and different lowercase letters indicate that the differences between different treatments reached a significant level of 5%. Among them, WT is the wild-type tomato Ailsa Craig without genetic modification; rboh1-1 and rboh1-2 are rboh1 mutant plants.

[0028] Figure 5 This is a diagram of the binding of transcription factor TGA4 to the promoters of NRT1.1 and NRT2.1 genes. Figure 5 A is a schematic diagram of the binding of transcription factor TGA4 to the promoters of NRT1.1 and NRT2.1 genes; Figure 5 B is the EMSA result diagram; Figure 5 C is the result diagram of LUC-REN experiment; Figure 5D is the CUT-RUN experimental results. Figure 5 The data shown in C and 5D are the means of four replicates, and the standard errors are shown by vertical bars. Tukey's test was used, and different lowercase letters indicate significant differences between different treatments at the 5% level.

[0029] Figure 6 This is a diagram of the oxidatively modified transcription factor TGA4 binding to the NRT1.1 and NRT2.1 gene promoters. Figure 6 A is the result of BIAM labeling experiment; Figure 6 B is a graph showing the results of an in vitro oxidation experiment; Figure 6 C is a graph showing the results of an in vivo oxidation experiment; Figure 6 D is the result diagram of LUC-REN experiment; Figure 6 E is the CUT-RUN experimental result diagram; Figure 6 F is the result of real-time fluorescence quantitative PCR experiment. Figure 6 The data shown in D, 6E and 6F are the means of four replicates, and the standard errors are shown by vertical bars. Tukey's test was used, and different lowercase letters indicate significant differences between different treatments at the 5% level. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with the accompanying drawings and specific examples. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0031] Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercial sources. The experimental material used was the tomato cultivar Ailsa Craig (Solanum lycopersicum L.cv.).

[0032] Example 1

[0033] Total RNA extraction and gene expression analysis.

[0034] 1. Extraction of Total RNA from Tomato

[0035] Total RNA from tomato roots was extracted using the Tiangen Plant total RNA extraction kit:

[0036] (1) Grind 0.1 g of root sample in liquid nitrogen, add 1 mL of lysis buffer RZ, and vortex to mix;

[0037] (2) Centrifuge at 12,000 rpm for 5 min at 4°C and remove the supernatant;

[0038] (3) Add 200 μL of chloroform, shake vigorously for 15 seconds, and leave at room temperature for 3 minutes;

[0039] (4) Centrifuge at 4°C, 12,000 rpm for 10 min. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. Transfer the aqueous phase to a new tube and proceed to the next step.

[0040] (5) Add 0.5 times the volume of anhydrous ethanol, mix well, transfer to adsorption column CR3, centrifuge at 12000 rpm at 4°C for 30 s, and discard the waste liquid in the collection tube;

[0041] (6) Add 500 μL of deproteinized solution RD to the adsorption column CR3, centrifuge at 12,000 rpm for 30 s at 4°C, and discard the waste liquid;

[0042] (7) Add 600 μL of rinse solution RW to the adsorption column CR3, let stand at room temperature for 2 min, centrifuge at 4°C, 12000 rpm for 30 s, and discard the waste liquid;

[0043] (8) Repeat step (7);

[0044] (9) Place the adsorption column in a 2 mL collection tube and centrifuge at 12,000 rpm for 2 min at 4 °C to remove the residual waste liquid;

[0045] (10) After the adsorption column was dried in a clean bench for 5 min, it was transferred to a new RNase-free centrifuge tube and 50 μL RNase-Free ddHO was added. 2 O, placed at room temperature for 2 min, centrifuged at 12000 rpm for 2 min at 4 °C;

[0046] (11) Determine OD using a UV spectrophotometer 260 / OD 280 Check the RNA sample content and purity.

[0047] 2. Real-time quantitative PCR (qRT-PCR)

[0048] The 480II Real-Time PCR detection system (Roche, Swiss) and SYBRGreen PCR Master Mix (Takara, RR420A) were used. The PCR reaction conditions were: 95°C for 3 min; 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 30 s, and 40 cycles. Fluorescence data were collected at the end of the extension of each cycle. Tomato Actin and Ubiquitin3 genes were used as internal references, and gene-specific primers were designed based on the cDNA sequence. The sequences of each primer are shown in Table 1. The relative expression of genes was calculated using the method of Livak and Schmittgen (2001).

[0049] Table 1 Real-time fluorescence quantitative PCR primers

[0050]

[0051]

[0052] To elucidate the role of RBOHs / NADPH oxidase-dependent ROS in tomato response to low nitrogen stress, we first examined the expression levels of all eight RBOH genes in tomato roots ( Figure 2 A). Under normal conditions, the transcript level of RBOH1 was significantly higher than that of the other seven RBOH genes, especially in tomato roots. The expression of RBOH1 in roots and flowers was significantly higher than that in other tissues, indicating its key role in ROS generation in roots. Under low nitrogen stress, the expression of RBOH1 gene was upregulated 3.2-fold after 1 day of treatment and maintained a continuous and significant increase from 1 to 3 days ( Figure 2 B).

[0053] Example 2

[0054] Construction of tomato RBOH1 gene mutant plants.

[0055] First, total RNA was extracted from young roots of wild-type tomatoes; the obtained tomato total RNA was reverse transcribed into cDNA; the sgRNA sequence was designed using the CRISPR-P website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) as follows (RBOH1-sgRNA: ACGTCGGATACGGTGTCTTC). The synthesized sequence was annealed and inserted into the BbsI site of the AtU6-sgRNA-AtOBQ-Cas9 vector, and the AtU6-sgRNA-AtoBQ-Cas9box was inserted into the HindIII and KpnI sites of the pCAMBIA1301 binary vector. All the plasmids obtained above were transformed into the Agrobacterium tumefaciens EHA105 strain, and the target vector was transformed into the tomato cotyledons through Agrobacterium-mediated infection of tomato cotyledons, and candidate plants were preliminarily screened using hygromycin. Transformed plants were selected based on hygromycin resistance, and knockouts were identified by sequencing the PCR amplicon of the target locus. Specific primers were designed near the sequence position of the sgRNA of the tomato RBOH1 gene to detect changes in the target gene sequence. The primers are as follows, and the detection fragment length is 363bp. The homozygous mutants in the RBOH1 knockout transgenic plants can be screened for experiments based on the size of the PCR product band and the sequencing results. The PCR product was sent for testing. Figure 1Sequencing results of tomato RBOH1 CRISPR / Cas9 knockout plants. CRISPR-RBOH1-F: 5'-GGTCAGGCTTCTACAGAAAACT-3',

[0056] CRISPR-RBOH1-R: 5′-GATCGAGTTTCCGACGTCGA-3′.

[0057] The specific steps are as follows:

[0058] 1) Culture medium configuration

[0059] Seeding medium: 2.15g / L MS powder + 100mg / L inositol + 10g / L sucrose + 8g / L agar. PH value is 5.8.

[0060] Nursing medium: alcohol + 1.3g / L thiamine hydrochloride + 0.2mg / L 2,4-D + 200mg / L KH 2 PO 4 +0.1mg / L KT+7.5g / L agar. pH value is 5.8.

[0061] 2Z selection regeneration medium: 4.44g / L MS powder + 30g / L sucrose + 100mg / L inositol + 2mg / L ZR + 300mg / L timentin + 6mg / L hygromycin. pH value is 5.8.

[0062] 0.2Z selection regeneration medium: 4.44g / L MS powder + 30g / L sucrose + 100mg / L inositol + 0.2mg / L ZR + 300mg / L timentin + 6mg / L hygromycin. pH value is 5.8.

[0063] Rooting medium: 4.44g / L MS powder + 30g / L sucrose + 100mg / L inositol + 300mg / L timentin + 6mg / L hygromycin. pH value is 5.8.

[0064] Liquid MS0.2 medium: 4.44g / L MS powder + 20g / L sucrose + 100mg / L inositol + 0.2mg / L thiamine hydrochloride. pH value is 5.8. Used for suspension infection of Agrobacterium.

[0065] YEB medium: 5 g beef extract, 5 g peptone, 1 g yeast extract, 5 g sucrose, 0.5 g MgSO 4 7H 2 O, dilute to 1 L with distilled water, adjust pH to 7.0, sterilize at 121℃ for 20 min, and set aside. Add 15 g agar powder per liter of YEB solid medium, and the other components are the same as those of liquid medium.

[0066] 2) Cultivation of sterile seedlings

[0067] Tomato seeds were soaked in tap water (or shaken at 28℃ 200rpm) for 6-8h, then sterilized with 75% alcohol for 30s, then sterilized in 10% NaClO for 15min (shaker at 28℃ 200rpm), rinsed 3 times with sterilized distilled water and transferred to a sterilized container, inoculated in 1 / 2MS culture medium. After culturing at 25℃ in the dark until white, they were transferred to a light culture room. The seedling growth conditions were 25℃, 16h light / 8h dark, and light intensity of 18001x.

[0068] 3) Prepare explants and culture Agrobacterium

[0069] About a week after the seeds germinate, when the cotyledons have spread out but the true leaves have not yet grown, cut the cotyledons of the sterile seedlings into two sections with a new scalpel. The cotyledons have a small petiole and are spread flat on the nursing medium for pre-culture for 24 hours (protected from light, overnight is fine, and nursing culture for too long can easily lead to excessive infection). Pick a single colony of Agrobacterium on the LB plate containing antibiotics, inoculate it in 30mL LB containing antibiotics (150mL conical flask), and culture it overnight at 28℃ and 200rpm until the mid-logarithmic phase (OD600≈1.0, about 16 to 24 hours). Shake the bacteria first, then cut the cotyledons (inoculate between 12 and 20 hours).

[0070] 4) Transformation and regeneration

[0071] Take out the A bacterial solution of Agrobacterium tumefaciens containing the target vector plasmid from the -80℃ refrigerator, activate it on a YEB plate containing antibiotics, pick a single colony of Agrobacterium, inoculate it into 2mL YEB containing antibiotics, shake and culture it at 28℃, 200rpm overnight, then expand and shake 30mL at a ratio of 1:100, and culture it at 28℃, 200rpm overnight until the OD 600 =0.8~1.0. Centrifuge the cultured Agrobacterium at 4℃4000rpm for 10min; discard the supernatant, and add 15mL suspension medium MS 0.2 to suspend the bacteria for later use. Transfer the pre-cultured cotyledon explants to a sterile culture dish with 15mL of MS 0.2, pour in the suspended bacterial solution, infect in the dark for 2~3min, and gently shake the culture dish. Use tweezers to gently pick up the explants, transfer the explants to sterile filter paper, absorb the remaining bacterial solution, transfer to sterile filter paper to absorb the remaining bacterial solution, and spread the reverse side up back to the original care medium, and culture in the dark at 22℃ for 48h.

[0072] After co-cultivation, the explants were transferred to 2Z medium with the front side facing upwards and cultured at 25°C with a 16h light / 8h dark photoperiod. Fresh 2Z medium was replaced every two weeks. After differentiation and budding, the brown explants were removed and the differentiated buds were transferred to 0.2Z medium for selective culture. Fresh medium was replaced every three weeks.

[0073] 5) Rooting culture and transplanting

[0074] When the regenerated buds grow to about 1 cm, cut off the buds (optional, to avoid damaging the rooting site) and place them in a rooting medium for rooting. After 2 weeks, the transformed seedlings with good rooting and growth to about 5 cm were hardened and transplanted into a nutrient pot with a peat: vermiculite=3:1 matrix to obtain tomato RBOH1 gene mutant plants, which were named mutant plants rboh1-1 and mutant plants rboh1-2 (the sequencing results of rboh1-1 and rboh1-2 corresponded to Figure 1 M1: +1bp and M3: +2bp).

[0075] Example 3

[0076] The various indicators of the obtained tomato wild-type WT and rboh1 mutant plants were measured after low-nitrogen treatment. The experimental materials were: wild-type WT, mutant plants rboh1-1, rboh1-2, and transgenic plants used stable inherited F2 generation seeds for subsequent experimental observations.

[0077] The specific method of low nitrogen treatment for wild-type WT and rboh1 mutant plants is as follows:

[0078] The wild type WT and mutant plants rboh1-1 and rboh1-2 were divided into two groups, one as the control group and the other as the experimental group.

[0079] When the tomato had five leaves and one heart, the experimental group was treated with low nitrogen and the nutrient solution was replaced every 3 days. The growth conditions were: day and night temperature 23℃ / 20℃, 14h photoperiod and 600μmol m -2 s -1 Light intensity.

[0080] The total duration of low nitrogen treatment was 3 weeks. Sampling and determination of relevant indicators were required during and at the end of the experiment.

[0081] The chlorophyll content was determined as follows:

[0082] Normal functioning leaves were taken as samples for chlorophyll extraction. Weigh 0.1 g of leaf sample and extract with 10 ml of 80% acetone in the dark until the leaves are completely decolorized. The sample was then centrifuged at 4000 g and the supernatant was taken for quantitative determination of chlorophyll. The absorbance of the supernatant was measured at 663 nm and 645 nm using a spectrophotometer to determine the chlorophyll content.

[0083] The method for determining the carbon and nitrogen content is as follows:

[0084] The whole aerial parts and the whole root system were sampled for carbon and nitrogen content determination. These samples were dried, finely ground, and passed through a 100 mesh sieve to ensure consistency. Nitrogen and carbon content in plant tissues were analyzed using a Flash IRMS elemental analyzer (Thermo Fisher Scientific, USA).

[0085] The 3,3'-diaminobenzidine (DAB) staining method is as follows:

[0086] The root tips were immersed in 50 mM Tris-HCl buffer (pH 3.8) for 15 min and then stained with 0.1% DAB solution for 10 min under light conditions. After staining, the root tips were rinsed three times with Tris-HCl buffer and destained with acid glycerol at 60 °C for 12 h. The treated root tips were observed using a Zeiss Stemi 305 stereo microscope equipped with a Zeiss Axiocam ERc 5s camera, maintaining consistent imaging parameters.

[0087] H 2 The DCF-DA (DCF) staining method is as follows:

[0088] The root tips were immersed in 50 mM PBS buffer (pH 7.4) for 30 min and then incubated with HO in the dark. 2 DCF-DA (Sigma-Aldrich) staining was performed for 10 min. After washing three times with PBS buffer, fluorescence images were captured using a Leica DM4000B microscope and a Leica DFC425C camera.

[0089] CeCl 3 The staining method is as follows:

[0090] The root tips were immersed in 50 mM 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (pH 7.2) and incubated with 5 mM CCCl in the dark. 3The solution was vacuum infiltrated. The root tips were then fixed in 1.25% (v / v) glutaraldehyde and 1.25% (v / v) paraformaldehyde in 50 mM sodium arsenite buffer (pH 7.2) for 1 hour and observed under a transmission electron microscope.

[0091] H 2 O 2 The content determination method is as follows:

[0092] The whole root system was used as the test 2 O 2 For samples with high content, 0.1 g of tomato root sample was taken for determination. 2 O 2 The content was quantified using a hydrogen peroxide assay kit (Solarbio, BC3595) according to the detailed instructions provided by the kit.

[0093] The NADPH oxidase activity was determined as follows:

[0094] Plasma membranes were isolated from root samples using a modified two-phase water-polymer partitioning system. First, roots were homogenized in extraction buffer (50 mM Tris-HCl, pH 7.5, 0.25 M sucrose, 1 mM ascorbic acid, 1 mM EDTA, 0.6% PVP, 1 mM PMSF) and filtered through gauze. After centrifugation at 10,000 g for 15 min, microparticle membranes were isolated by centrifugation at 50,000 g for 30 min. The pellet was resuspended in a solution (0.33 M sucrose, 3 mM KCl, 5 mM potassium phosphate, pH 7.8) and plasma membranes were isolated by three rounds of partitioning using a two-phase polymer system (6.2% Dextran T500, 6.2% polyethylene glycol 3350, 0.33 M sucrose, 3 mM KCl, 5 mM potassium phosphate, pH 7.8). The upper phase was diluted with Tris-HCl buffer (10 mM, pH 7.4) containing 0.25 M sucrose, 1 mM EDTA, 1 mM DTT, 1 mM ascorbic acid, and 1 mM PMSF and centrifuged at 120,000 g for 30 min. The final pellet was resuspended in Tris-HCl buffer for further analysis. BSA was used as a standard to determine the protein content in the plasma membrane. NADPH-dependent superoxide anion (O 2- ) generation activity was determined by measuring the oxidative stress of XTT 2-The amount of reduction was evaluated. The reaction mixture (1 mL) included 50 mM Tris-HCl buffer (pH 7.5), 0.5 mM XTT, 100 μM NADPH, and 15-20 μg of membrane protein. The reaction was started by adding NADPH and the reduction of XTT was monitored at 470 nm. Background activity was corrected by adding 50 units of superoxide dismutase (SOD) to the reaction. The superoxide generation rate was calculated by using an extinction coefficient of 2.16×10 4 M -1 cm -1 calculate.

[0095] The rboh1 mutants (rboh1-1 and rboh1-2) were used to investigate its function in ROS generation and low nitrogen stress tolerance. Histochemical analysis by DAB and DCF staining showed that ROS induced by low nitrogen stress was significantly reduced in the rboh1 mutants ( Figure 3 A-3B). Using CeCl 3 Subcellular localization studies showed that H accumulated in the intercellular space of root cells after low nitrogen treatment was higher than that in wild-type plants. 2 O 2 This is also suppressed in rboh1 mutants ( Figure 3 C). Consistently, low nitrogen induced H 2 O 2 NADPH oxidase activity was also suppressed in the roots of rboh1 mutants ( Figure 3 DE), indicating that RBOH1 mediates ROS generation under low nitrogen stress. We further investigated the function of RBOH1 in tomato response to low nitrogen stress. Under normal nitrogen conditions, there was no significant difference in growth phenotype between WT and rboh1 mutant ( Figure 4 A). However, after three weeks of low nitrogen treatment, rboh1 mutants showed severe leaf chlorosis, while WT plants showed milder chlorosis ( Figure 4 A). Under low nitrogen stress, the chlorophyll content and total biomass of the rboh1 mutant were significantly lower than those of the WT plants ( Figure 4 B) Under normal conditions, nitrogen and carbon contents in the roots of WT and rboh1 plants are similar ( Figure 4 C). However, under low nitrogen conditions, nitrogen and carbon contents in the roots and pores of rboh1 mutants were significantly lower than those in WT plants ( Figure 4 C). Similarly, there was no significant difference in the gene expression of NRT1.1 and NRT2.1 in the roots of WT and rboh1 plants under normal conditions, but under low nitrogen conditions, the gene expression of NRT1.1 and NRT2.1 in the roots of rboh1 mutants was significantly lower than that of WT. This highlights the RBOH1-dependent H 2 O 2These findings suggest that RBOH1 positively regulates nitrogen uptake in tomato.

[0096] Example 4

[0097] 1. EMSA experiments verified that the transcription factor TGA4 binds to the promoters of NRT1.1 and NRT2.1 genes

[0098] According to the full length CDS of TAG4 gene (amino acid sequence as shown in SEQ ID NO.4, gene sequence as shown in SEQ ID NO.2), specific primers were designed (see Table 2), and PCR amplification was performed using tomato cDNA as template. The vector was digested with EcoRI and BamHI and ligated to the yeast expression vector pGBKT7 (BD-MED25). MBP-TGA4, MBP-TGA4 C334S The fusion protein needs to be affinity purified. In the EMSA experiment, the probe was biotin labeled at the 3′ end using the Biotin 3′End DNA Labeling Kit (Pierce, 89818) and annealed to form a double-stranded probe. The binding experiment was performed according to the guidelines provided by the Light Shift Chemiluminescent EMSA Kit (Thermo Fisher Scientific, 20148). The Biotin-EBNA Control DNA and EBNA extract provided in the kit were used as positive controls. The primers for the probes used are listed in Table 3.

[0099] 2.LUC-REN experiment verifies that transcription factor TGA4 activates the expression of NRT1.1 and NRT2.1

[0100] TGA4 and TGA4 C334S CDS sequence (TGA4 C334SThe nucleotide sequence is shown in SEQ ID NO.5) and the promoters of NRT1.1 and NRT2.1 (the NRT1.1 promoter sequence is shown in SEQ ID NO.6; the NRT2.1 promoter sequence is shown in SEQ ID NO.7), respectively, were inserted into pGreen 1I002962-SK and pGreen II0800-LUC vectors. The primers used for vector construction are listed in Table 2. The promoter PCR product was cloned into the pGreen II0800-LUC vector to drive the expression of the firefly luciferase (LUC) reporter gene, while the 35S promoter (Pro35S) was used to drive the Renilla luciferase (REN) reporter gene as an internal reference. The promoter activity was analyzed in Nicotiana benthamiana by Agrobacterium-mediated transient expression. All constructs were introduced into Agrobacterium GV3101 strains. The Agrobacterium strains containing the relevant constructs were mixed and injected into N. benthamiana leaves together with the infiltration buffer. Two days after infiltration, LUC and REN activities were measured using a dual luciferase reporter gene kit (Vazyme, DL101-01). The relative LUC / REN activities of the empty vector SK combined with the promoter were normalized to 1, and the analysis was performed in 6 replicates.

[0101] 3. CUT-RUN experiments verified that the transcription factor TGA4 activated the expression of NRT1.1 and NRT2.1 in tomatoes

[0102] Plant cell nuclei were extracted using the BestBio Plant Cell Nuclear Extraction Kit (BestBio, BB-36112). CUT-RUN experiments were performed using the High Activity pG-M Nase CUT&RUN PCR / qPCR Kit (Vazyme, HD101) according to the manufacturer’s instructions. Approximately 5 × 10 5 The nuclear samples were incubated with IgG control antibody and anti-GFP monoclonal antibody (Thermo Fisher Scientific, MA5-15256) at 4°C overnight, followed by the cleavage and release steps. The DNA fragments in the CUT-RUN experiment were purified by DNA purification buffer and spin columns. Finally, qPCR was used to quantify the DNA products, and the primers used are listed in Table 4.

[0103] Table 2 Vector construction primers

[0104] Carrier sequence MBP-TGA4-F gagggaaggatttcagaattcATGAATTCTTCAACATATACTCAATTTGTT MBP-TGA4-R caggtcgactctagaggatccAGCAGGTTCAGAAAGACGTCCA <![CDATA[MBP-TGA4 C334S -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[MBP-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG SK-TGA4-F cgctctagaactagtggatccATGAATTCTTCAACATATACTCAATTTGTT SK-TGA4-R tgatttcagcgaattggtaccAGCAGGTTTCAGAAAGACGTCCA <![CDATA[SK-TGA4 C3334 -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[SK-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG GFP-TGA4-F ctctcgagctttcgcgagctcATGAATTCTTCAACATATACTCAATTTGTT GFP-TGA4-R gcccttgctcaccatggatccAGCAGGTTCAGAAAGACGTCCA <![CDATA[GFP-TGA4 C3334 -F]]> GATGTCCAGCATACTGGCTCCGCACCAATCAG <![CDATA[GFP-TGA4 C3334 -R]]> CCAGTATGCTGGACATCTGTAGAAGGGTTTCTTGG

[0105] Table 3 Probe primers for EMSA experiments

[0106] Probe sequence NRT1.1-probe-F TATCTTTTTGACGTGCAATA NRT1.1-probe-R TATTGCACGTCAAAAAGATA NRT2.1-probe-F AAACACACGTCAGGCTTCCA NRT2.1-probe-R TGGAAGCCTGACGTGTGTTT Mu-NRT1.1-probe-F TATCTTTTAAAAATGCAATA Mu-NRT1.1-probe-R TATTGCATTTTTAAAAGATA Mu-NRT2.1-probe-F AAACACAAAAAAGGCTTCCA Mu-NRT2.1-probe-R TGGAAGCCTTTTTTGTGTTT

[0107] Table 4 Primers for CUT-RUN experiment

[0108] name sequence NRT1.1-CUT-RUN-F CCCTATTGTTTGGGTGCATTCT NRT1.1-CUT-RUN-R GTCTGGCCCAGGAATTTTACAAC NRT2.1-CUT-RUN-F TTTGCAATGCCCTTATTCTTTG NRT2.1-CUT-RUN-R TCTTCACGTTTGCCTCACCC

[0109] RBOH1-induced H 2 O 2 The research focus on the effects of low nitrogen on the expression of NRT1.1 and NRT2.1 genes is 2 O 2 Whether these genes are regulated by oxidative post-translational modifications (Oxi-PTMs) of specific transcription factors. We identified a transcription factor, TGA4, as a regulator of NRT1.1 and NRT2.1. TGA4 has a conserved "TGACG" binding site in the promoters of NRT1.1 and NRT2.1 ( Figure 5 A). Electrophoretic mobility shift assays (EMSA) confirmed that TGA4 binds to these promoters in vitro ( Figure 5 B). In vivo, using Pro35S as the effector and ProNRT1.1 or ProNRT2.1 as the luciferase (LUC) reporter gene, the experiment showed that TGA4 significantly enhanced the LUC activity of both reporter genes ( Figure 5 C). In addition, analysis using CUT&RUN qPCR showed that under low nitrogen conditions, GFP-TGA4 bound more strongly to the promoters of NRT1.1 and NRT2.1 than GFP-EV control ( Figure 5 D).

[0110] To analyze Oxi-PTM, we used a biotin exchange assay to detect H 2 O 2 sensitive cysteine ​​residues and use BIAM labeling to detect H 2 O 2 The maltose binding protein (MBP) fusion protein of the transcription factor (MBP-TGA4) was pretreated with or without H 2 O 2 SDS-PAGE and immunoblotting analysis showed that MBP-TGA4 was labeled with BIAM and H 2 O 2 Treatment resulted in a dose-dependent decrease in the marker level, indicating that H 2 O 2 The reduced cysteine ​​residues in these proteins are reduced Figure 6 A).

[0111] Western blot analysis showed that H 2 O 2induced the oxidation of TGA4, and Cys-334 was identified as the major oxidized residue ( Figure 6 B).

[0112] In vivo experiments showed that nitrogen deficiency significantly induced the oxidation of TGA4, and H 2 O 2 Under these conditions, mutation of Cys-334 significantly reduced the level of TGA4 oxidation ( Figure 6 C). RBOH1 mutation also reduces the oxidation level of TGA4 under low nitrogen stress ( Figure 6 C).

[0113] In order to determine H 2 O 2 To investigate whether TGA4-mediated oxidation promotes the expression of NRT1.1 and NRT2.1, we compared the control and H 2 O 2 LUC activity was measured in N. benthamiana leaves under the treatment conditions. The expression of Pro35S significantly enhanced the LUC activity of NRT1.1 and NRT2.1 reporter genes, especially under H 2 O 2 Processing Figure 6 D) However, in leaves expressing the Pro35S mutant, H 2 O 2 The LUC activity after treatment was lower than that in leaves expressing Pro35S ( Figure 6 D), indicating that H 2 O 2 The TGA4-mediated Oxi-PTM at Cys-334 is critical for the ability of TGA4 to enhance NRT1.1 and NRT2.1 promoter binding.

[0114] Further analysis using CUT-RUN qPCR under low nitrogen conditions showed that the enrichment of NRT1.1 and NRT2.1 promoters in GFP-TGA4 / WT transgenic roots was significantly higher than that in GFP-TGA4 C334S / WT transgenic root line ( Figure 6 E).

[0115] In addition, the relative enrichment of NRT1.1 and NRT2.1 promoters in GFP-TGA4 / WT transgenic roots was significantly higher than that in GFP-TGA4 / rboh1-1 roots ( Figure 6 F). Mutation of RBOH1 significantly impairs the ability of TGA4 to promote the expression of NRT1.1 and NRT2.1 under low nitrogen conditions. These results together indicate that RBOH1-dependent H 2 O 2Post-translational modification of TGA4 by oxidation enhanced the binding of TGA4 to the promoters of NRT1.1 and NRT2.1, thereby promoting the expression of these genes under low nitrogen stress.

[0116] Compared with the prior art, the main advantages of the present invention include: the present invention inhibits the expression of tomato RBOH1 through CRISPR / Cas9 technology to produce rboh1 mutant plants, laying the foundation for finding simpler ideas and methods for creating tomato plant nitrogen efficient utilization germplasm.

[0117] In addition, it should be understood that after reading the above description of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Application of a tomato gene or a protein encoded by the tomato gene in regulating plant tolerance to low nitrogen stress, wherein the tomato gene is the RBOH1 gene or the TGA4 gene.

2. The use according to claim 1, characterized in that The amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.

4.

3. The use according to claim 1, characterized in that The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.

2.

4. The use according to claim 1, characterized in that The plant is Arabidopsis thaliana, tomato or tobacco.

5. A method for regulating plant tolerance to low nitrogen stress, characterized in that: When it is necessary to reduce the tolerance of plants to low nitrogen stress, the RBOH1 gene or TGA4 gene in the plants is silenced or knocked out; when it is necessary to increase the tolerance of plants to low nitrogen stress, the RBOH1 gene or TGA4 gene in the plants is overexpressed; The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.

2.

6. The method for regulating plant tolerance to low nitrogen stress as claimed in claim 5, characterized in that: The plant is Arabidopsis thaliana, tomato or tobacco.

7. Use of a tomato gene or a protein encoded by the tomato gene in creating germplasm with high tolerance to low nitrogen stress, wherein the tomato gene is the RBOH1 gene or the TGA4 gene, and germplasm with high tolerance to low nitrogen stress is obtained by screening germplasm with high expression of tomato genes or high expression of proteins encoded by tomato genes.

8. The use according to claim 7, characterized in that The amino acid sequence of the protein encoded by the RBOH1 gene is shown in SEQ ID NO.3, and the amino acid sequence of the protein encoded by the TGA4 gene is shown in SEQ ID NO.4; The nucleotide sequence of the RBOH1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the TGA4 gene is shown in SEQ ID NO.

2.

9. A method for constructing germplasm with high tolerance to low nitrogen stress, characterized in that: The method comprises the following steps: overexpressing the RBOH1 gene in the germplasm, wherein the nucleotide sequence of the RBOH1 gene is shown as SEQ ID NO.

1.

10. The method for constructing germplasm with high tolerance to low nitrogen stress as claimed in claim 9, characterized in that: The following steps are involved: (1) constructing a vector for overexpressing the RBOH1 gene; (2) The vector for overexpressing the RBOH1 gene constructed in step (1) is introduced into tomato explants to overexpress the RBOH1 gene having a nucleotide sequence as shown in SEQ ID NO.1, and the germplasm with high tolerance to low nitrogen stress is obtained after cultivation.

Images