Nucleic acid sequence combination for simultaneously detecting various pathogenic vibrios, RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit and use method of RT-PCR kit

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a nucleic acid sequence combination for simultaneously detecting various pathogenic vibrios, an RT-PCR (reverse transcription-polymerase chain reaction) kit and a use method of the RT-PCR kit, and the nucleic acid sequence combination is shown as SEQ ID No.1-SEQ ID No.19. The RT-PCR kit comprises RT-PCR primer probes, the primer probes comprise forward and reverse amplification primers and detection probes respectively aiming at vibrio cholerae, vibrio parahaemolyticus, vibrio fluvialis, vibrio mimicus, vibrio vulnificus and vibrio alginolyticus, and corresponding sequences in SEQ ID No.1-SEQ ID No.19 are adopted. The kit disclosed by the invention can be used for rapidly detecting and identifying the six vibrios at the same time; the kit has high accuracy, specificity and sensitivity, and is suitable for clinical detection of infected samples.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio, an RT-PCR kit and a use method thereof. Background Art

[0002] Foodborne diarrhea is a common gastrointestinal disease that is closely related to our daily diet. The mechanism of foodborne diarrhea can be divided into two categories: infectious diarrhea caused by pathogenic microorganisms and non-infectious diarrhea, including food allergic reactions, food intolerance, and food poisoning. In infectious diarrhea, common pathogenic microorganisms include Salmonella, Shigella, Vibrio, Campylobacter, diarrhea-causing Escherichia coli, and Norovirus. These pathogens can be transmitted to humans through contaminated food, causing symptoms such as diarrhea.

[0003] Bacterial diarrhea is an intestinal disease caused by bacterial infection, mainly manifested by diarrhea, abdominal pain, nausea, vomiting and other symptoms. This disease is widely prevalent worldwide, especially in developing countries, posing a serious threat to children's health. It is an important factor leading to malnutrition, growth and development disorders and even death in children. Bacterial diarrhea has a high incidence and mortality rate among children in developing countries. There are about 21.7 billion diarrhea and related cases in developing countries each year, resulting in the death of about 2.4 million children under the age of 5. Common symptoms of bacterial diarrhea include increased frequency of bowel movements, abdominal pain, abdominal distension, mucus, pus and blood in the stool. In addition, patients may also experience severe symptoms such as high fever and water and electrolyte disorders. Diarrhea caused by different bacteria has different characteristics, such as watery stools, sticky stools or bloody stools.

[0004] Vibrio plays an important role in diarrheal infections, especially Vibrio parahaemolyticus, which is one of the main pathogens causing diarrhea. Its infection has obvious seasonality, mainly in summer and autumn. Other Vibrio that cause diarrhea include Vibrio cholerae, Vibrio rivulosa, Vibrio vulnificus, Vibrio mimicus, and Vibrio alginolyticus. Vibrio cholerae mainly causes acute diarrhea. After entering the human body through the mouth, it can survive in the gastric acid environment and enhance its survival ability in gastric juice by forming a biofilm. It eventually colonizes in the small intestine and releases virulence factors, causing diarrheal cholera. In recent years, there have been more and more reports of Vibrio rivulosa, Vibrio vulnificus, Vibrio mimicus, and Vibrio alginolyticus causing diarrhea in humans.

[0005] Detection methods for diarrheal bacterial pathogens include culture, serological identification, conventional PCR, fluorescent PCR, sequencing, etc. Different methods have different characteristics. Fluorescent PCR is increasingly being used due to its high sensitivity and specificity, simple operation, and rapid results.

[0006] The technical difficulties that need to be improved in the fluorescent PCR detection method for diarrhea bacteria are mainly: on the one hand, to improve the specificity of the detection, it is necessary to design highly specific primers and probes. Since there are many types of intestinal flora in gastrointestinal samples and the diversity of gene sequences, primers and probes must be very precise for the target bacteria to avoid cross-reactions with other microorganisms; on the other hand, to improve the sensitivity of the detection to avoid the risk of missed detection.

[0007] In the prior art, a Chinese patent with publication number CN108841980B provides a nucleic acid combination for the detection of pathogenic Vibrio and its application, which combines the visualization membrane chip technology of reverse dot hybridization with the multiplex PCR technology. During the detection, the single-stranded probes of each species-specific sequence are arranged in order and fixed on the surface of the supporting membrane, and then the multiplex PCR products to be tested are hybridized with them, so that multiple pathogenic Vibrio can be detected on a membrane chip at the same time. However, the visualization membrane chip technology of reverse dot hybridization used in the above prior art has the technical problems of complex detection operation, high detection cost and poor detection sensitivity when detecting nucleic acid samples.

[0008] Another example is the prior art Chinese patent CN11 0093428A, which provides a high-throughput quantitative detection kit for pathogenic Vibrio. The primers designed for 8 pathogenic Vibrio specific genes have strong specificity and can be rapidly amplified. The amount of pathogenic template is determined by the amount of double-stranded DNA using fluorescent dyes, thereby achieving quantitative detection. However, the detection limit of the above prior art can only reach 10 to 40 copies / μL, and the sensitivity is poor. Summary of the invention

[0009] In response to the technical problems of complex operation, high detection cost and poor sensitivity in the existing technology for detecting pathogenic Vibrio mentioned in the background technology, the present invention can effectively improve the sensitivity and specificity of detection, reduce the difficulty of operation and reduce the detection cost by specifically designing primers and probes and combining them with full premix technology.

[0010] The specific technical solutions of the present invention are as follows:

[0011] A nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio species, comprising the following primer pairs:

[0012] Forward amplification primers for detecting Vibrio cholerae:

[0013] 5'-GCTTTGTAGGTTGCCGTTG+T-3', as shown in SEQ ID No. 1;

[0014] Reverse amplification primers: 5'-ACTTGCTGCTAACGTTGG+CT-3', as shown in SEQ ID No.2, 5'-GCGAATGCTGGCGTAGA+C-3', as shown in SEQ ID No.3;

[0015] Forward amplification primers for detection of Vibrio parahaemolyticus:

[0016] 5'-GGCAAACATCAAAYTGTTC+GC-3', as shown in SEQ ID No.4; reverse amplification primer: 5'-GCGACCTTTCTCTGAAATATTAA+TTG-3', as shown in SEQ ID No.5;

[0017] Forward amplification primer for detecting Vibrio fluvibrios: 5'-AACCACGAATGGATCTGTTC+AC-3', as shown in SEQ ID No.6; reverse amplification primer: 5'-ACACYGCCAAGCGTC+GAA-3', as shown in SEQ ID No.7;

[0018] Forward amplification primer for detecting Vibrio mimicus: 5'-TCACTGAGCATAAAGGTGAGC+TG-3', as shown in SEQ ID No.8; reverse amplification primer: 5'-TTAGTGACATTATTGGCAGACAC+TG-3', as shown in SEQ ID No.9;

[0019] Forward amplification primers for detection of Vibrio vulnificus:

[0020] 5'-GATGTTTATGGTGAGAACGGTG+A-3', as shown in SEQ ID No.10; reverse amplification primer: 5'-TCTTTATCTAGGCCCCAAAC+TTG-3', as shown in SEQ ID No.11;

[0021] Forward amplification primers for detection of Vibrio alginolyticus:

[0022] 5'-GGTATATGCGCAATGCRG+TT-3', as shown in SEQ ID No.12; reverse amplification primer: 5'-CTCATCTTCAGCACCGATTG+AT-3', as shown in SEQ ID No.13.

[0023] Furthermore, the nucleic acid sequence combination also includes the following probe groups:

[0024] Vibrio cholerae detection probe: 5'-AGGAACCAGCTATCATTG-3', as shown in SEQ ID No. 14;

[0025] Vibrio parahaemolyticus detection probe: 5'-AGCCGTCGAGCCTT-3', as shown in SEQ ID No. 15;

[0026] Vibrio fluvibrios detection probe: 5'-ATTGATTCTGTTGGTTGCC-3', as shown in SEQ ID No. 16;

[0027] Vibrio mimicus detection probe: 5'-ATCCACATCCTCCGCACG-3', as shown in SEQ ID No. 17;

[0028] Vibrio vulnificus detection probe: 5'-TCCAACTGCCGTGACAGC-3', as shown in SEQ ID No. 18;

[0029] Vibrio alginolyticus detection probe: 5'-ATTGCTCGTTCCACTGC-3', as shown in SEQ ID No.19.

[0030] Furthermore, the 5' end of the Vibrio cholerae detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0031] The 5' end of the detection probe sequence of Vibrio parahaemolyticus is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0032] The 5' end of the detection probe sequence of Vibrio fluvibrios is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0033] The 5' end of the Vibrio mimicus detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0034] The 5' end of the Vibrio vulnificus detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0035] The 5' end of the detection probe sequence of Vibrio alginolyticus is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB.

[0036] Furthermore, the bases "A+", "C+" and "G+" in the primer sequence are locked nucleic acid modified bases.

[0037] The present invention also provides an RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio spp., wherein the kit adopts the above-mentioned nucleic acid sequence combination.

[0038] Furthermore, the kit includes fully premixed reagents I and II, and both reagents I and II include a buffer solution, Taq enzyme, and primers and probes for detection; reagent I is used to detect Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio fluviro; and reagent II is used to detect Vibrio mimicus, Vibrio vulnificus, and Vibrio alginolyticus.

[0039] Furthermore, the final concentration of primers for Vibrio cholerae, Vibrio parahaemolyticus and Vibrio fluvii in the reagent I is 444 nM, and the final concentration of probes for Vibrio cholerae, Vibrio parahaemolyticus and Vibrio fluvii is 222 nM; in the reagent II, the final concentration of primers for Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus is 444 nM, and the final concentration of probes for Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus is 222 nM.

[0040] The present invention also provides a method for using the RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio, comprising the following steps:

[0041] Step 1: Extract sample nucleic acid;

[0042] Step 2: Mix Reagent I and Reagent II respectively and dispense them into test tubes, then add the extracted sample template, negative control, and positive quality control products into different PCR reaction tubes, set the reaction conditions, and perform fluorescent PCR detection;

[0043] Step 3: After the reaction in step 2 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

[0044] Furthermore, the reaction conditions in step 2 are: 95° C., 2 min in the pre-denaturation stage; 95° C., 5 s, 56° C., 30 s in the amplification stage, and 40 cycles.

[0045] Compared with the prior art, the present invention has the following advantages:

[0046] (1) The present invention can achieve rapid detection and identification of 6 pathogenic Vibrio species simultaneously by designing specific primer probe sequences, accurately determine specific pathogens, guide further antibiotic treatment, and improve the scientificity and effectiveness of treatment plans. At the same time, the kit provided by the present invention can help to conduct statistical analysis on the types and prevalence of infected pathogens by identifying specific pathogens, understand the detection rate of infected pathogens, and the prevalence trend, and then take scientific preventive measures. And compared with other detection kits currently on the market, the detection limit of the kit provided in the present invention for each pathogenic Vibrio can reach as low as 250 copies / mL, which improves the sensitivity of detection.

[0047] (2) The reagents in the kit of the present invention are in the form of a fully premixed solution, that is, the primer probe, buffer and Taq enzyme are premixed into one tube, and only need to be thawed, mixed and dispensed for use, eliminating the step of preparing the reaction system and greatly improving work efficiency. In addition, the kit of the present invention has optimized the amplification procedure to shorten the detection time, and can achieve the detection time shortened to within 1 hour.

[0048] (3) The kit provided in the present invention uses locked nucleic acid to modify the bases at specific sites on the primers, thereby improving the amplification efficiency of the primers and further improving the detection sensitivity while ensuring specificity. Compared with the primer sequence not modified with locked nucleic acid, the detection sensitivity of the present invention is improved by about 5 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is a graph showing the detection results of reagent I in an RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio in an embodiment of the present invention;

[0050] Figure 2 This is a graph showing the detection results of reagent II in an RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio in an embodiment of the present invention;

[0051] Figure 3 This is a graph showing the experimental results of the detection limits of various detection index target sequences using the primers and probes of the present invention in Experimental Example 1 of the present invention;

[0052] Figure 4 This is a graph showing the experimental results of the detection limits of various detection index target sequences using the primers and probes of the present invention in Experimental Example 1 of the present invention;

[0053] Figure 5 This is a comparison chart of the detection results of Vibrio cholerae using a locked nucleic acid modified primer system and a conventional primer system in Example 2 of the present invention;

[0054] Figure 6 This is a comparison chart of the detection results of Vibrio parahaemolyticus using a locked nucleic acid modified primer system and a conventional primer system in Example 2 of the present invention;

[0055] Figure 7 This is a comparison chart of the detection results of Vibrio fluvibrios using a primer system modified with locked nucleic acid and a conventional primer system in Example 2 of the present invention;

[0056] Figure 8 This is a comparison chart of the detection results of Vibrio mimicus using a locked nucleic acid modified primer system and a conventional primer system in Example 2 of the present invention;

[0057] Fig. 9 This is a comparison chart of the detection results of Vibrio vulnificus using a locked nucleic acid modified primer system and a conventional primer system in Example 2 of the present invention;

[0058] Fig.10 This is a comparison chart of the detection results of Vibrio alginolyticus using a primer system modified with locked nucleic acid and a conventional primer system in Example 2 of the present invention;

[0059] Fig.11 This is a graph showing the results of cross-reaction detection between the primer-probe detection system of the present invention and common pathogens of diarrhea in Example 4 of the present invention. DETAILED DESCRIPTION

[0060] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0061] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work shall fall within the scope of protection of the present invention.

[0062] Example

[0063] This embodiment provides a nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio, and the sequence is shown in the following Table 1:

[0064] Table 1: Nucleotide sequence list

[0065]

[0066]

[0067] The bases "A+", "C+" and "G+" in the above primer sequences are bases modified with locked nucleic acid, wherein the Vibrio cholerae specific primers are shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the detection probe is shown in SEQ ID No.14, the 5' end of which is labeled with a FAM fluorescent group and the 3' end is labeled with a fluorescent quenching group MGB;

[0068] The Vibrio parahaemolyticus specific primers are shown in SEQ ID No. 4 and SEQ ID No. 5, and the detection probe is shown in SEQ ID No. 15, the 5' end of which is labeled with a VIC fluorescent group and the 3' end is labeled with a fluorescent quenching group MGB;

[0069] The specific primers for Vibrio fluvibrios are shown in SEQ ID No.6 and SEQ ID No.7, and the detection probe is shown in SEQ ID No.16, the 5' end of which is labeled with a ROX fluorescent group, and the 3' end of which is labeled with a fluorescent quenching group MGB;

[0070] The Vibrio mimicus specific primers are shown in SEQ ID No. 8 and SEQ ID No. 9, and the detection probe is shown in SEQ ID No. 17, the 5' end of which is labeled with a FAM fluorescent group and the 3' end is labeled with a fluorescent quenching group MGB;

[0071] The Vibrio vulnificus specific primers are shown in SEQ ID No. 10 and SEQ ID No. 11, and the detection probe is shown in SEQ ID No. 18, the 5' end of which is labeled with a VIC fluorescent group and the 3' end is labeled with a fluorescent quenching group MGB;

[0072] The Vibrio alginolyticus specific primers are shown in SEQ ID No. 12 and SEQ ID No. 13, and the detection probe is shown in SEQ ID No. 19, the 5' end of which is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB.

[0073] This embodiment also provides an RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio, wherein the detection kit is prepared using a 20 μl amplification reaction system as an example. The preparation scheme of reagent I is shown in Table 2 below, and the preparation scheme of reagent II is shown in Table 3 below:

[0074] Table 2: Reagent I preparation table

[0075]

[0076] Table 3: Reagent II preparation table

[0077]

[0078]

[0079] The RT-PCR premix is ​​a mixed solution of a buffer solution and a taq enzyme, purchased from Novozymes, product name: PureAmp U+Super Multiple Probe qPCR PreMix (Low DNA), item number: UQN221-C1. The corresponding sequences of the primer and probe names in Table 2 and Table 3 are shown in Table 1.

[0080] This embodiment also provides a method for using the above detection kit, comprising the following steps:

[0081] Step 1: Extract sample nucleic acid.

[0082] Specifically, nucleic acids from positive samples of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus were extracted for verification of the detection system, and the indicators of each positive sample were confirmed by sequencing.

[0083] Step 2: Mix Reagent I and Reagent II and dispense them directly into 96-well plates or eight-well tubes. Add the extracted sample template, negative control, and positive quality control products into different PCR reaction tubes, place them in the fluorescence quantitative PCR instrument, set the reaction conditions, and perform fluorescence PCR detection.

[0084] Specifically, the prepared reagents I and II are vortexed and mixed, centrifuged instantly, and directly dispensed into a 96-well plate or eight-well tube strip, with 18 μL dispensed into each well; the dispensed reagents are brought to the sample loading room, and 2 μL of the sample nucleic acid, negative control, and positive quality control products extracted and prepared in advance are added to different PCR reaction tubes, covered with tube caps or sealed with film, and brought to the amplification room for on-machine testing after instant centrifugation.

[0085] Step 3: After the reaction in step 2 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

[0086] Specifically, the reaction conditions were set as 95°C for 2 min in the pre-denaturation phase, 95°C for 5 s, 56°C for 30 s in the amplification phase, and 40 cycles. After the settings were completed, the detection program was run. The criteria for interpreting the amplification curve and Ct value results were as follows:

[0087] Positive: "S"-shaped amplification curve appears, Ct value ≤ 35; Suspicious: "S"-shaped amplification curve appears, but Ct value > 35;

[0088] Negative: No Ct value; or the curve exceeds the threshold, but does not show an "S" shape. For suspicious results, the experiment should be repeated. If an "S"-shaped amplification curve appears in the repeated experiment, and the negative control is not contaminated, it can be judged as positive.

[0089] The experimental results are as attached Figure 1 and attached Figure 2 As shown, from the results, it can be seen that the detection kit of the present invention can be used to simultaneously detect nucleic acids of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus samples, all of which can be accurately detected with good linearity.

[0090] Experimental Example 1: Detection Limit Experiment

[0091] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, the reference samples of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus were detected. The reference samples were artificially synthesized and accurately quantified nucleic acid samples. After the samples were gradient diluted, the concentrations of 5000 copies / mL, 1000 copies / mL, 500 copies / mL, 250 copies / mL and 100 copies / mL solutions were selected for on-machine detection to verify the minimum detection limit and linearity of the kit.

[0092] The experimental results are as attached Figure 3 and 4 It can be seen that the detection limit reference of each index detected by the primers and probes of the present invention shows good linearity of the detection system, and the minimum detection limit of each index of the present invention can reach 250 copies / mL, while the minimum detection limit of similar multiple detection kits on the market or similar multiple detection methods reported in the literature is claimed to be 500 copies / mL. Detection using the primers and probes of the present invention has better sensitivity.

[0093] Experimental Example 2: Effect of Locked Nucleic Acid on Detection Sensitivity

[0094] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, conventional primers that have not been modified with locked nucleic acid are set as control group 1, and Vibrio cholerae, Vibrio parahaemolyticus, Vibrio rivulosa, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus are detected respectively. The sample is consistent with the detection kit in the embodiment. This experimental example detects the positive sample nucleic acid of each index with a sample concentration of 500 copies / mL to verify whether the locked nucleic acid modification can effectively improve the detection sensitivity of the detection kit of the present invention.

[0095] The experimental results are shown in Table 4 below. It can be seen from the table that the locked nucleic acid modified primer system of the present invention can advance the Ct value of each index channel detection by 1-3 compared with the primer system of control group 1, reflecting that the detection sensitivity of the present invention is about 5 times higher than that of control group 1. At the same time, the signal value of the present invention is also significantly improved compared with the other two methods. The signal value of the modified primer system of the present invention is distributed between 1400-2400, and the signal value of the conventional primer system is between 800-1600.

[0096] Table 4: Comparison of the test results of the primer system of the present invention and the primer system without locked nucleic acid modification

[0097]

[0098] Experimental Example 3: Effect of probe on amplification signal value

[0099] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, the probe sequence used was replaced as the control group 2, and Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus were detected respectively to verify that the probe sequence used in the present invention has specificity. The specific probe sequence information of the control group 2 is shown in Table 5 below:

[0100] Table 5: Probe sequence list of control group 2

[0101]

[0102] The embodiment and comparative example 2 were compared in an experiment. The reaction system was prepared as in the reference embodiment, and the template loading amount was 2 μL. The loading template was the target sequence solution of each index, with a concentration of 500 copies / μL. The ABI 7500 fluorescent PCR instrument was used for on-machine detection, and the detection Ct value and signal value difference between the embodiment and the control group 2 were compared. The experimental results are shown in Table 6 below:

[0103] Table 5: Test results of Example and Control Group 2

[0104]

[0105]

[0106] Analysis of experimental results: It can be seen from Table 5 that the probe sequence selected in the present invention is superior to the probe sequence used in the control group 2 in terms of signal value. The high signal value can indirectly improve the sensitivity. At the same time, the high signal value amplification curve is more standard, which makes it easier to interpret the results when detecting low-concentration samples. In addition, it has better specificity.

[0107] Example 4: Specificity test of the primer-probe detection system of the present invention

[0108] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, 14 common diarrheal bacterial cultures or samples were selected to test whether the detection kit provided by the present invention is specific to Vibrio cholerae, Vibrio parahaemolyticus, Vibrio fluvii, Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus. The 14 diarrheal bacterial indicators include: Aeromonas hydrophila, Pseudomonas shigelloides, Salmonella, Shigella, Campylobacter coli, Campylobacter jejuni, Enterobacter sakazakii, Clostridium difficile, Yersinia enterocolitica and diarrhea-causing Escherichia coli (ETEC, EHEC / STEC, EPEC, EAEC, EIEC).

[0109] The experimental results are as attached Fig.11 As shown. Fig.11 It can be seen that the detection kit provided by the present invention has no cross reaction with common diarrheal bacterial pathogens and has good specificity.

Claims

1. A nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio, characterized in that: The following primer pairs are included: Forward amplification primers for detecting Vibrio cholerae: 5'-GCTTTGTAGGTTGCCGTTG+T-3', as shown in SEQ ID No.1; reverse amplification primer Compound: 5'-ACTTGCTGCTAACGTTGG+CT-3', as shown in SEQ ID No.2, 5'-GCGAATGCTGGCGTAGA+C-3', as shown in SEQ ID No.3; Forward amplification primers for detection of Vibrio parahaemolyticus: 5'-GGCAAACATCAAAYTGTTC+GC-3', as shown in SEQ ID No.4; reverse amplification primer: 5'-GCGACCTTTCTCTGAAATATTAA+TTG-3', as shown in SEQ ID No.5; Forward amplification primer for detecting Vibrio fluvibrios: 5'-AACCACGAATGGATCTGTTC+AC-3', as shown in SEQ ID No.6; reverse amplification primer: 5'-ACACYGCCAAGCGTC+GAA-3', as shown in SEQ ID No.7; Forward amplification primer for detecting Vibrio mimicus: 5'-TCACTGAGCATAAAGGTGAGC+TG-3', as shown in SEQ ID No.8; reverse amplification primer: 5'- TTAGTGACATTATTGGCAGACAC+TG-3', as shown in SEQ ID No.9; Forward amplification primers for detection of Vibrio vulnificus: 5'- GATGTTTATGGTGAGAACGGTG+A-3', as shown in SEQ ID No.10; reverse amplification primer: 5'-TCTTTATCTAGGCCCCAAAC+TTG-3', as shown in SEQ ID No.11; Forward amplification primers for detection of Vibrio alginolyticus: 5'-GGTATATGCGCAATGCRG+TT-3', as shown in SEQ ID No.12; reverse amplification primer: 5'-CTCATCTTCAGCACCGATTG+AT-3', as shown in SEQ ID No.

13.

2. A nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio according to claim 1, characterized in that: Also included are the following probe sets: Vibrio cholerae detection probe: 5'-AGGAACCAGCTATCATTG-3', such as SEQ ID No.14 As shown; Vibrio parahaemolyticus detection probe: 5'-AGCCGTCGAGCCTT-3', as shown in SEQ ID No.15; Vibrio fluvibrios detection probe: 5'-ATTGATTCTGGTTGGTTGCC-3', as shown in SEQ ID No.16 Show; Vibrio mimicus detection probe: 5'-ATCCACATCCTCCGCACG -3', as shown in SEQ ID No. 17; Vibrio vulnificus detection probe: 5'-TCCAACTGCCGTGACAGC -3', as shown in SEQ ID No. 18; Vibrio alginolyticus detection probe: 5'-ATTGCTCGTTCCACTGC -3', as shown in SEQ ID No.

19.

3. A nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio according to claim 2, characterized in that: The 5' end of the Vibrio cholerae detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the detection probe sequence of Vibrio parahaemolyticus is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the detection probe sequence of Vibrio fluvibrios is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the Vibrio mimicus detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent Photoquencher group MGB; The 5' end of the Vibrio vulnificus detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the detection probe sequence of Vibrio alginolyticus is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB.

4. A nucleic acid sequence combination for simultaneously detecting multiple pathogenic Vibrio according to claim 3, characterized in that: The bases "A+", "C+" and "G+" in the primer sequence are locked nucleic acid modified bases.

5. A RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio, characterized in that: The kit uses the nucleic acid sequence combination described in claim 4.

6. A RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio as claimed in claim 5, characterized in that: The kit comprises fully premixed reagents I and II, both of which comprise a buffer solution, Taq enzyme, and primers and probes for detection; the reagent I is used for detecting Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio fluvii; the reagent II is used for detecting Vibrio mimicus, Vibrio vulnificus, and Vibrio alginolyticus.

7. A RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio as claimed in claim 6, characterized in that: The final concentration of the primers for Vibrio cholerae, Vibrio parahaemolyticus and Vibrio fluvii in the reagent I is 444 nM, and the final concentration of the probes for Vibrio cholerae, Vibrio parahaemolyticus and Vibrio fluvii is 222 nM; In the reagent II, the final concentration of primers of Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus is 444 nM, and the final concentration of probes of Vibrio mimicus, Vibrio vulnificus and Vibrio alginolyticus is 222 nM.

8. A method for using a RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio as described in claim 7, characterized in that: The steps include: Step 1: Extract sample nucleic acid; Step 2: Mix Reagent I and Reagent II respectively and dispense them into test tubes, then add the extracted sample template, negative control, and positive quality control products into different PCR reaction tubes, set the reaction conditions, and perform fluorescent PCR detection; Step 3: After the reaction in step 2 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

9. The method for using the RT-PCR kit for simultaneously detecting multiple pathogenic Vibrio according to claim 8, characterized in that: The reaction conditions in step 2 are as follows: 95° C. for 2 min in the pre-denaturation stage; 95° C. for 5 s and 56° C. for 30 s in the amplification stage, and 40 cycles.

Images