Close-linkage SSR (simple sequence repeat) marker and application thereof in QTL (quantitative trait loci) positioning of barley helminthosporium leaf spot

Abstract

The invention provides a closely linked SSR marker and application thereof in barley helminthosporium leaf spot resistant QTL positioning, and relates to the technical field of molecular marker assisted breeding. The two QTL sites closely linked with the helminthosporium leaf spot resistance character are successfully positioned through the SSR marker technology, the accuracy of the SSR marker is further verified, the positioning work of the barley helminthosporium leaf spot resistance QTL is successfully completed within a short time by utilizing the SSR marker technology, timely and effective support is provided for disease-resistant breeding, and the method has the advantages of being high in practicability and high in practicability. According to the calculated QTL effect, the position of the QTL on the genetic map is determined, fine positioning of the QTL can be achieved, cross breeding is conducted through the screened helminthosporium leaf spot resistant genotype, a new helminthosporium leaf spot resistant barley variety can be more quickly cultivated in combination with a traditional breeding method, and the strategy of the modern genetic technology and the traditional breeding method is combined.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and specifically relates to a tightly linked SSR marker and application thereof in QTL positioning of barley leaf spot resistance. Background Art

[0002] The positioning of barley leaf spot resistance refers to the process of determining the genes or loci (i.e. the location of the gene on the chromosome) related to leaf spot resistance in the barley genome through molecular marker technology, genetic mapping and other methods. The Chinese patent with publication number CN118755761A discloses an application of a barley leaf spot resistance gene Hv7H.17950, which mainly obtains the barley leaf spot resistance Hv7H.17950 gene through QTL fine positioning, clones the gene, and further verifies its function through bioinformatics analysis and VIGS technology, and explores the leaf spot resistance ability of the barley Hv7H.17950 gene. Although the above patent solves the problem of gene positioning, there are still the following problems in actual operation: each barley sample is not effectively analyzed and processed for DNA, resulting in poor breeding quality; no more perfect marking technology is used to mark the barley gene, resulting in inaccurate later positioning data; no further breeding and breeding process analysis is performed on the positioning of the leaf spot resistance QTL, resulting in poor disease resistance of the new variety. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a tightly linked SSR marker and its application in the QTL positioning of barley resistance to Helminthosporium leaf spot.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides an SSR molecular marker tightly linked to a barley helminth spore leaf spot resistance QTL site, wherein the barley helminth spore leaf spot resistance QTL site is located on barley chromosome 3, and the QTL site includes QRcs-caas-3H-1-1 and / or QRcs-caas-3H-1-2; the QRcs-caas-3H-1-1 is located between the SSR molecular markers scssr25691 and GBM1094; the QRcs-caas-3H-1-2 is located between the SSR molecular markers Bmag0877 and Ebmac0541.

[0006] The present invention also provides a primer set for detecting the SSR molecular marker tightly linked to the barley helminth spore leaf spot resistance QTL site, the primer set comprising one or more of a scssr25691 forward primer and a scssr25691 reverse primer, a GBM1094 forward primer and a GBM1094 reverse primer, a Bmag0877 forward primer and a Bmag0877 reverse primer, and an Ebmac0541 forward primer and an Ebmac0541 reverse primer; the nucleotide sequence of the scssr25691 forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the scssr25691 reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the GBM1094 forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the GBM1094 reverse primer is shown in SEQ ID NO.4; the nucleotide sequence of the Bmag0877 forward primer is shown in SEQ ID NO. The nucleotide sequence of the Bmag0877 reverse primer is shown in SEQ ID NO.5, the nucleotide sequence of the Ebmac0541 forward primer is shown in SEQ ID NO.6; the nucleotide sequence of the Ebmac0541 reverse primer is shown in SEQ ID NO.7, and the nucleotide sequence of the Ebmac0541 reverse primer is shown in SEQ ID NO.8.

[0007] The present invention also provides an application of the SSR molecular marker or the primer set in the QTL positioning of barley resistance to Helminthosporium leaf spot.

[0008] Preferably, the QTL mapping of barley resistance to Helminthosporium leaf spot disease comprises the following steps:

[0009] Parent selection and breeding: barley resources are screened from the barley variety library for phenotypic disease identification, and after identification, hybridization is performed to obtain F1 generation barley seeds after additional generations;

[0010] Self-pollination recombination and DNA extraction: The F1 generation barley seeds are self-pollinated for multiple generations, and the F2 generation barley seeds obtained after multiple generations are sown again. 2:3 DNA was extracted from leaves of individual plants of the family, and barley leaf DNA data was obtained after extraction;

[0011] SSR molecular markers and screening: molecular markers are used to mark the DNA data of barley leaves. After molecular markers are completed, polymorphism analysis and screening are performed. After screening, genotype analysis is performed. SSR markers are performed based on the results of genotype analysis. After marking, SSR marker data are obtained.

[0012] Construction of genetic linkage map: Calculate the genetic distance of SSR marker data, distinguish different linkage groups according to the genetic distance, and construct the map according to different linkage groups and genetic distances. After the construction is completed, the barley genetic map is obtained;

[0013] QTL location analysis and verification: Data processing of barley genetic map, QTL detection after data processing, QTL effect estimation based on QTL detection results, marker association and verification based on QTL effect estimation results, and finally obtain candidate marker data for barley breeding for Helminthosporium leaf spot disease resistance;

[0014] Application of candidate marker data: Analyze the candidate marker data for marker-assisted selection, conduct genotype verification after the selection is completed, confirm the breeding data based on the verification results, breed barley varieties resistant to Helminthosporium leaf spot disease based on the breeding data, and conduct long-term monitoring and improvement of the breeding process.

[0015] More preferably, the barley resources include barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot.

[0016] More preferably, the hybridization process comprises the following steps: emasculating the parental mother of the susceptible barley variety, bagging and isolating the seeds after emasculation, artificially pollinating with pollen of the disease-resistant parent 2-3 days later, marking the parents, and marking and storing the mature seeds after the seeds mature.

[0017] More preferably, the SSR molecular marker and screening also includes the following steps: retrieving known SSR sites from a barley genome database, designing specific primers for the known SSR sites, and obtaining SSR primer data after the design is completed; using the SSR primer data to perform PCR amplification on the barley leaf DNA data to obtain a PCR product; detecting the PCR product, after which the detection is completed, performing electrophoresis analysis on the PCR products of the DNA samples of the barley leaf DNA data of different genotypes at the same SSR site, and recording the allele type of each sample at each SSR site; according to the electrophoresis results, interpreting the genotype of each sample and recording it as different allele types, performing genotyping analysis on the different allele types, and establishing a genotyping database after the genotyping analysis is completed; marking and corresponding the SSR sites after the barley leaf DNA data detection in the established genotyping database, and finally obtaining the SSR marker data.

[0018] More preferably, the generation of the barley genetic map comprises the following steps: verifying and collating the SSR marker data, and after verification and collating, using the Haldane mapping function algorithm to calculate the genetic distance between each pair of SSR marker data in the SSR marker data, and obtaining the SSR marker genetic distance after the calculation; then allocating the SSR marker data to different linkages, the linkage group being a group of markers that are closely connected in genetic distance, markers with smaller genetic distances are classified into the same linkage group, and markers with larger genetic distances belong to different linkage groups; after the allocation is completed, automatic identification of the linkage groups is performed, and linkage group data is obtained after automatic identification; and a barley genetic map is generated according to the genetic distance and linkage group data.

[0019] More preferably, a significance threshold is set when performing QTL detection, and the significance threshold setting includes a permutation test LOD threshold; after QTL detection, the effect size of each significant QTL is calculated, and the QTL effect size includes additive effect, dominant effect and contribution rate to the target trait; and the position of each QTL on the genetic map is determined according to the calculated QTL effect size.

[0020] More preferably, the application of the candidate marker data also includes the following steps: performing correlation analysis on the candidate marker data to confirm the association between each candidate marker and the leaf spot resistance trait, and obtaining representative sample varieties resistant to and susceptible to Helminthosporium leaf spot after the confirmation is completed; performing genotype analysis on the representative sample varieties, and obtaining the performance of each representative sample variety in different genotypes after the analysis is completed, and based on the genotype analysis results, screening out genotypes with Helminthosporium leaf spot resistance traits as breeding materials, and at the same time, recording the phenotypic data of the screened Helminthosporium leaf spot resistance genotypes; using the screened Helminthosporium leaf spot resistance genotypes for hybrid breeding, combined with traditional breeding methods, to cultivate new barley varieties; conducting multi-year multi-point tests on the cultivated Helminthosporium leaf spot resistance barley varieties to observe disease resistance under different environmental conditions, improving the varieties based on the test results, and regularly testing candidate markers.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] (1) The SSR molecular markers screened by the present invention are highly polymorphic, that is, the number of repetitions in these regions varies between different individuals or strains. This enables SSR markers to effectively distinguish different individuals or strains, providing a powerful tool for genetic diversity analysis. The present invention successfully screened out 4 pairs of polymorphic primers from 81 pairs of SSR molecular markers, further proving the high polymorphism of SSR markers. SSR marker technology has the characteristics of good stability and repeatability, and can ensure the accuracy of experimental results. Two QTL loci closely linked to the resistance to Helminthosporium leaf spot trait were successfully located by SSR marker technology, which further verified the accuracy of SSR markers. The location of barley resistance to Helminthosporium leaf spot QTL was successfully completed in a relatively short period of time using SSR marker technology, providing timely and effective support for disease-resistant breeding. Compared with other high-throughput molecular marker technologies, SSR detection technology equipment requirements are relatively low and the cost is relatively economical. This makes SSR marker technology the preferred marker tool for small and medium-sized laboratories and scientific research projects, which helps to reduce scientific research costs. SSR markers are usually co-dominant markers, that is, the alleles of both parties can be detected at the same site. This makes SSR markers more advantageous in the construction of genetic linkage maps and gene localization. In the invention, two QTL loci closely linked to the resistance to Helminthosporium leaf spot disease were successfully located through SSR marker technology, and these loci are co-dominantly inherited, which facilitates the discovery and utilization of disease-resistant genes. The positions of QTL loci located by SSR marker technology are clear, which provides an important basis for subsequent gene cloning and functional verification. In the invention, two QTL loci (QRcs-caas-3H-1-1 and QRcs-caas-3H-1-2) located on Chr3 were successfully located, and their close linkage relationship with the resistance to Helminthosporium leaf spot disease traits was determined.

[0023] (2) The present invention selects F 2:3 DNA extraction from leaves of 40 plants in the family can ensure the representativeness of the samples and reduce the impact of accidental errors on the experimental results. Through selection, not only can the resistance of barley to Helminthosporium leaf spot be improved, but also its adaptability to other environmental factors can be enhanced to a certain extent.

[0024] (3) The present invention allocates SSR markers to different linkage groups according to genetic distance, which can ensure that closely linked markers are classified into the same linkage group, while markers with larger genetic distances are correctly allocated to different linkage groups. This helps to reveal the linkage structure in the genome and provide useful information for subsequent QTL positioning. Two QTL loci closely linked to the Helminthosporium leaf spot resistance trait were successfully located using SSR marker technology, which further verified the accuracy of SSR markers. The SSR marker technology was used to successfully complete the positioning of the barley Helminthosporium leaf spot resistance QTL in a relatively short period of time, providing timely and effective support for disease-resistant breeding.

[0025] (4) The present invention determines the position of the QTL on the genetic map according to the calculated QTL effect size, which can achieve precise positioning of the QTL, facilitate subsequent functional research and gene cloning, and use the screened Helminthosporium leaf spot disease-resistant genotypes for hybrid breeding in combination with traditional breeding methods to more quickly breed new Helminthosporium leaf spot disease-resistant barley varieties. This combines modern genetic technology with traditional breeding methods and accelerates the breeding process of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the steps for locating the QTL for resistance to Helminthosporium leaf spot in barley using the tightly linked SSR markers of the present invention. DETAILED DESCRIPTION

[0027] The present invention provides an SSR molecular marker tightly linked to a barley helminth spore leaf spot resistance QTL site, wherein the barley helminth spore leaf spot resistance QTL site is located on barley chromosome 3, and the QTL site includes QRcs-caas-3H-1-1 and / or QRcs-caas-3H-1-2; the QRcs-caas-3H-1-1 is located between the SSR molecular markers scssr25691 and GBM1094; the QRcs-caas-3H-1-2 is located between the SSR molecular markers Bmag0877 and Ebmac0541.

[0028] The present invention also provides a primer set for detecting the SSR molecular marker tightly linked to the barley helminth spore leaf spot resistance QTL site, the primer set comprising one or more of a scssr25691 forward primer and a scssr25691 reverse primer, a GBM1094 forward primer and a GBM1094 reverse primer, a Bmag0877 forward primer and a Bmag0877 reverse primer, and an Ebmac0541 forward primer and an Ebmac0541 reverse primer; the nucleotide sequence of the scssr25691 forward primer is ACGAGCTGATATCCCACGAG (SEQ ID NO.1), the nucleotide sequence of the scssr25691 reverse primer is TCCGAGCTTCTTATCTTTGG (SEQ ID NO.2); the nucleotide sequence of the GBM1094 forward primer is GGTATAATCGGCAGAAGCCA (SEQ ID NO.3); NO.3), the nucleotide sequence of the GBM1094 reverse primer is GAGGTCACAAGCTCTACGCC (SEQ ID NO.4); the nucleotide sequence of the Bmag0877 forward primer is AAAGCTCATGGTAGATCAAGA (SEQ ID NO.5), the nucleotide sequence of the Bmag0877 reverse primer is TAGTTTTCCCAAAAGCTTCTA (SEQ ID NO.6); the nucleotide sequence of the Ebmac0541 forward primer is ACGGATCTACTTTAGCTAGCA (SEQ ID NO.7), and the nucleotide sequence of the Ebmac0541 reverse primer is AAACAACCCCACACAATC (SEQ ID NO.8). The primer set of the present invention includes the above 4 pairs of specific primers, which can be used to identify QTLs related to the barley resistance to helminth spore leaf spot disease. The genotype of each individual plant in the F2:3 family can be determined by PCR amplification and electrophoresis analysis, and then the relationship between these genotypes and disease resistance is analyzed by statistical methods (such as mixed linear models).

[0029] The present invention also provides an application of the SSR molecular marker or the primer set in the QTL positioning of barley resistance to Helminthosporium leaf spot.

[0030] In the present invention, the QTL mapping of barley resistance to Helminthosporium leaf spot disease comprises the following steps:

[0031] Parent selection and breeding: barley resources are screened from the barley variety library for phenotypic disease identification, and after identification, hybridization is performed to obtain F1 generation barley seeds after additional generations;

[0032] Self-pollination recombination and DNA extraction: The F1 generation barley seeds are self-pollinated for multiple generations, and the F2 generation barley seeds obtained after multiple generations are sown again. 2:3 DNA was extracted from leaves of individual plants of the family, and barley leaf DNA data was obtained after extraction;

[0033] SSR molecular markers and screening: molecular markers are used to mark the DNA data of barley leaves. After molecular markers are completed, polymorphism analysis and screening are performed. After screening, genotype analysis is performed. SSR markers are performed based on the results of genotype analysis. After marking, SSR marker data are obtained.

[0034] Construction of genetic linkage map: Calculate the genetic distance of SSR marker data, distinguish different linkage groups according to the genetic distance, and construct the map according to different linkage groups and genetic distances. After the construction is completed, the barley genetic map is obtained;

[0035] QTL location analysis and verification: Data processing of barley genetic map, QTL detection after data processing, QTL effect estimation based on QTL detection results, marker association and verification based on QTL effect estimation results, and finally obtain candidate marker data for barley breeding for Helminthosporium leaf spot disease resistance;

[0036] Application of candidate marker data: Analyze the candidate marker data for marker-assisted selection, conduct genotype verification after the selection is completed, confirm the breeding data based on the verification results, breed barley varieties resistant to Helminthosporium leaf spot disease based on the breeding data, and conduct long-term monitoring and improvement of the breeding process.

[0037] In the present invention, the specific steps of parent selection and cultivation are preferably as follows: barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot are retrieved from the barley variety library, and the barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot are used as parents for cultivating barley; the parents for cultivating barley are subjected to phenotypic evaluation, and the phenotypic evaluation includes evaluation of resistance to Helminthosporium leaf spot, and finally the phenotypic evaluation results are saved. The resistance to Helminthosporium leaf spot is: disease index 0 is immune, 1 is highly resistant, 2 is moderately resistant, 3 is moderately susceptible, and 4 is highly susceptible. The present invention can more effectively screen out genetic variations and QTLs related to resistance to Helminthosporium leaf spot through clear parent selection, comprehensive phenotypic evaluation and clear evaluation criteria. The present invention retrieves barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot from the barley variety library as parents, and such selection directly targets the research target—resistance to Helminthosporium leaf spot. This targeted parent selection helps to more accurately locate and analyze the genetic basis of resistance to Helminthosporium leaf spot in subsequent experiments. The phenotypic evaluation covers the evaluation of resistance to Helminthosporium leaf spot. This comprehensive evaluation helps to gain a deeper understanding of the genetic characteristics and phenotypes of barley. In particular, the evaluation of resistance to Helminthosporium leaf spot is directly related to the core issue of the study. For the evaluation indicators of resistance to Helminthosporium leaf spot, the scheme provides clear quantitative standards. These standards not only help to normalize and standardize experimental operations, but also facilitate the analysis and comparison of subsequent data. Through the phenotypic evaluation of Helminthosporium leaf spot resistant barley and Helminthosporium leaf spot susceptible barley, traits with significant differences can be screened out, and then genetic linkage analysis can be performed using closely linked SSR markers. This analysis helps to determine the location of QTLs related to resistance to Helminthosporium leaf spot, providing an important basis for subsequent genetic improvement and molecular marker-assisted selection. Through clear parent selection, comprehensive phenotypic evaluation and clear evaluation criteria, genetic variations and QTLs related to resistance to Helminthosporium leaf spot can be more effectively screened out. This not only improves the efficiency of the research, but also enhances the accuracy and reliability of the results.

[0038] In the present invention, hybridization is performed after the evaluation is completed, and the hybridization preferably comprises the following steps: emasculating the parent mother of the susceptible barley variety, bagging and isolating the mother after emasculation, artificially pollinating with the pollen of the disease-resistant parent after 2-3 days, marking the parents, marking and preserving the mature seeds after the seeds mature, and finally planting the mature seeds in the next year to obtain F1 generation barley seeds.

[0039] In the present invention, after obtaining the F1 generation barley seeds, the F1 generation barley seeds are subjected to self-pollination, and the self-pollination treatment step is preferably: sowing the F1 generation barley seeds, self-pollinating, and waiting for the seeds to mature to obtain the F2 generation barley seeds; sowing the F2 generation barley seeds according to the above process to obtain the F 2:3 Identify the leaf spot of a single plant with Helminthosporium spp. 2:3DNA is extracted from leaves of individual plants of the family. The DNA extraction step is preferably as follows: the extracted leaves are placed in a mortar, and quartz sand and extraction buffer are added for grinding; the ground mixture is transferred to a centrifuge tube, and heated in a water bath at 65-75°C, and after heating, a chloroform-isoamyl alcohol mixture is added for oscillation, and after the oscillation is completed, the supernatant is taken, and isopropanol or anhydrous ethanol is added for mixing; after the mixing is completed, the supernatant is removed, and the precipitate is washed with 70% ethanol, and dried at room temperature or 37°C; after the drying treatment, the DNA is dissolved with TE buffer or sterile water; the DNA is further purified using a DNA purification kit, and then the extracted DNA is quantitatively extracted using a fluorescent quantitative PCR method; after the quantitative extraction is completed, F 2:3 DNA data of family leaves are collected and labeled as resistant and susceptible barley DNA data; finally, the quantitatively extracted DNA data is packaged into sterile centrifuge tubes for storage. The present invention adds quartz sand and extraction buffer during the grinding process to help break cells and release DNA. Heating in a water bath at 65 to 75°C can promote cell lysis and DNA release, thereby improving extraction efficiency. Oscillation of the chloroform-isoamyl alcohol mixture and mixing with isopropanol or anhydrous ethanol can help remove impurities such as proteins and polysaccharides, and further purify DNA. The use of a DNA purification kit can further remove residual impurities and improve the purity and quality of DNA. The fluorescent quantitative PCR method has the characteristics of high sensitivity and high specificity, and can accurately measure the concentration and purity of DNA from F 2:3 DNA extraction from leaf samples of 40 plants in the family can ensure the representativeness of the samples and reduce the impact of accidental errors on the experimental results.

[0040] The present invention can significantly improve the genetic homozygosity of barley seeds through self-pollination and identification. This is crucial for the subsequent use of SSR markers for genotype analysis and QTL positioning, because the homozygous genetic background can reduce genetic noise, making the QTL related to resistance to Helminthosporium leaf spot easier to detect. In a highly homozygous genetic background, the linkage relationship between the tightly linked SSR markers and the Helminthosporium leaf spot resistance QTL will be clearer. This helps to accurately determine the distance between the SSR marker and the target QTL, thereby more accurately predicting the resistance to Helminthosporium leaf spot of barley varieties. Through self-pollination, selection and identification, favorable genes related to the target trait (such as resistance to Helminthosporium leaf spot) can be quickly accumulated. This helps to accelerate the breeding process of disease-resistant barley varieties and shorten the launch time of new varieties. Using SSR markers for auxiliary selection can screen out plants with excellent resistance to Helminthosporium leaf spot at an early stage. This avoids the waste of resources caused by discovering insufficient resistance at a later stage, improves the overall efficiency of breeding, and through multiple generations of self-pollination and selection, not only can the barley's resistance to Helminthosporium leaf spot be improved, but its adaptability to other environmental factors can also be enhanced to a certain extent.

[0041] In the present invention, the specific steps of SSR molecular markers and screening are preferably as follows: according to the SSR marker technology, known SSR sites are retrieved from the barley genome database, specific primers are designed for the known SSR sites, and SSR primer data are obtained after the design is completed; the barley leaf DNA data are PCR amplified using the SSR primer data to obtain PCR products; the PCR products are detected, and after the detection is completed, the DNA samples of barley leaf DNA data with different genotypes are subjected to electrophoresis analysis at the PCR products of the same SSR site, and the allele type of each sample at each SSR site is recorded; according to the electrophoresis results, the genotype of each sample is interpreted and recorded as different allele types, and the different allele types are subjected to genotyping analysis, and after the genotyping analysis is completed, a genotype database is established; the SSR site marking and correspondence after the barley leaf DNA data detection are performed in the established genotype database, and finally the SSR marker data is obtained. In the present invention, based on the SSR marker technology, 4 pairs of primers with polymorphism were screened from 81 pairs of SSR molecular markers; it was determined that the resistance to Helminthosporium leaf spot disease in adult plants of F2:3 family barley was affected by two QTLs (QRcs-caas-3H-1-1 and QRcs-caas-3H-1-2) located on Chr3, among which QRcs.caas-3H-1-1 was located between scssr25691 and GBM1094; QRcs.caas-3H-1-2 was located between Bmag0877 and Ebmac0541, explaining phenotypic variation of 6.03 and 10.03%, respectively. Among them, QRcs-caas-3H-1-2 is a new QTL site. The present invention successfully located two QTL sites closely linked to the resistance to Helminthosporium leaf spot disease through SSR marker technology, and these sites are all co-dominant inheritance, which facilitates the mining and utilization of disease-resistant genes. In the present invention, the PCR reaction system preferably includes a DNA template, primers, dNTPs, DNA polymerase and buffer; the PCR amplification conditions preferably include denaturation, annealing and extension; the denaturation temperature is preferably 94-98°C, and the time is 30-60s, the annealing temperature is preferably confirmed based on the Tm value of the SSR primer data, and the time is 30-60s; the extension temperature is preferably 70-72°C, and the time is 1 min / KB.

[0042] The present invention retrieves known SSR sites from a barley genome database and designs specific primers, and can efficiently perform PCR amplification on a target region, thereby reducing blindness and trial-and-error costs. The design of specific primers ensures the accuracy of PCR amplification, so that each SSR site can be accurately identified and amplified. The design of the PCR reaction system is flexible and can be optimized according to different SSR primer data and DNA templates to adapt to different experimental conditions. The PCR product is detected by agarose gel electrophoresis, and multiple samples can be processed at the same time, thereby improving the detection efficiency. Electrophoresis analysis can intuitively display the allele types of different genotypes at the SSR site, which is convenient for subsequent data recording and analysis. Establishing a genotype database is helpful to systematically store and manage a large amount of SSR marker data, thereby facilitating subsequent research. Marking and corresponding SSR sites in the genotype database can ensure that each SSR site is accurately associated with its corresponding allele type. The SSR marker technology can screen out barley varieties carrying genes for resistance to Helminthosporium leaf spot disease, thereby providing a basis for breeding new disease-resistant varieties.

[0043] The SSR molecular markers screened by the present invention have high polymorphism, that is, different individuals or strains have different repetition times in these regions. This enables SSR markers to effectively distinguish different individuals or strains, and provides a powerful tool for genetic diversity analysis. The present invention successfully screened out 4 pairs of polymorphic primers from 81 pairs of SSR molecular markers, further proving the high polymorphism of SSR markers. The SSR marker technology has the characteristics of good stability and repeatability, and can ensure the accuracy of the experimental results. The present invention successfully located two QTL loci closely linked to the resistance to Helminthosporium leaf spot traits through SSR marker technology, which further verified the accuracy of SSR markers. The SSR marker technology was used to successfully complete the positioning of barley resistance to Helminthosporium leaf spot QTL in a relatively short period of time, providing timely and effective support for disease-resistant breeding. Compared with other high-throughput molecular marker technologies, SSR detection technology equipment requirements are relatively low, and the cost is relatively economical. This makes SSR marker technology the preferred marker tool for small and medium-sized laboratories and scientific research projects, which helps to reduce scientific research costs. SSR markers are usually co-dominant markers, that is, the alleles of both parties can be detected at the same site. This makes SSR markers more advantageous in the construction of genetic linkage maps and gene localization. In the invention, two QTL loci closely linked to the resistance to Helminthosporium leaf spot disease were successfully located through SSR marker technology, and these loci are co-dominantly inherited, which facilitates the discovery and utilization of disease-resistant genes. The positions of QTL loci located by SSR marker technology are clear, which provides an important basis for subsequent gene cloning and functional verification. In the invention, two QTL loci (QRcs-caas-3H-1-1 and QRcs-caas-3H-1-2) located on Chr3 were successfully located, and their close linkage relationship with the resistance to Helminthosporium leaf spot disease traits was determined.

[0044] In the present invention, the generation of the barley genetic map includes the following steps: verifying and collating the SSR marker data, and after verification and collating, using the Haldane mapping function algorithm to calculate the genetic distance between each pair of SSR marker data in the SSR marker data, and obtaining the SSR marker genetic distance after the calculation is completed; then allocating the SSR marker data to different linkages, the linkage group is a group of markers that are closely connected in genetic distance, markers with smaller genetic distances are classified into the same linkage group, and markers with larger genetic distances belong to different linkage groups; after the allocation is completed, automatic identification of the linkage groups is performed, and linkage group data is obtained after automatic identification; and a barley genetic map is generated according to the genetic distance and linkage group data. The present invention preferably uses genetic map software to construct the map, and sets the map parameters in the software, including the maximum genetic distance, the minimum recombination frequency, and the minimum and maximum number of markers of the linkage group. The genetic map software automatically assigns markers to different linkage groups according to the input parameters and genotype data, and calculates the relative positions between them. According to the results of the preliminary construction, the map is optimized, and the optimization includes adjusting the positions of the markers, re-evaluating the linkage relationship, and eliminating erroneous data; after the optimization is completed, a barley genetic map is obtained. The present invention uses genetic map software to construct the map, and sets appropriate map parameters to ensure the accuracy and flexibility of the map construction.

[0045] The present invention can ensure that the data used is accurate and reliable by verifying and collating the SSR marker data, and provide a solid foundation for subsequent calculation and analysis. This helps to reduce the analysis bias caused by data errors. The Haldane mapping function algorithm is used to calculate the genetic distance between each pair of SSR markers. This method is widely recognized in genetic research and can provide a more accurate genetic distance estimate. This helps to more accurately reflect the genetic relationship between markers. SSR markers are assigned to different linkage groups according to genetic distance, which can ensure that tightly linked markers are classified as the same linkage group, while markers with larger genetic distances are correctly assigned to different linkage groups. This helps to reveal the linkage structure in the genome and provide useful information for subsequent QTL positioning. Genetic map software is used to construct the map, and appropriate map parameters (such as maximum genetic distance, minimum recombination frequency, minimum and maximum number of markers of linkage groups) are set to ensure the accuracy and flexibility of map construction. This helps to more accurately reflect the genetic structure of the barley genome and provide a reliable basis for subsequent genetic analysis and QTL positioning. Optimization of the preliminary constructed genetic map, including adjusting the positions of markers, re-evaluating linkage relationships and eliminating erroneous data, can further improve the accuracy and reliability of the map. It is not only suitable for the QTL positioning of barley resistance to Helminthosporium leaf spot, but can also be widely used in genetic analysis and positioning research of other crops and traits.

[0046] In the present invention, a mixed linear model is preferably used to construct a statistical model for a barley genetic map, and after the statistical model is constructed, QTL analysis software is used to perform QTL detection; a significance threshold is set when performing QTL detection, wherein the significance threshold setting includes a permutation test LOD threshold; after QTL detection, the effect size of each significant QTL is calculated, and the effect size of the QTL includes additive effect, dominant effect and contribution rate to the target trait; the position of each QTL on the genetic map is determined according to the calculated effect size of the QTL; at the same time, the QTL effect estimation is subjected to interaction analysis, wherein the interaction analysis includes QTC and environment interaction analysis and QTC and QTC interaction analysis; finally, the QTL effect estimation result is obtained; according to the QTL effect estimation result, the SSR marker that is most resolved with the QTL effect estimation result is associated; after the association is completed, verification is performed, and the verification includes independent sample verification, marker-assisted verification and statistical verification; according to the verification result, data that performs consistently under different conditions and is significantly correlated with the target trait is marked, and after the marking is completed, candidate marker data for barley breeding against Helminthosporium leaf spot disease is obtained. The present invention determines the position of a QTL on a genetic map according to the calculated QTL effect size, and can achieve fine positioning of the QTL, which is helpful for subsequent functional research and gene cloning.

[0047] The present invention constructs a statistical model through a mixed linear model, which can more accurately consider genetic variation and environmental factors, thereby improving the accuracy of QTL positioning. The permutation test is used to set the LOD threshold, which can ensure the reliability of the significance test and reduce the occurrence of false positive results. The additive effect, dominant effect and contribution rate of each significant QTL to the target trait are calculated, which is helpful for a comprehensive understanding of the genetic effect of the QTL and provides important information for subsequent breeding work. The position of the QTL on the genetic map is determined according to the calculated QTL effect size, which can achieve fine positioning of the QTL, which is helpful for subsequent functional research and gene cloning. QTC (quantitative trait locus and environment interaction) and QTC×QTC interaction analysis are performed, which can reveal complex genetic interaction relationships and provide a deeper perspective for understanding the genetic basis of traits. Through multiple methods such as independent sample verification, marker-assisted verification and statistical verification, it can be ensured that the discovered QTLs perform consistently under different conditions and are significantly correlated with the target trait, thereby enhancing the reliability of the results. By applying candidate markers to the breeding practice of barley resistance to Helminthosporium leaf spot, it can guide the selection of barley varieties with excellent resistance and improve breeding efficiency and accuracy.

[0048] In the present invention, the specific steps of applying the candidate marker data are preferably as follows: performing correlation analysis on the candidate marker data, confirming the association between each candidate marker and the helminth spore leaf spot resistance trait, and obtaining representative sample varieties resistant to helminth spore leaf spot and susceptible to helminth spore leaf spot after the confirmation; performing genotype analysis on the representative sample varieties, obtaining the performance of each representative sample variety in different genotypes after the analysis, and screening out the genotype with the helminth spore leaf spot resistance trait as breeding material according to the genotype analysis results, and recording the phenotypic data of the screened helminth spore leaf spot resistance genotype; using the screened helminth spore leaf spot resistance genotype for hybrid breeding, combining with traditional breeding methods, cultivating new barley varieties; conducting multi-year multi-point tests on the cultivated helminth spore leaf spot resistance barley varieties, observing the disease resistance under different environmental conditions, improving the varieties according to the test results, and regularly detecting the candidate markers. The present invention uses the screened helminth spore leaf spot resistance genotype for hybrid breeding, combined with traditional breeding methods, and can cultivate new helminth spore leaf spot resistance barley varieties more quickly.

[0049] The present invention can accurately confirm the association between each candidate marker and the helminth spore leaf spot resistance trait by performing correlation analysis on candidate marker data. This accuracy helps to improve the accuracy of QTL positioning, thereby more accurately identifying the gene region related to the helminth spore leaf spot resistance, and the genotype analysis of the representative sample variety enables breeders to screen out the genotype with the helminth spore leaf spot resistance trait as breeding material. This not only improves the breeding efficiency, but also ensures the genetic quality of the breeding material, lays the foundation for cultivating excellent helminth spore leaf spot resistance barley varieties, and uses the screened helminth spore leaf spot resistance genotype for hybrid breeding, combined with traditional breeding methods, and can cultivate new helminth spore leaf spot resistance barley varieties more quickly. This strategy combining modern genetic technology and traditional breeding methods accelerates the breeding process of new varieties, not only provides a practical technical path for barley helminth spore leaf spot resistance breeding, but also promotes the development of related genetic markers and breeding technologies. With the deepening of research and the continuous innovation of technology, these technologies will play an increasingly important role in the field of barley disease-resistant breeding. Through accurate genetic markers and genotype analysis, breeders can use resources more effectively and reduce production costs. At the same time, because new varieties have stronger disease resistance and adaptability, they can reduce the risk of disease in actual production and increase farmers' income.

[0050] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0052] Example 1

[0053] S1: Parent selection and generation: The barley varieties are phenotypically evaluated, and after the evaluation is completed, hybridization is performed to obtain F1 generation barley seeds;

[0054] S2: Self-pollination and DNA extraction: The F1 generation barley seeds are self-pollinated for multiple generations, and the F2 generation barley seeds obtained after multiple generations are sown and the obtained F 2:3 DNA was extracted from leaves of individual plants of the family, and barley leaf DNA data was obtained after extraction;

[0055] S3: SSR molecular markers and screening: molecular markers are used to mark the DNA data of barley leaves. After molecular markers are completed, polymorphism analysis and screening are performed. After screening, genotype analysis is performed. SSR markers are performed according to the results of genotype analysis. After marking, SSR marker data are obtained.

[0056] S4: Construction of genetic linkage map: Calculate the genetic distance of SSR marker data, distinguish different linkage groups according to the genetic distance, construct a map according to different linkage groups and genetic distances, and obtain a barley genetic map after the construction is completed;

[0057] S5: QTL location analysis and verification: Data processing is performed on the barley genetic map, and QTL detection is performed after the data processing is completed. QTL effect estimation is performed based on the QTL detection results, and marker association and verification are performed based on the QTL effect estimation results, and finally candidate marker data for barley breeding for resistance to Helminthosporium leaf spot disease are obtained;

[0058] S6: Application of candidate marker data: Analyze candidate marker data for marker-assisted selection, conduct genotype verification after selection, confirm breeding data based on verification results, breed barley varieties resistant to Helminthosporium leaf spot based on breeding data, and conduct long-term monitoring and improvement of the breeding process. See the flowchart for details. Figure 1 .

[0059] The method of performing phenotypic evaluation on barley varieties in step S1 includes: retrieving barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot from a barley variety library, and using the barley varieties resistant to Helminthosporium leaf spot and the barley varieties susceptible to Helminthosporium leaf spot as parents of selected barley; performing phenotypic evaluation on the selected barley parents, wherein the phenotypic evaluation is an evaluation of resistance to Helminthosporium leaf spot; the resistance to Helminthosporium leaf spot is as follows: a disease index of 0 for immunity, 1 for high resistance, 2 for medium resistance, 3 for medium sensitivity, and 4 for high sensitivity; and finally saving the phenotypic evaluation result.

[0060] After the evaluation in step S1 is completed, hybridization is performed, and after the hybridization is completed, additional generation is performed, including: hybridization of the breeding barley parents that have completed the phenotypic evaluation and passed the evaluation;

[0061] The hybridization process comprises the following steps: emasculating the susceptible barley parent, bagging and isolating the plant, artificially pollinating the plant with pollen from the disease-resistant parent 2-3 days later, marking the parents, marking and preserving the mature seeds after they mature, and finally planting the mature seeds in the next year to obtain F1 generation barley seeds.

[0062] In S2, the F1 generation barley seeds are self-pollinated to obtain the F2 generation barley seeds, and the F2 generation seeds are sown. 2:3 The method for identifying the leaf spot disease of a single plant of a family includes: self-pollinating the F1 generation barley seeds for generation; the self-pollination treatment steps are: sowing the F1 generation barley seeds, self-pollinating for generation, and waiting for the seeds to mature to obtain the F2 generation barley seeds; sowing the F2 generation barley seeds according to the above process to obtain the F 2:3 Identification of single plant Helminthosporium leaf spot disease was carried out.

[0063] For S2 Lieutenant General F 2:3 DNA was extracted from leaves of individual plants of the family, including: 2:3 DNA is extracted from leaf samples of each individual plant in the identification results of the family; the leaves for DNA extraction are placed in a mortar, and quartz sand and extraction buffer are added for grinding; the ground mixture is transferred to a centrifuge tube and heated in a water bath at 65-75°C, and after heating, a chloroform-isoamyl alcohol mixture is added for oscillation, and after the oscillation is completed, the supernatant is taken, and isopropanol or anhydrous ethanol is added for mixing; after the mixing is completed, the supernatant is removed, and the precipitate is washed with 70% ethanol, and dried at room temperature or 37°C; after the drying treatment, the DNA is dissolved with TE buffer or sterile water; the DNA is further purified using a DNA purification kit, and then the extracted DNA is quantitatively extracted using a fluorescent quantitative PCR method; after the quantitative extraction is completed, F 2:3 The DNA data of the family leaves are collected and marked as resistant and susceptible barley DNA data; finally, the quantitatively extracted DNA data are packaged into sterile centrifuge tubes for storage.

[0064] In S3, the barley leaf DNA data is molecularly marked, and polymorphism analysis and screening are performed after the molecular marking is completed. After the screening is completed, genotype analysis is performed, and SSR marking is performed according to the results of the genotype analysis, including: according to the SSR marker technology, known SSR loci are retrieved from the barley genome database, and specific primers are designed for the known SSR loci. After the design is completed, SSR primer data is obtained; and the barley leaf DNA data is PCR amplified using the SSR primer data. The PCR reaction system includes a DNA template, primers, dNTPs, DNA polymerase and buffer; when performing PCR amplification, the PCR amplification conditions are confirmed, and the PCR amplification conditions include denaturation, annealing and extension, the denaturation temperature is between 94 and 98°C, the time is 30 to 60 seconds, the annealing temperature is confirmed according to the Tm value of the SSR primer data, the time is 30 to 60 seconds, and the extension temperature is about 72°C, and the time is 1 minute / KB; after the PCR amplification of the barley leaf DNA data is completed, the PCR product is obtained; the PCR product is detected by agarose gel electrophoresis, and after the detection is completed, the DNA samples of the barley leaf DNA data of different genotypes are subjected to electrophoresis analysis of the PCR products at the same SSR site, and the allele type of each sample at each SSR site is recorded; according to the electrophoresis result, the genotype of each sample is interpreted and recorded as different allele types, and the different allele types are subjected to genotype analysis, and after the genotype analysis is completed, a genotype database is established; the SSR site markers and correspondences after the barley leaf DNA data detection are carried out in the established genotype database; and finally the SSR marker data is obtained.

[0065] The method of retrieving known SSR loci from a barley genome database according to the SSR marker technology also includes: based on the SSR marker technology, screening out 4 pairs of primers with polymorphism from 81 pairs of SSR molecular markers; determining F 2:3 The resistance of barley to Helminthosporium leaf spot at the adult stage was controlled by two QTLs (QRcs-caas-3H-1-1 and QRcs-caas-3H-1-2) located on Chr3, among which QRcs.caas-3H-1-1 was located between scssr25691 and GBM1094; QRcs.caas-3H-1-2 was located between Bmag0877 and Ebmac0541, explaining 6.03 and 10.03% of the phenotypic variation, respectively.

[0066] The specific primer sets included scssr25691 forward primer and scssr25691 reverse primer, GBM1094 forward primer and GBM1094 reverse primer, Bmag0877 forward primer and Bmag0877 reverse primer, and Ebmac0541 forward primer and Ebmac0541 reverse primer;

[0067] The nucleotide sequence of the scssr25691 forward primer is ACGAGCTGATATCCCACGAG (SEQ ID NO.1), and the nucleotide sequence of the scssr25691 reverse primer is TCCGAGCTTCTTATCTTTGG (SEQ ID NO.2); the nucleotide sequence of the GBM1094 forward primer is GGTATAATCGGCAGAAGCCA (SEQ ID NO.3), and the nucleotide sequence of the GBM1094 reverse primer is GAGGTCACAAGCTCTACGCC (SEQ ID NO.4); the nucleotide sequence of the Bmag0877 forward primer is AAAGCTCATGGTAGATCAAGA (SEQ ID NO.5), and the nucleotide sequence of the Bmag0877 reverse primer is TAGTTTTCCCAAAAGCTTCTA (SEQ ID NO.6); the nucleotide sequence of the Ebmac0541 forward primer is ACGGATCTACTTTAGCTAGCA (SEQ ID NO.7), and the nucleotide sequence of the Ebmac0541 reverse primer was AAACAACCCCACACAATC (SEQ ID NO.8).

[0068] In S4, the genetic distance of SSR marker data is calculated, different linkage groups are distinguished according to the genetic distance, and the map is constructed according to different linkage groups and genetic distances, including: verifying and sorting the SSR marker data, and after verification and sorting, the genetic distance between each pair of SSR marker data in the SSR marker data is calculated using the Haldane mapping function algorithm, and the SSR marker genetic distance is obtained after the calculation; then the SSR marker data is allocated to different linkages, and the linkage group is a group of markers that are closely connected in genetic distance. Markers with smaller genetic distances are classified into the same linkage group, while markers with larger genetic distances belong to different linkage groups; allocation is completed Then the linkage group is automatically identified, and the linkage group data is obtained after automatic identification; a barley genetic map is generated according to the genetic distance and the linkage group data. The barley genetic map generation process includes using genetic map software to construct the map, setting the map parameters in the software, and the map parameters include the maximum genetic distance, the minimum recombination frequency, and the minimum and maximum number of markers of the linkage group. The genetic map software automatically assigns markers to different linkage groups according to the input parameters and genotype data, and calculates the relative position between them. According to the results of the preliminary construction, the map is optimized, and the optimization includes adjusting the position of the markers, re-evaluating the linkage relationship and eliminating erroneous data; after the optimization is completed, a barley genetic map is obtained.

[0069] According to S5, the barley genetic map is processed, QTL detection is performed after the data processing is completed, QTL effect estimation is performed based on the QTL detection results, and marker association and verification are performed based on the QTL effect estimation results, including: using a mixed linear model to construct a statistical model for the barley genetic map, and after the statistical model is constructed, QTL detection is performed using QTL analysis software; when performing QTL detection, a significance threshold is set, wherein the significance threshold setting includes a permutation test LOD (log likelihood ratio) threshold; after QTL detection, the effect size of each significant QTL is calculated, and the effect size of the QTL includes additive effect, dominant effect and contribution rate to the target trait; according to The calculated effect size of QTL determines the position of each QTL on the genetic map; at the same time, the QTL effect estimation is subjected to interaction analysis, wherein the interaction analysis includes QTC and environment interaction analysis and QTC and QTC interaction analysis; finally, the QTL effect estimation result is obtained; based on the QTL effect estimation result, the SSR marker that is most resolved with the QTL effect estimation result is associated; after the association is completed, verification is performed, and the verification includes independent sample verification, marker-assisted verification and statistical verification; based on the verification results, the data that perform consistently under different conditions and are significantly correlated with the target trait are marked, and after the marking is completed, the candidate marker data for barley breeding against Helminthosporium leaf spot disease is obtained.

[0070] In S6, the candidate marker data are analyzed for marker-assisted selection, and genotype verification is performed after the selection is completed. The breeding data is confirmed according to the verification results, and barley varieties resistant to Helminthosporium leaf spot disease are bred according to the breeding data, and the breeding process is monitored and improved for a long time, including: correlation analysis is performed on the candidate marker data, and the correlation analysis is to confirm the association between each candidate marker and the Helminthosporium leaf spot disease resistance trait, and after the confirmation is completed, representative sample varieties resistant to Helminthosporium leaf spot disease and susceptible to Helminthosporium leaf spot disease are obtained; genotype analysis is performed on the representative sample varieties, and after the analysis is completed, each representative sample variety is obtained. The performance of this variety in different genotypes, and based on the results of genotype analysis, genotypes with resistance to Helminthosporium leaf spot disease were screened out as breeding materials. At the same time, the phenotypic data of the screened Helminthosporium leaf spot disease resistant genotypes were recorded; hybrid breeding was carried out using the screened Helminthosporium leaf spot disease resistant genotypes, combined with traditional breeding methods, to cultivate new barley varieties; multi-year multi-point tests were conducted on the cultivated Helminthosporium leaf spot disease resistant barley varieties to observe the disease resistance and yield performance under different environmental conditions, and the varieties were improved according to the test results, and candidate markers were tested regularly.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An SSR molecular marker tightly linked to a QTL locus for resistance to barley Helminthosporium leaf spot, characterized in that: The barley resistance to helminth spore leaf spot QTL site is located on barley chromosome 3, and the QTL site includes QRcs-caas-3H-1-1 and / or QRcs-caas-3H-1-2; the QRcs-caas-3H-1-1 is located between the SSR molecular markers scssr25691 and GBM1094; the QRcs-caas-3H-1-2 is located between the SSR molecular markers Bmag0877 and Ebmac0541.

2. A primer set for detecting the SSR molecular marker tightly linked to the barley helminth leaf spot resistance QTL locus according to claim 1, characterized in that: The primer set includes one or more of a scssr25691 forward primer and a scssr25691 reverse primer, a GBM1094 forward primer and a GBM1094 reverse primer, a Bmag0877 forward primer and a Bmag0877 reverse primer, and an Ebmac0541 forward primer and an Ebmac0541 reverse primer; the nucleotide sequence of the scssr25691 forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the scssr25691 reverse primer is shown in SEQ ID NO.2; the nucleotide sequence of the GBM1094 forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the GBM1094 reverse primer is shown in SEQ ID NO.4; the nucleotide sequence of the Bmag0877 forward primer is shown in SEQ ID NO.5, and the nucleotide sequence of the Bmag0877 reverse primer is shown in SEQ ID NO.6; the nucleotide sequence of the Ebmac0541 forward primer is shown in SEQ ID NO. NO.7, and the nucleotide sequence of the Ebmac0541 reverse primer is shown in SEQ ID NO.

8.

3. Use of the SSR molecular marker described in claim 1 or the primer set described in claim 2 in the QTL positioning of barley resistance to Helminthosporium leaf spot.

4. The use according to claim 3, characterized in that: The barley resistance to Helminthosporium leaf spot QTL positioning comprises the following steps: Parent selection and breeding: barley resources are screened from the barley variety library for phenotypic disease identification, and after identification, hybridization is performed to obtain F1 generation barley seeds after additional generations; Self-pollination recombination and DNA extraction: The F1 generation barley seeds are self-pollinated for multiple generations, and the F2 generation barley seeds obtained after multiple generations are sown again. 2:3 DNA was extracted from leaves of individual plants of the family, and barley leaf DNA data was obtained after extraction; SSR molecular markers and screening: molecular markers are used to mark the DNA data of barley leaves. After molecular markers are completed, polymorphism analysis and screening are performed. After screening, genotype analysis is performed. SSR markers are performed based on the results of genotype analysis. After marking, SSR marker data are obtained. Construction of genetic linkage map: Calculate the genetic distance of SSR marker data, distinguish different linkage groups according to the genetic distance, and construct the map according to different linkage groups and genetic distances. After the construction is completed, the barley genetic map is obtained; QTL location analysis and verification: Data processing of barley genetic map, QTL detection after data processing, QTL effect estimation based on QTL detection results, marker association and verification based on QTL effect estimation results, and finally obtain candidate marker data for barley breeding for Helminthosporium leaf spot disease resistance; Application of candidate marker data: Analyze the candidate marker data for marker-assisted selection, conduct genotype verification after the selection is completed, confirm the breeding data based on the verification results, breed barley varieties resistant to Helminthosporium leaf spot disease based on the breeding data, and conduct long-term monitoring and improvement of the breeding process.

5. The use according to claim 4, characterized in that: The barley resources include barley varieties resistant to Helminthosporium leaf spot and barley varieties susceptible to Helminthosporium leaf spot.

6. The use according to claim 4, characterized in that: The hybridization process comprises the following steps: emasculating the parent mother of the susceptible barley variety, bagging and isolating the emasculated mother, artificially pollinating with the pollen of the disease-resistant parent 2-3 days later, marking the parents, and marking and preserving the mature seeds after the seeds mature.

7. The use according to claim 4, characterized in that: The SSR molecular marker and screening also includes the following steps: retrieving known SSR loci from the barley genome database, designing specific primers for the known SSR loci, and obtaining SSR primer data after the design is completed; The barley leaf DNA data was amplified by PCR using the SSR primer data to obtain PCR products; The PCR products are tested, and after the testing is completed, the PCR products of the DNA samples of the barley leaf DNA data of different genotypes at the same SSR locus are subjected to electrophoresis analysis, and the allele type of each sample at each SSR locus is recorded; According to the electrophoresis results, the genotype of each sample is interpreted and recorded as different allele types. The different allele types are subjected to genotype analysis. After the genotype analysis is completed, a genotype database is established. The SSR site markers and correspondences after the barley leaf DNA data detection are performed in the established genotype database to finally obtain the SSR marker data.

8. The use according to claim 4, characterized in that: The generation of the barley genetic map comprises the following steps: verifying and collating the SSR marker data, and after verification and collating, using the Haldane mapping function algorithm to calculate the genetic distance between each pair of SSR marker data in the SSR marker data, and obtaining the SSR marker genetic distance after the calculation is completed; then allocating the SSR marker data to different linkages, the linkage group being a group of markers that are closely connected in genetic distance, markers with smaller genetic distances are classified into the same linkage group, and markers with larger genetic distances belong to different linkage groups; after the allocation is completed, automatic identification of the linkage groups is performed, and linkage group data is obtained after automatic identification; and a barley genetic map is generated according to the genetic distance and linkage group data.

9. The use according to claim 4, characterized in that: When performing QTL detection, a significance threshold is set, and the significance threshold setting includes a permutation test LOD threshold; after QTL detection, the effect size of each significant QTL is calculated, and the QTL effect size includes additive effect, dominant effect and contribution rate to the target trait; the position of each QTL on the genetic map is determined according to the calculated QTL effect size.

10. The use according to claim 4, characterized in that: The application of the candidate marker data also includes the following steps: performing correlation analysis on the candidate marker data to confirm the association between each candidate marker and the helminth spore leaf spot resistance trait, and obtaining representative sample varieties resistant to helminth spore leaf spot and susceptible to helminth spore leaf spot after the confirmation is completed; performing genotype analysis on the representative sample varieties, and obtaining the performance of each representative sample variety in different genotypes after the analysis is completed, and based on the genotype analysis results, screening out genotypes with helminth spore leaf spot resistance traits as breeding materials, and at the same time, recording the phenotypic data of the screened helminth spore leaf spot resistance genotypes; using the screened helminth spore leaf spot resistance genotypes for hybrid breeding, combined with traditional breeding methods, to cultivate new barley varieties; conducting multi-year multi-point tests on the cultivated helminth spore leaf spot resistance barley varieties to observe disease resistance under different environmental conditions, improving the varieties based on the test results, and regularly testing candidate markers.

Images