Construction of artificial multicellular system and application of artificial multicellular system in nitrogen reduction

Abstract

The invention discloses construction of an artificial multicellular system and application of the artificial multicellular system in nitrogen reduction, and belongs to the technical field of fermentative degradation. According to the artificial multi-cell system constructed by the method disclosed by the invention, a direct ammoxidation gene dnfABC is over-expressed by adopting Shinella zoogloeoides ATCC19623, and a urea degradation gene cluster ureDABCJEFG is over-expressed by adopting Paracoccus denrificans DYTN-1; the constructed recombinant bacteria are independently or jointly used for nitrogen reduction. According to the method, the synergistic effect of microorganisms in the nitrogen degradation process is utilized, the artificial multicellular system meeting the nitrogen pollution wastewater treatment requirement is developed, the degradation effect and the process stability are remarkably improved, and rapid degradation of nitrogen is achieved.

Description

Technical Field

[0001] The invention relates to the construction of an artificial multi-cell system and its application in nitrogen reduction, belonging to the technical field of fermentation degradation. Background Art

[0003] In the past 20 years, there have been a lot of studies on the degradation of nitrogen, covering various processes included in chemical denitrification, physical denitrification and biological denitrification. However, physical and chemical methods have high requirements for equipment, high cost, high energy consumption, and easy to produce secondary pollution. In comparison, biological denitrification technology has become the most studied, widely used and most promising denitrification technology with its advantages of simple operation, economy, high efficiency and environmental protection. At present, environmentally friendly bacteria isolated from the environment, such as Pseudomonas and Bacillus, have been used as chassis cells to study the degradation of petroleum, pesticide pollutants and eutrophication pollutants. Paracoccus denitrificans isolated from activated sludge is an environmentally friendly strain with good denitrification ability. It can carry out denitrification under both anaerobic and aerobic conditions. Artificial multicellular systems have a strong environmental response mechanism and can achieve high-efficiency removal of pollutants under low cellular metabolic loads with definability and controllability. The use of artificial multicellular system bioremediation technology has the advantages of low maintenance cost, good performance, and reduced sewage generation. It is used in sewage denitrification in environmental remediation, but research on the application of artificial multicellular systems in sewage denitrification is still in its infancy. Summary of the invention

[0004] The purpose of the present invention is to utilize the definability and controllability of artificial multicellular systems to decompose metabolic pathways and achieve efficient denitrification under low cellular metabolic loads. It has broad application potential in the biological purification treatment of industrial wastewater, marine aquaculture wastewater and domestic sewage.

[0005] The present invention provides a recombinant microorganism that can utilize nitrogen, which is (a) and / or (b):

[0006] (a) Recombinant Shinella azogloeoides overexpressing the direct ammonia oxidation gene cluster dnfABC;

[0007] (b) Recombinant Paracoccus denitrificans overexpressing the urea degradation gene cluster ureDABCJEFG.

[0008] In one embodiment, the recombinant Shinella azoogloeoides uses Shinella azoogloeoides ATCC 19623 as a host.

[0009] In one embodiment, the recombinant Paracoccus denitrifying bacteria uses Paracoccus denitrifying bacteria DYTN-1 as a host, and the Paracoccus denitrifying bacteria DYTN-1 has been disclosed in patent publication number CN106754576B.

[0010] In one embodiment, the promoter P 07370 , promoter P 08395 , promoter P 13560 , promoter P 15910 or promoter P 07680 Regulates the expression of the direct ammonia oxidation gene cluster dnfABC.

[0011] In one embodiment, the recombinant Zoogloea schenckiae is produced in Zoogloea schenckiae ATCC 19623 using a high strength promoter P 07370 or medium strength promoter P 08395 Overexpression of dnfABC.

[0012] In one embodiment, the promoter P 1851 The fragment regulates the expression of the urea degradation gene cluster ureDABCJEFG.

[0013] In one embodiment, the direct ammonia oxidation gene cluster dnfABC is derived from Alcaligenes ammonioxydans HO-1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0014] In one embodiment, the urea degradation gene cluster ureDABCJEFG, the nucleotide sequence is shown in SEQ ID NO.2.

[0015] In one embodiment, the promoter P 07370 The nucleotide sequence of the promoter is shown in SEQ ID NO.3. 08395 The nucleotide sequence of the promoter is shown in SEQ ID NO.4; 13560 The nucleotide sequence of the promoter is shown in SEQ ID NO.5; 15910 The nucleotide sequence of the promoter is shown in SEQ ID NO.6; 1851 The nucleotide sequence is shown in SEQ ID NO.8.

[0016] The present invention also provides a microbial preparation containing the recombinant microorganism.

[0017] In one embodiment, the microbial preparation contains living cells of the recombinant Zoogloeosporium schenkelii and the recombinant Paracoccus denitrificans.

[0018] The present invention also provides the use of the recombinant microorganism or the microbial preparation in reducing nitrogen in the environment.

[0019] In one embodiment, the application is to introduce the recombinant microorganism or the microbial preparation into a water environment to be treated.

[0020] In one embodiment, the concentration of ammonia nitrogen and urea nitrogen in the water to be treated is ≥ 1 g / L.

[0021] In one embodiment, the bacterial concentration of the recombinant microbial cells in the water environment to be treated is ≥ 2×10 6 CFU / mL.

[0022] In one embodiment, the application is to culture the recombinant Zoogloeosporium schenkelii overexpressing the direct ammonia oxidation gene cluster dnfABC and the recombinant Paracoccus denitrificans overexpressing the urea degradation gene cluster ureDABCJEFG in the water environment to be treated for 24h to 72h.

[0023] Beneficial effects:

[0024] (1) The present invention uses a gradient promoter to overexpress dnfABC in Zoogloeosporium schenkelii, adds the same amount of denitrifying bacteria, and measures the ammonia nitrogen degradation efficiency of the single-cell system and the multi-cell system overexpressing dnfABC by the gradient promoter. It is clear that the use of a medium-strength promoter to overexpress dnfABC and the multi-cell system helps to improve the ammonia nitrogen degradation efficiency.

[0025] (2) The present invention also measured the urea degradation efficiency of the single-cell system and the multi-cell system overexpressing ureDAJBCEFG in Denitrifying Paracoccus, and clarified that the multi-cell system helps to improve the urea degradation efficiency.

[0026] (3) The present invention provides a theoretical reference for the application of multicellular systems to reduce nitrogen. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The changes of ammonia nitrogen content in the gradient promoter overexpressing dnfABC;

[0028] Figure 2 The changes of ammonia nitrogen content in single cell and multi-cell system overexpressing dnfABC with gradient promoter;

[0029] Figure 3 The 72-hour ammonia nitrogen removal rate of single cells and multi-cell systems overexpressing dnfABC with a gradient promoter;

[0030] Figure 4 The changes of ammonia nitrogen content in overexpressing ureDAJBCEFG;

[0031] Figure 5 is the 72h urea removal rate of overexpressed ureDAJBCEFG. DETAILED DESCRIPTION

[0032] The specific implementation modes of the present invention are further explained in detail below through the description of embodiments, so as to help those skilled in the art to have a more complete, accurate and in-depth understanding of the inventive concept and technical solution of the present invention.

[0033] (1) Strains and plasmids

[0034] Table 1 Strains and plasmids used in this study

[0035]

[0036] (2) Molecular biology operations

[0037] DNA gel recovery, PCR product purification, and plasmid extraction were performed in accordance with the instructions for the corresponding kits of Sangon Biotech (Shanghai) Co., Ltd. The Gibson Assembly reaction system and conditions were performed in accordance with the instructions for the Gibson Assembly kit of New England Biotechnology (Beijing) Co., Ltd. The PCR reaction system and conditions and the recombination ligation system and conditions were respectively performed in accordance with the instructions for use of the corresponding products of Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0038] (3) Preparation and transformation of E. coli competent cells

[0039] Preparation of competent cells:

[0040] ① The wild-type strain in the bacterial preservation tube was activated by streaking on the plate, and a single colony was picked and inoculated into 5 mL of LB medium for further activation. The culture was then continued at 250 r·min-1 and 37°C overnight.

[0041] ② Transfer the second activated seed liquid to fresh 50mL LB medium at a 2% inoculum volume, culture until OD600 reaches 0.4-0.6, and place on ice for 15-30 minutes.

[0042] ③ Use a pre-cooled refrigerated centrifuge to collect the bacteria by centrifugation at 4°C, 5000r·min-1 for 10 min, and resuspend the bacteria with pre-cooled 0.1mol·L-1CaCl2 sterile solution and place on ice for 30 min.

[0043] ④Repeat step ③ and collect the bacteria by centrifugation again.

[0044] ⑤ Resuspend the bacteria in equal proportions with pre-cooled 0.1 mol·L-1 CaCl2 sterile solution and 30% sterile glycerol (add 2 mL of CaCl2 and glycerol mixture to collect 50 mL of bacterial solution), divide into 100 μL per tube, and store at -80℃ for later use.

[0045] Recombinant transformation:

[0046] ① After slowly thawing the competent cells on ice, add 1 μg of plasmid or ligation product (calculated according to the concentration, generally not more than 10% of the competent volume), mix well and place on ice for 15 minutes.

[0047] ② After sufficient ice bath time, heat shock at 42℃ for 90s and immediately place on ice for 3-5min. Add 1mL LB medium and incubate at 37℃ for 1h.

[0048] ③ After incubation, centrifuge the bacterial solution at 5000r·min-1 to collect the bacteria, spread them on a plate containing the corresponding antibiotics, and culture them inverted at 37℃ for 12-16h.

[0049] ④ After the colonies grow, pick single colonies for PCR verification, screen positive clones for activation culture, or extract plasmids for sequencing verification or preserve the bacteria for subsequent experiments.

[0050] (4) Quantitative detection of nitrogen

[0051] Urea nitrogen and ammonia nitrogen were quantitatively detected by urease Bordeaux colorimetry and Nessler reagent spectrophotometry, respectively. Urea nitrogen (Yuanye R21721, Shanghai, China) and ammonia nitrogen (Lianhua LH-NH4, Shanghai, China) were measured using kits for the corresponding reaction treatment. All tests were carried out in strict accordance with the manufacturer's instructions. At the same time, the determination of nitrogen was carried out using standard products to draw standard curves, and then the nitrogen content of the samples was calculated based on the standard curves. Among them, in order to ensure the accuracy of the data, the bacterial solution was centrifuged at 12000r·min-1 for 10min, and the supernatant was taken for the determination of urea nitrogen and ammonium nitrogen.

[0052] Example 1 Effect of overexpression of dnfABC by gradient strength promoter on ammonia nitrogen degradation

[0053] Ammonium salt is the main nitrogen pollutant in the water environment. In order to improve the nitrogen removal efficiency, we designed, constructed and optimized the ammonia nitrogen reduction pathway in S. zoogloeoides ATCC19623. Specifically, we used promoters of different strengths: weak (P 07370 ), medium (P 08395 , P 13560 , P 15910 ) and strong (P 07680) expressed a novel ammonium nitrogen removal pathway called the "direct ammonia oxidation (Dirammox) pathway" (dnfABC), whose ammonia oxidation pathway is NH3→NH2OH→N2.

[0054] The specific steps are:

[0055] Synthetic promoter and gene sequence P 13560 -dnfABC,P 07680 -dnfABC,P 08395 -dnfABC,P 15910 -dnfABC,P 07370 -dnfABC, constructed into the multiple cloning site of plasmid pBBR1MCS2, generating plasmid pBBR1MCS2-P 15910 -dnfABC, pBBR1MCS2-P 13560 -dnfABC, pBBR1MCS2-P 07370 -dnfABC, pBBR1MCS2-P 07680 -dnfABC, pBBR1MCS2-P 08395 -dnfABC. All plasmids were constructed in E. coli JM109. The plasmids were transformed into competent cells of E. coli WM3064, cultured at 37°C for 12 hours, and the correct single clone was picked and inoculated into LB medium. Kana was added at a final concentration of 50 mg / L, and cultured at 37°C and 250 rpm for 24 hours. The plasmids were then transferred into S. zoogloeoides ATCC19623 by conjugation transfer. Among them, the promoter P 07370 The nucleotide sequence of the promoter is shown in SEQ ID NO.3. 08395 The nucleotide sequence of the promoter is shown in SEQ ID NO.4; 13560 The nucleotide sequence of the promoter is shown in SEQ ID NO.5; 15910 The nucleotide sequence is shown in SEQ ID NO.6.

[0056] Conjugative transfer of S. zoogloeoides ATCC19623:

[0057] ① After the donor bacteria E. coli WM3064 (carrying pBBR1 MCS-2) and the recipient bacteria strain S. zoogloeoides ATCC19623 used in the conjugation transfer experiment were cultured to a certain concentration, the bacteria were collected by centrifugation at 4℃ and 10000r / min for 5min.

[0058] ② Wash away the residual resistance in the culture medium with non-resistance culture medium, resuspend and mix the bacteria, and repeat once.

[0059] ③ Drop the resuspended bacterial liquid onto LB solid culture medium containing diaminopimelate and culture at 28℃ for 5-8h.

[0060] ④ Use 1 mL of ddH2O to wash and collect the bacteria from the culture plate.

[0061] ⑤ Dilute the collected bacteria at a ratio of 1:1000 and spread evenly on a solid agar plate containing kanamycin, and culture in a 28°C incubator until obvious clones grow.

[0062] The overnight LB seed solution activated by recombinant S. zoogloeoides ATCC19623 was diluted to OD 600 1, inoculated into 50 mL of M9 fermentation medium at a 2% inoculum, and added to a final concentration of 3.819 g·L -1 NH4 + Cl, corresponding concentration of antibiotics, and a final concentration of 4 g·L -1 Glycerol. Samples were taken every 12 hours for testing, and the whole fermentation process lasted for 72 hours, controlled at 30℃ and 150r·min -1 The results were as follows. Figure 1 As shown, in the first 24 h of treatment, the ammonium nitrogen removal rate of the engineered strain overexpressing the gene was higher than that of the wild type, among which the promoter P 13560 The strain overexpressing dnfABC had the lowest residual ammonium nitrogen level at 24 h, about 435 mg·L -1 , which is 81% of the wild-type strain. However, after 72 hours of treatment, the ammonium nitrogen removal rates of the engineered strain and the original strain were similar, with the largest difference in the promoter P 13560 The ammonium nitrogen removal rate of the strain overexpressing dnfABC was only 0.3% higher than that of the original strain ( Figure 1 We speculate that this may be because no genes homologous to dnfABC have been found in the genome of S. zoogloeoides ATCC19623, and dnfABC genes require the cooperation of the electron transport chain to perform their ammonia oxidation function.

[0063] Example 2 Study on the ability of multi-cell system to synergistically degrade ammonium nitrogen

[0064] In order to further improve the removal efficiency of ammonium nitrogen, we adopted the strategy of synergistic degradation of multicellular system. The S. zoogloeoides ATCC19623 engineered strain overexpressing dnfABC gene constructed in Example 1 and the original strain of P. denitrificans DYTN-1 (disclosed in the patent with publication number CN106754576B) were diluted to OD 600The strain was inoculated into 50 mL of M9 fermentation medium and a final concentration of 3.819 g·L was added. -1 NH4 + Cl, corresponding concentration of antibiotics, and a final concentration of 4 g·L -1 Glycerol. Samples were taken every 12 hours, and the whole fermentation process was 72 hours, controlled at 30℃ and 150r·min -1 The results showed that the ammonium nitrogen removal rate of the multicellular system was slightly higher than that of the corresponding single-cell system in the first 24 h, among which the high-strength promoter (P 07680 ) The multicellular system of S. zoogloeoides ATCC19623 overexpressing dnfABC increased the ammonium nitrogen removal rate by 17% compared with its single-cell system. 07370 The ammonium nitrogen removal rate of the multicellular system of S. zoogloeoides ATCC19623 overexpressing dnfABC was 10% higher than that of the single-cell system. 08395 ) The ammonium nitrogen removal efficiency of the multicellular system of S. zoogloeoides ATCC19623 overexpressing dnfABC was 12% higher than that of the single-cell system. The ammonium nitrogen removal efficiency of the multicellular systems overexpressing genes of the other promoters was similar to that of the single-cell system ( Figure 2 However, the ammonium nitrogen removal rate of the multi-cell system of S. zoogloeoides ATCC19623 engineered strain overexpressing dnfABC at 72h was slightly higher than that of the single-cell system, among which the medium-strength promoter (P 13560 ) The ammonium nitrogen removal rate of the multicellular system of the S. zoogloeoides ATCC19623 engineered strain overexpressing dnfABC was increased by 5.4% compared with that of the original strain ( Figure 3 ). In addition, the ammonium nitrogen removal rate of the original strain multi-cell culture system was also higher than that of the single-cell culture systems of the two original strains ( Figure 3 ). It is not difficult to find that the multicellular system helps to improve the removal rate of ammonium nitrogen, which may be due to the synergistic effect of the two strains of bacteria in the multicellular system.

[0065] Example 3 Study on the ability of multi-cell system to synergistically degrade urea

[0066] Urea is also a soluble organic nitrogen widely present in sewage environment. Long-term discharge of urea-containing sewage is prone to eutrophication, leading to the proliferation of algae and phytoplankton. In order to reduce urea in sewage, we used the promoter P in the P.denitrificans DYTN-1 strain.1851 The urea degradation gene cluster ureDAJBCEFG derived from its own genome was overexpressed, and its urea nitrogen removal rate was tested in a culture medium with urea as the sole nitrogen source for 72 hours.

[0067] The specific steps are as follows: using P.denitricans DYTN-1 as a template, the primer pair ure-F (CTATTGCCCGTGCGAATGCGCA) / ure-R (ATGCAGCGTAGCCGGGGGGCCGCTTCGGTCCGGCT) was used to amplify the gene fragment ure, and the primer pair P1851-F (GCTACGCTGCATTCTGATACTGCTATCCTGCCGCGGAACA) / P1851-R (TAGACTAGttgctcacatgtCATCCTCGAGCTGCTGGGTCA) was used to amplify the promoter P 1851 fragment (shown in SEQ ID NO.8), the promoter fragment and the gene fragment were separated according to P 1851 ure sequence was inserted into the multiple cloning site of plasmid pBBR1MCS2 to generate plasmid pBBR1MCS2-P 1851 -ureDAJBCEFG, the construction of plasmids was carried out in E. coli JM109. The plasmid was transformed into E. coli S17-1λpir competent cells, cultured at 37℃ for 12h-16h, the correct single clone was picked and inoculated into LB medium, kana with a final concentration of 50mg / L was added, and the plasmid was transferred into P. denitrificans DYTN-1 by conjugation transfer after cultured at 37℃ and 250rpm for 24h.

[0068] P. denitrificans DYTN-1 conjugative transfer:

[0069] ① Inoculate E. coli S17-1λpir (donor bacteria) and P. denitrificans DYTN-1 (recipient bacteria) into test tubes containing 5 mL of LB medium, and culture them overnight at 37°C, 250 r·min-1 and 30°C, 150 r·min-1, respectively.

[0070] ②On the second day, centrifuge at 5000r·min-1 for 2min to collect 108cfu·mL -1 The cells were then washed twice with LB culture medium to remove the antibiotics in the original culture medium.

[0071] ③ Transfer E. coli S17-1λpir and P. denitrificans DYTN-1 cells into the same tube at a ratio of 3:10, mix, and culture statically at 37°C for 30 minutes.

[0072] ④ Vigorously shake the mixed bacterial solution for 20 seconds to destroy the sexual pili connection between the donor bacteria and the recipient bacteria and stop gene transfer so as to screen for the formation of single colonies.

[0073] ⑤ Spread 0.1 mL of the zygotic bacteria solution on a double-resistant agar plate of spectinomycin and kanamycin, culture at 30°C for two days, pick a single colony for colony PCR verification, and screen the positive clones for activation culture.

[0074] Dilute the recombinant P. denitrificans DYTN-activated overnight LB seed stock to OD 600 1, inoculated into 50 mL of M9 fermentation medium at a 2% inoculum, and added to a final concentration of 3.819 g·L -1 NH4 + Cl, corresponding concentration of antibiotics, and a final concentration of 4 g·L -1 Glycerol. Samples were taken every 12 hours for testing, and the whole fermentation process lasted for 72 hours, controlled at 30℃ and 150r·min -1 Shake culture.

[0075] The experimental results showed that the urea nitrogen removal rate of the P.denitrificans DYTN-1 engineered strain overexpressing the urea degradation gene cluster ureDAJBCEFG was 3.3% higher than that of the original strain. At the same time, we also diluted the P.denitrificans DYTN-1 engineered strain overexpressing the ureDAJBCEFG gene and the S.zoogloeoides ATCC19623 original strain to OD 600 The urea nitrogen removal rate of the multi-cell system of the engineered strain was 6.9% higher than that of the single-cell system of the engineered strain. Figure 5 ), in addition, the urea nitrogen removal rate of the multicellular system of the engineered strain was higher than that of the single-cell system of the original strains of the two bacteria and the multicellular system of the original strains, which further demonstrated that there was a synergistic effect between the two bacteria in the multicellular system.

[0076] The urea degradation gene cluster ureDAJBCEFG can convert urea in the environment into NH3. In order to further explore the removal process of urea nitrogen, the ammonium nitrogen content in the culture medium was measured within 72 hours. The results showed that in the multicellular system of the P. denitrificans DYTN-1 engineered strain overexpressing the ureDAJBCEFG gene, the ammonium nitrogen content in the culture medium increased rapidly to 594.1 mg / L ( Figure 4 ), which was significantly higher than that of the systems under other conditions, further supporting the view that the two strains have a synergistic effect in the multicellular system.

[0077] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant microorganism capable of utilizing nitrogen, characterized in that: For (a) and / or (b): (a) Recombinant Shinella azogloeoides overexpressing the direct ammonia oxidation gene cluster dnfABC; (b) Recombinant Paracoccus denitrificans overexpressing the urea degradation gene cluster ureDABCJEFG.

2. The recombinant microorganism according to claim 1, characterized in that The recombinant Shinella zoogloeoides uses Shinella zoogloeoides ATCC 19623 as a host.

3. The recombinant microorganism according to claim 1, characterized in that The recombinant Paracoccus denitrificans uses Paracoccus denitrificans DYTN-1 as a host.

4. The recombinant microorganism according to claim 1 or 2, characterized in that Promoter P 07370 , promoter P 08395 , promoter P 13560 , promoter P 15910 or promoter P 07680 Regulates the expression of the direct ammonia oxidation gene cluster dnfABC.

5. The recombinant microorganism according to claim 1 or 3, characterized in that With promoter P 1851 The fragment regulates the expression of the urea degradation gene cluster ureDABCJEFG.

6. The recombinant microorganism according to any one of claims 1 to 5, characterized in that The nucleotide sequence of the direct ammonia oxidation gene cluster dnfABC is shown in SEQ ID NO.1; the nucleotide sequence of the urea degradation gene cluster ureDABCJEFG is shown in SEQ ID NO.

2.

7. A microbial preparation containing the recombinant microorganism according to any one of claims 1 to 6.

8. Use of the recombinant microorganism according to claim 1 or the microbial preparation according to claim 7 in reducing nitrogen in the environment.

9. A method for reducing nitrogen content in water, characterized in that: The recombinant microorganism according to claim 1 or the microbial preparation according to claim 7 is cultured in nitrogen-containing water for 24 to 72 hours.

10. The method according to claim 9, characterized in that The concentrations of ammonia nitrogen and urea nitrogen in the water to be treated are ≥1 g / L.

Images