Chaetomium aureum FF21 for promoting growth of blueberries and application of chaetomium aureum FF21

Abstract

The invention discloses chaetomium aureum FF21 for promoting blueberry growth and application of the chaetomium aureum FF21. The chaetomium aureum FF21 has a taxonomic name of Arcopilus aureum, is preserved in the China General Microbiological Culture Collection Center on September 19, 2024, and has a preservation number of CGMCC (China General Microbiological Culture Collection Center) No.41521. The chaetomium aureum FF21 has a preservation number of CGMCC No.41521. The chaetomium aureum FF21 has the functions of increasing the content of soluble sugar, SOD enzyme, PPO enzyme and total phosphorus in blueberry plants so as to achieve the effect of promoting the growth of blueberry seedlings, and has great potential of being developed into a microbial agent.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms and relates to a Chaetomium aureum FF21 for promoting the growth of blueberries and an application thereof. Background Art

[0002] Blueberry (Vaccinium uliginosum) is the common name for blue-fruited plants of the genus Vaccinium in the family Ericaceae. Wild blueberries are widely distributed throughout the world. They are mainly produced in the United States and are mainly distributed in the Greater Khingan Range and Lesser Khingan Range forest areas in China. As an emerging fruit with high economic value and health functions, the cultivation area of ​​blueberry has been greatly developed. However, most growers currently lack experience in facility cultivation of blueberries. Although tissue culture and rapid propagation systems for many blueberry varieties have been established, there are still problems such as difficulty in rooting seedlings and low survival rate of transplanting, which have become the main obstacles to large-scale tissue culture and rapid propagation of blueberry seedlings.

[0003] Blueberries are shallow-rooted plants without root hairs. Under natural conditions, they often form a mutualistic relationship with symbiotic fungi, which have the functions of enhancing plant growth potential, improving the root environment, and enhancing the resistance of plants to diseases and pests. Plant rhizosphere growth-promoting fungi are a type of beneficial fungi that grow in the rhizosphere soil of plants. They have a variety of growth-promoting mechanisms for plants, such as biological nitrogen fixation, phosphorus and potassium dissolution, production of plant hormones such as IAA, antagonism of pathogens, and induction of systemic resistance. In particular, these fungi can increase osmotic regulating substances (such as sugars) during metabolism. In addition, the organic acids produced can dissolve insoluble phosphorus in the soil and promote plant growth and development. They can also increase soil blood circulation by increasing oxidase in the soil and promote the growth of blueberry seedlings. Research on blueberry growth promotion using symbiotic fungi in the roots of blueberries is an important part of the development of the blueberry green industry. Dark Septate Endophytes (DSE) are the main group of plant endophytes. They are characterized by forming dark-colored hyphae with obvious septa after symbiosis with plant roots, and forming "microsclerotia" structures in plant cells and intercellular spaces. DSE colonizes the epidermis, cortex and even intercellular spaces of vascular tissues of healthy plant roots to form symbionts, but will not form pathological characteristics caused by pathogens in healthy root tissues. DSE has a wide host range and ecological distribution characteristics. It is mainly distributed in arid, cold and heavy metal-contaminated areas, as well as special habitats and characteristic plants. It has no host specificity and strong adaptability. DSE may have functions similar to mycorrhizal fungi and can establish a mutualistic symbiotic relationship with the host. It plays an important role in promoting plant growth, improving mineral absorption and biological disease control, and enhancing plant stress resistance.

[0004] Chaetomium aureum is a microorganism of the genus Chaetomium, a dark septate endophytic fungus, which is used to decompose cellulose, and has broad-spectrum antagonism and good stress resistance. In the past, it was mostly used for the prevention and control of pests and diseases, but there were no reports on the development of rapid growth of tissue culture seedlings, especially the promotion of the growth of blueberry seedlings. Summary of the invention

[0005] The purpose of the present invention is to provide a golden Chaetomium FF21 that promotes the growth of blueberries and its application. The golden Chaetomium FF21 of the present invention has the function of increasing plant biomass, increasing soluble sugar, SOD enzyme, PPO enzyme and total phosphorus content in plants, so as to achieve the effect of promoting the growth of blueberry seedlings.

[0006] The technical solution of the present invention: a golden Chaetomium FF21 that promotes the growth of blueberries and its application. The golden Chaetomium FF21 has the taxonomic name Arcopilus aureus, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on September 19, 2024, with the deposit number CGMCC No.41521.

[0007] The aforementioned Chaetomium aureum FF21 was obtained from blueberry roots by tissue separation method.

[0008] The aforementioned tissue separation method is carried out according to the following steps:

[0009] (1) Cleaning and disinfection: Select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, filter them with filter paper, move them to a clean bench, soak them in a 75% ethanol solution for 2-4 seconds, rinse them with sterile water for 4-6 times, then put them in 75% ethanol for disinfection for 20-40 seconds, then rinse them with sterile water for 4-6 times and dry them to obtain product A;

[0010] (2) Cultivation, separation and purification: Place the A-grade PDA culture medium in a constant temperature incubator at 28°C for 3-5 days. After dark septate hyphae grow in the culture dish, pick the edge hyphae and continue culturing in a new PDA culture dish. Repeat 3-5 times to obtain a pure culture strain, and obtain Chaetomium aureum FF21.

[0011] In the above step (1), cleaning and disinfection: select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, filter them with filter paper, move them to a clean bench, soak them in a 75% ethanol solution for 3 seconds, rinse them with sterile water for 5 times, then put them in 75% ethanol for disinfection for 30 seconds, then rinse them with sterile water for 5 times and dry them to obtain product A;

[0012] In the above step (2), the PDA medium is prepared by dissolving 200 g of potato, 20 g of glucose and 20 g of agar in 1000 mL of distilled water, and the pH is natural.

[0013] A blueberry growth promoting agent comprising the aforementioned Chaetomium aureum FF21.

[0014] The application of the aforementioned Chaetomium aureum FF21, and the application of the Chaetomium aureum FF21 in the preparation of a preparation for promoting the growth of blueberries.

[0015] A blueberry growth-promoting bacterial product, the active ingredient of the product comprising the aforementioned Chaetomium aureum FF21.

[0016] A blueberry growth-promoting bacteria product, wherein the active ingredient of the product is the aforementioned Chaetomium aureum FF21.

[0017] A method for preparing a blueberry growth-promoting bacteria product, using the aforementioned Chaetomium aureum FF21 as an active ingredient or one of the active ingredients for preparing the product.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The present invention discloses a golden Chaetomium FF21 and its application in promoting the growth of blueberries. The golden Chaetomium FF21 from the roots of blueberries is isolated and cultured by a tissue separation method, and the golden Chaetomium FF21 is back-grafted into blueberry potted seedlings. The golden Chaetomium FF21 can colonize the roots of blueberries and has no negative effect on the growth of blueberry seedlings.

[0020] 2. The results of the biomass measurement of blueberry plants by Chaetomium aureum FF21 showed that the aboveground height of blueberry seedlings increased from 28.33 cm to 36.00 cm, and the ground diameter increased from 4.71 cm to 6.92 cm; the aboveground fresh weight increased from 4.98 g to 8.61 g, the underground fresh weight increased from 1.01 g to 2.51 g, the aboveground dry weight increased from 2.13 g to 3.69 g, and the underground dry weight increased from 0.57 g to 1.18 g.

[0021] 3. The results of the measurement of physiological indicators of blueberry plants by Chaetomium aureum FF21 showed that the soluble sugar content of the aboveground part of blueberry seedlings reached 8.38 mg / g, and that of the underground part reached 15.56 mg / g; it not only increased the soluble sugar content of blueberry seedlings, but also increased the SOD enzyme, PPO enzyme and total phosphorus content of blueberry seedlings, increasing the superoxide dismutase (SOD) enzyme content in the aboveground part of blueberry seedlings from 104.72 U / g to 122.59 U / g, the polyphenol oxidase (PPO) content in the aboveground part from 95.8 U / mg to 493.8 U / mg, and the total phosphorus content from 4.58 g / kg to 5.63 g / kg.

[0022] In summary, the blueberry golden Chaetomium FF21 of the present invention can not only effectively promote blueberry biomass, but also effectively increase the soluble sugar, SOD enzyme, PPO enzyme, and total phosphorus content in blueberry seedlings, and has great potential for promoting blueberry growth and being developed into a microbial agent. Moreover, the fungus is golden Chaetomium FF21, which can be directly isolated using blueberry root tissue culture without the need to introduce additional strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 : Colony morphology (A, B) and septate hyphae (C) of FF21;

[0024] Figure 2 :ITS-based phylogenetic tree of Arcopilus aureus FF21;

[0025] Figure 3 : Colonization in the roots of blueberry tissue culture seedlings (A: blank; B: FF21);

[0026] Figure 4 :Effects of inoculation with FF21 on root growth of potted blueberry seedlings (A: blank; B: FF21);

[0027] Figure 5 : Effects of FF21 on the biomass of blueberry plants (symbol * indicates significant difference p<0.05);

[0028] Figure 6 : Effects of FF21 on the growth of blueberry plants (symbol * indicates significant difference p<0.05, ns indicates no significant difference);

[0029] Figure 7 : Effects of FF21 on root activity of blueberry plants (symbol * indicates significant difference p<0.05);

[0030] Figure 8 : Effects of FF21 on soluble sugar in blueberry plants (symbol * indicates significant difference p<0.05);

[0031] Fig. 9 : Effects of FF21 on SOD and POD activities of blueberry plants (symbol * indicates significant difference p<0.05, ns indicates no significant difference);

[0032] Fig.10 :Effect of FF21 on total phosphorus in blueberry plants (the symbol * indicates significant difference p<0.05). DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and embodiments, but they are not intended to limit the present invention.

[0034] Example 1: Tissue Isolation of Chaetomium aureum FF21

[0035] (1) Cleaning and disinfection: Select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, filter them with filter paper, move them to a clean bench, soak them in a 75% ethanol solution for 3 seconds, rinse them with sterile water for 5 times, then put them in 75% ethanol for disinfection for 30 seconds, rinse them with sterile water for 5 times and dry them to obtain product A;

[0036] (2) Cultivation, separation and purification: Place the A-grade PDA culture medium in a constant temperature incubator for 4 days. After dark septate hyphae grow in the culture dish, pick the edge hyphae and continue culturing in a new PDA culture dish. After repeating 4 times, a pure culture strain can be obtained, and Chaetomium aureum FF21 is obtained.

[0037] PDA medium formula: 200 g potato, 20 g glucose and 20 g agar dissolved in 1000 mL distilled water, pH natural.

[0038] Example 2: Tissue Isolation of Chaetomium aureum FF21

[0039] (1) Cleaning and disinfection: Select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, and then filter dry them with filter paper. Move them to a clean bench, soak them in a 75% ethanol solution for 4 seconds, rinse them with sterile water for 4 times, and then sterilize them in 75% ethanol for 40 seconds. Then rinse them with sterile water for 6 times and dry them to obtain product A.

[0040] (2) Cultivation, separation and purification: Place the A-grade PDA culture medium in a constant temperature incubator at 28°C for 5 days. After dark septate hyphae grow in the culture dish, pick the edge hyphae and continue culturing in a new PDA culture dish. Repeat this three times to obtain a pure culture strain, namely, Chaetomium aureum FF21.

[0041] PDA medium formula: 200 g potato, 20 g glucose and 20 g agar dissolved in 1000 mL distilled water, pH natural.

[0042] Example 3: Tissue Isolation of Chaetomium aureum FF21

[0043] (1) Cleaning and disinfection: Select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, and then filter dry them with filter paper. Move them to a clean bench, soak them in a 75% ethanol solution for 2 seconds, rinse them with sterile water for 6 times, and then sterilize them in 75% ethanol for 20 seconds. Then rinse them with sterile water for 4 times and dry them to obtain product A.

[0044] (2) Cultivation, separation and purification: Place the A-grade PDA culture medium in a constant temperature incubator for 3 days. After dark septate hyphae grow in the culture dish, pick the edge hyphae and continue culturing in a new PDA culture dish. Repeat 5 times to obtain a pure culture strain, and obtain Chaetomium aureum FF21.

[0045] PDA medium formula: 200 g potato, 20 g glucose and 20 g agar dissolved in 1000 mL distilled water, pH natural.

[0046] The present invention has done a lot of analysis and verification experiments, and the following are the results of the experimental research of the present invention:

[0047] 1. Isolation and identification of Chaetomium aureum FF21

[0048] 1.1 Isolation and identification of Chaetomium aureum FF21

[0049] The dark septate endophytes (DSE) were isolated and cultured from blueberry roots collected from Huaxi Gaopo Ecological Blueberry Garden, Guiyang City, Guizhou Province (106°50′14″E, 26°16′46″N) by tissue separation method. Blueberry roots with healthy surface and no lesions were selected, washed with clean water and dried, and then immersed in 75% ethanol solution for 3s in a clean bench, rinsed with sterile water 5 times, transferred to 3% (V / V) NaClO solution for disinfection for 3min, rinsed with sterile water 5 times, placed in 75% ethanol for disinfection for 30s, and then rinsed with sterile water 5 times and dried. Five blueberry root segments were placed in each PDA (200g potato, 20g glucose, 20g agar, 1000mL distilled water) culture medium, repeated 20 times, and placed in a 28℃ constant temperature incubator for 3-5d. Using the fungal colony edge picking method, fungi with typical growth morphological differences in the PDA plate culture medium were picked and transferred to the PDA culture medium, cultured in a constant temperature incubator at 28°C, and purified 3-5 times.

[0050] The colony characteristics (colony color, colony shape and edge characteristics) were observed and photographed with a camera. The mycelial morphology and spores of the strain were observed under a microscope to complete the morphological identification. The DNA of the strain was extracted using the Fungal DNA Midi Kit. The sequence of the strain was obtained using universal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3'), and the DNA was amplified by polymerase chain reaction (PCR). The PCR amplification product was directly sent to Chongqing Qingke Biological Testing Company for gel cutting, purification and sequencing.

[0051] 1.2 Isolation and identification results of Chaetomium aureum FF21

[0052] On PDA medium, the hyphae are luxuriant, the colonies are golden yellow, and red metabolites are produced, which turn the colonies and the medium red. They have septate hyphae. Figure 1 ) The ITS sequence was compared with the sequences of the same genus but different species in the Blast comparison results, and Colletotrichum fructicola was introduced as an exogenous bacterium. ClustalW in MEGA11.0 software was used for sequence alignment, and the phylogenetic tree was constructed using the neighbor-joining method in MEGA11.0. It was found that strain FF21 was located in one branch of the phylogenetic tree with a support of 100%, and was clustered into one category ( Figure 2 ); combined with the colony morphology and microscopic morphology, the DSE strain was identified as Arcopilus aureus (named as Chaetomium aureus FF21).

[0053] 2. Inoculation experiment of Chaetomium aureum FF21 on blueberry tissue culture seedlings

[0054] 2.1 Tieback test method

[0055] The isolated Chaetomium aureum FF21 was inoculated on sterile blueberry seedlings and cultured for 1 month. The colonization of the strain was observed under a microscope.

[0056] MEA liquid medium: 20 g glucose, 3 g soy peptone, 30 g malt extract powder, pH 5.4 ± 0.2. Pour 200 mL MEA liquid medium into a 500 mL conical flask and sterilize at 121°C for 20 min.

[0057] Moss culture medium: Soak dry moss in distilled water for 24 hours, then take out the moss and remove about 50% of the water in the moss. Then divide the moss into tissue culture bottles, with the amount of moss occupying about 1 / 3 of the volume of the tissue culture bottle. Then wipe the tissue culture bottle clean and set the sterilization conditions of the high-temperature and high-pressure sterilizer to 121℃ for 2 hours.

[0058] The specific method is as follows: 1 / 3 of the moss matrix is ​​sterilized in the tissue culture bottle, and the rooted blueberry tissue culture seedlings are washed and transplanted into the above tissue culture bottle, with 2 plants planted in each bottle. After one week of seedling acclimatization, 3 ml of MEA culture solution with FF21 strain block is added to the above tissue culture bottle containing sterile seedlings. The colonization of the strain is observed after 30 days.

[0059] Colonization observation: Wash the sterile seedling roots with distilled water, place them in a 10% KOH solution at 100℃ for 1h, transfer them to a plate containing lactic acid for neutralization for 10min and then transfer them to 0.5% acid fuchsin for staining for 30s, then transfer them to lactic acid glycerol liquid (lactic acid: glycerol: distilled water = 1:1:1) for decolorization, finally place them on a glass slide for pressing and observe the infection status of Chaetomium aureum FF21 under a microscope.

[0060] 2.2 Tieback test results

[0061] Compared with the control treatment, the growth of blueberry tissue culture seedlings inoculated with Chaetomium aureum FF21 was not significantly abnormal, and dark septate hyphae could be observed in the tissues of the seedlings inoculated with Chaetomium aureum FF21 ( Figure 3 ). This indicates that the strain Chaetomium aureum FF21 can colonize the roots of blueberry and has no negative effect on the growth of blueberry seedlings.

[0062] 3 Inoculation test

[0063] 3.1 Method of inoculation with Chaetomium aureum FF21

[0064] Under sterile conditions, 5 DSE cakes (d = 5 mm) were taken with a cork puncher and inoculated into a conical flask containing 100 mL of PDB after autoclaving. The flask was cultured at 28 °C and 170 rpm / min for 14 days and then crushed with a blender to make 1 × 10 6 CFU / mL of FF21 bacterial suspension.

[0065] The inoculation experiment used a one-year-old blueberry pot experiment, with a total of 2 treatments, namely the control group (CK), inoculated with FF21 bacterial suspension, 1 plant per pot, a total of 12 experimental pots. The pot experiment was carried out in a greenhouse. Healthy, disease-free, and uniformly growing blueberry seedlings were selected and inoculated using the root wound irrigation method: a sterilized scalpel was inserted into the soil near the plant to create a root wound, and each blueberry was infused with 100mL of FF21 bacterial suspension, with the seedlings inoculated with the same amount of sterile distilled water as the control group. No fertilizer was applied during the growth period, water was poured every three days, and the uniform cultivation management was harvested after 90 days.

[0066] 3.2 Effects of inoculation with Chaetomium aureum FF21 on blueberry growth

[0067] The root structure was scanned using a root scanner. The biomass was measured by weighing (dry weight and fresh weight). The drying time was 48 hours in an oven at 45°C. The plant height and ground diameter of each pot were measured using a ruler and a vernier caliper, respectively. The soluble sugar, SOD enzyme, PPO enzyme, and total phosphorus content of the blueberry seedlings were determined.

[0068] 3.2.1 Effects of inoculation with Chaetomium aureum FF21 on blueberry biomass

[0069] The blueberry seedlings grown in pots after 90 days of cultivation management in item "3.1" were found to have a similar growth-promoting effect of Chaetomium aureum FF21 on blueberry seedlings as that of tissue culture seedlings. Compared with the control, the growth-promoting effect of inoculation with FF21 on blueberry seedlings was significant ( Figure 4-10 ).

[0070] Table 1 Effects of Chaetomium aureum FF21 on the growth of blueberry tissue culture seedlings under different treatments

[0071]

[0072]

[0073] Note: Data are mean ± standard error

[0074] Results: From Figure 4-Figure 6 As can be seen from Table 1, the root growth of blueberry seedlings inoculated with Chaetomium aureum FF21 was better than that of blueberry seedlings not inoculated with Chaetomium aureum FF21.

[0075] 3.2.2 Effects of inoculation with Chaetomium aureum FF21 on root activity of blueberry plants

[0076] The root activity of the blueberry potted seedlings after 90 days of cultivation and management in item "3.1" was determined by the TTC reduction method.

[0077] Results: See Figure 7 After using Chaetomium aureum FF21, the root activity of blueberry plants reached 13.08μg / (g·h), an increase of 133.57% compared with the blank.

[0078] 3.2.3 Effects of inoculation with Chaetomium aureum FF21 on soluble sugars in blueberry plants

[0079] Take the blueberry potted seedlings after 90 days of cultivation and management in "3.1", and use the anthrone method to determine the soluble sugar content in the aboveground and underground parts of the blueberry plants.

[0080] Results: See Figure 8 After using Chaetomium aureum FF21, the soluble sugar content of the aboveground part of blueberry plants reached 15.56 mg / g, an increase of 85.68% compared with the blank, and the soluble sugar content of the underground part reached 8.48 mg / g, an increase of 88.84% compared with the blank.

[0081] 3.2.4 Effects of inoculation with Chaetomium aureum FF21 on SOD and PPO activities in blueberry plants

[0082] The blueberry potted seedlings were taken after 90 days of cultivation and management in item “3.1”, and the SOD and PPO contents in the aboveground and underground parts of the blueberry plants were determined by the nitroblue tetrazolium (NBT) photoreduction method and the catechol colorimetric method, respectively.

[0083] Table 2 Effects of Chaetomium aureum FF21 on SOD and PPO activities in blueberry seedlings

[0084]

[0085] 3.2.5 Effects of inoculation with Chaetomium aureum FF21 on total phosphorus in blueberry plants

[0086] Take the blueberry potted seedlings after 90 days of cultivation and management in "3.1" and determine the total phosphorus content of the blueberry plants using the semi-micro Kelvin method.

[0087] Results: See Fig.10 After using Chaetomium aureum FF21, the total phosphorus content of blueberry plants reached 5.63g / kg, an increase of 22.93% over the blank.

[0088] 3.3 Conclusion:

[0089] Since blueberry is a shallow-rooted plant with slow growth, this study mainly studies the growth-promoting function of endophytic fungi in blueberry. The selected strain FF21 with good growth-promoting effect and dominant species was inoculated into blueberry tissue culture seedlings to observe its inoculation effect. The results showed that the mycelial structure of endophytic fungi could be observed in the roots of blueberries inoculated with FF21, and the seedling height, ground diameter, aboveground fresh weight, underground fresh weight, aboveground dry weight and underground dry weight of the blueberry seedlings inoculated with fungi were significantly higher than those of the control treatment. The root activity of the treatment group was also significantly higher than that of the uninoculated treatment group, indicating that inoculation with FF21 can promote the growth of the root system of blueberry seedlings. The plant root system is the main organ for plants to absorb and transmit nutrients. Its growth state basically determines the ability of plants to obtain water and nutrients. Therefore, root activity is an important indicator for judging the physiological condition of plant roots. Phosphorus is a necessary nutrient element for plants during their growth and development. The absorption of phosphorus by plants is very important for the formation of fruits in the future. The phosphorus element of the blueberry seedlings in the treatment group was significantly increased, indicating that the inoculation of strain FF21 can increase the yield of blueberries in the future. When plants are under stress, the content of osmotic regulating substances in their bodies will change directly. Therefore, one of the important indicators for evaluating the metabolism and physiological state of plants is the content of soluble sugars in plants. In this study, the soluble sugar content of the treatment group was higher than that of the control group. The antioxidant enzymes in plants keep the production and removal of reactive oxygen species in their cells in a dynamic balance. In this study, inoculation with FF21 can significantly increase the content of SOD and PPO enzymes in blueberry seedlings. The above results show that inoculation with FF21 can promote the growth of blueberry seedlings, as well as increase the activity of antioxidant enzymes and the content of osmotic regulating substances in blueberry seedlings.

[0090] Sequencing results

[0091] Arcopilus aureus FF21 (Chaetomium aureum), accession number PP448084.1 CCCTGTAGAAAAGCCCTCCGTAGGGTGAACCTGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATTGTGGACGCTACCTTTTAACGTTGCTTCGGCGGGCGGCCCGCTCCCCTGGAAAGCCCCTGTGGCCGCCCGGGGCTGCGAGCCCCCCGGCCCCCCTCGCGGGGGCGCCCGCCGGAGGATACCCAACTCTTGATTATTTTAGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCAGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCC CTGAAATCCAGTGGCGGGTTCGCTGTCACCCCGAGCGTAGTAGCAATATCTCGCTCAGGGCGTGCTGCGGGCACCGGCCGTTAAAAGCTGCCTTCTGGCAACACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAATTATATAAATATAAGG。

Claims

1. A Chaetomium aureum FF21 for promoting blueberry growth and its application, characterized in that: The golden Chaetomium FF21 has the scientific name Arcopilus aureus and was deposited in the China General Microbiological Culture Collection Center on September 19, 2024 with the deposit number CGMCC No.41521.

2. The golden Chaetomium FF21 according to claim 1, characterized in that: The Chaetomium aureum FF21 was obtained from blueberry roots by tissue separation method.

3. The golden Chaetomium FF21 according to claim 2, characterized in that: The tissue separation method is carried out according to the following steps: (1) Cleaning and disinfection: Select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, filter them with filter paper, move them to a clean bench, soak them in a 75% ethanol solution for 2-4 seconds, rinse them with sterile water for 4-6 times, then put them in 75% ethanol for disinfection for 20-40 seconds, then rinse them with sterile water for 4-6 times and dry them to obtain product A; (2) Cultivation, separation and purification: Place the A-grade PDA culture medium in a constant temperature incubator at 28°C for 3-5 days. After dark septate hyphae grow in the culture dish, pick the edge hyphae and continue culturing in a new PDA culture dish. Repeat 3-5 times to obtain a pure culture strain, and obtain Chaetomium aureum FF21.

4. The golden Chaetomium FF21 according to claim 3, characterized in that: In the step (1), cleaning and disinfection: select the roots of blueberries with healthy surfaces and no disease spots, wash them with clean water, filter them with filter paper to dry them, move them to a clean bench, soak them in a 75% ethanol solution for 3 seconds, rinse them with sterile water for 5 times, then put them in 75% ethanol for disinfection for 30 seconds, then rinse them with sterile water for 5 times and absorb the water to obtain product A.

5. The Chaetomium aureum FF21 according to claim 3, characterized in that: In the step (2), the PDA culture medium is prepared by dissolving 200 g of potato, 20 g of glucose and 20 g of agar in 1000 mL of distilled water, and the pH is natural. A blueberry growth promoting agent comprising the Chaetomium aureum FF21 according to claim 1 .

7. The use of Chaetomium aureum FF21 as claimed in claim 1, characterized in that: The application of the Chaetomium aureum FF21 in preparing a preparation for promoting the growth of blueberries.

8. A blueberry growth-promoting bacteria product, characterized in that: The active ingredient of the preparation includes the Chaetomium aureum FF21 described in claim 1.

9. A blueberry growth-promoting bacteria product, characterized in that: The active ingredient of the product is the Chaetomium aureum FF21 described in claim 1.

10. A method for preparing a blueberry growth-promoting bacteria product, characterized in that: The Chaetomium aureum FF21 described in claim 1 is used as the active ingredient or one of the active ingredients for preparing the product.

Images