Bidirectional promoter from histone gene of Japanese oryzias latipe and application of bidirectional promoter

Abstract

The invention discloses a histone gene-derived bidirectional promoter for Japanese oryzias latipe and application of the histone gene-derived bidirectional promoter. The bidirectional promoter provided by the invention can simultaneously drive the expression of genes on two sides, the efficiency of a multi-gene expression system is effectively improved, the fragment is only 353 bp, is short, small and simple, is convenient to introduce in different vectors and expression systems, reduces the occupation of the vector capacity, and is higher in flexibility. The gene is derived from a histone intergene region, has relatively strong transcriptional activity, can maintain high-level expression in various cell types, and has relatively strong application advantages in gene expression in the fields of aquaculture, ecological research, fish biology and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a bidirectional promoter derived from a Japanese medaka histone gene and an application thereof. Background Art

[0002] Promoters play a key role in the regulation of gene expression and directly affect transcription efficiency. In eukaryotes, the expression of exogenous genes usually relies on vectors with unidirectional promoters. Although this method is effective, it has limitations under the demand for multi-gene expression: the construction of these vectors is time-consuming and laborious, and the use of long plasmids or multiple plasmids may increase the burden on the host. In addition, using the same or similar promoters to express multiple genes in the same plasmid may lead to co-expression inhibition between genes. Therefore, it is urgent to develop more simplified and efficient promoter elements to overcome the shortcomings of unidirectional promoters.

[0003] Bioinformatics research has found that there is a special gene arrangement in the genomes of organisms in nature: two adjacent genes are located on different chains of DNA and transcribed in opposite directions. The distance between the transcription start sites (TSS) of these two genes is usually less than 1000 base pairs, which is called a "head-to-head" arrangement. These gene pairs are called bidirectional transcription gene pairs. Since these genes share regulatory elements in the promoter region, the fragment between the TSSs usually acts as a bidirectional promoter (BDP). Bidirectional promoters are widely present in the genomes of many organisms, from bacteriophages to higher mammals. Studies have shown that they are involved in the regulation of many core biological processes such as cell cycle and DNA repair.

[0004] The sequence characteristics of bidirectional promoters are usually characterized by the lack of TATA boxes, high GC content, and rich CpG islands. Compared with unidirectional promoters, bidirectional promoters have fewer transcription factor binding sites, but certain motifs frequently appear in genes related to specific species and functions. This specificity gives bidirectional promoters species and tissue specificity when responding to biological or environmental stimuli. Since bidirectional promoters can simultaneously initiate the expression of genes on both sides, their potential for application in multi-gene co-expression systems has gradually attracted attention in recent years. Compared with artificially synthesized bidirectional promoters, natural bidirectional promoters have obvious advantages in sequence length, regulatory accuracy, and responsiveness to tissues and environments. At present, natural bidirectional promoters have been modified and applied in model organisms such as yeast and Arabidopsis, showing broad prospects.

[0005] Although the arrangement of bidirectional transcribed gene pairs shows a certain degree of evolutionary conservation among species, their sequence structure and regulatory function show significant differences in different species, especially between vertebrates and invertebrates. These differences not only reflect the effects of different evolutionary pressures, but also reveal the diversity of gene regulatory mechanisms. In-depth research on the regulatory mechanism of bidirectional promoters can not only further clarify the complexity of genome regulation, but also provide an important theoretical basis for multi-gene expression systems. As a transitional group between invertebrates and vertebrates, the study of bidirectional promoters of fish can reveal the conservation and changes of this regulatory structure during evolution. However, the current research on bidirectional promoters in fish is still relatively limited, and there is an urgent need to fill this gap through systematic research.

[0006] The Chinese patent application with application number 202310568548.5 relates to a Japanese medaka bidirectional promoter and its application, which cannot maintain high-level expression in multiple cell types. Summary of the invention

[0007] Based on this, the present invention provides a bidirectional promoter derived from a medaka histone gene and applications thereof, which solve the problems in the above-mentioned background technology.

[0008] One of the technical solutions adopted by the present invention to solve the technical problem is: providing a bidirectional promoter derived from a Japanese medaka histone gene, wherein the nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] The DNA molecule shown in SEQ ID NO: 1 is a forward sequence, named H-BDP, and has a length of 353 bp;

[0010] The DNA molecule shown in SEQ ID NO: 2 is a DNA molecule that is reverse complementary to SEQ ID NO: 1, i.e., a reverse sequence, named H-BDPr, and has a length of 353 bp;

[0011] The second technical solution adopted by the present invention to solve the technical problem is: providing an expression cassette, a recombinant vector, a transgenic cell line, a recombinant bacterium or a recombinant virus containing the above-mentioned promoter.

[0012] Preferably, the expression cassette consists of the promoter according to claim 1, a target gene transcribed by the promoter according to claim 1, and a terminator.

[0013] Preferably, the recombinant vector is pGL3-basic, pGL2-Basic, pGL4.10, or pGLuc.

[0014] Preferably, the recombinant bacteria are Escherichia coli, Bacillus subtilis, lactic acid bacteria, or yeast.

[0015] The third technical solution adopted by the present invention to solve its technical problem is: to provide the application of the bidirectional promoter derived from the Japanese medaka histone gene in constructing a eukaryotic expression vector, expressing foreign genes in fish cells or mammalian cells.

[0016] The fourth technical solution adopted by the present invention to solve its technical problem is: to provide the application of the bidirectional promoter derived from the Japanese medaka histone gene in protein induction purification, transgenic strain research or gene therapy.

[0017] The present invention has the following beneficial effects:

[0018] 1. Bidirectional activation to improve the efficiency of multi-gene expression

[0019] This fragment is a bidirectional promoter that can drive the expression of genes on both sides at the same time, effectively improving the efficiency of the multi-gene expression system. Compared with unidirectional promoters, the present invention realizes the integration of dual gene expression on a single sequence, which is suitable for systems that require synchronous or coordinated expression of multiple genes, such as biosynthesis and gene function research.

[0020] 2. The snippets are short and easy to use

[0021] The promoter fragment of the present invention is only 353 bp, which is short and concise, and is easy to introduce into different vectors and expression systems, reducing the occupation of vector capacity and being more flexible. This makes the promoter suitable for various gene editing tools (such as CRISPR / Cas system) and recombinant vectors, expanding its application scenarios.

[0022] 3. Derived from histone genes, with high transcriptional activity and wide applicability

[0023] This promoter fragment is derived from the histone intergenic region, has strong transcriptional activity, and can maintain high-level expression in a variety of cell types. The characteristics of histone gene promoters ensure their universality, making this fragment suitable for gene expression research in different species, especially in aquatic organisms and fish cells.

[0024] 4. Endogenous sources, suitable for fish systems

[0025] As an endogenous promoter derived from medaka, the promoter fragment of the present invention can better adapt to the expression environment of fish cells and reduce the inadaptability and immune response that may be caused by heterologous promoters. This feature gives it a strong advantage in gene expression in the fields of aquaculture, ecological research and fish biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a sequence alignment of the bidirectional promoter H-BDP and HY22956, where the red marked bases are differential bases.

[0027] Figure 2 This is the reporter gene plasmid map.

[0028] Figure 3 This is the H-BDP reporter gene plasmid map.

[0029] Figure 4 This is a diagram to verify the transcriptional activity of H-BDP at the cellular level.

[0030] Figure A shows the luminescence of GFP and RFP proteins observed under a fluorescence microscope 48 hours after transfection of the H-BDP reporter gene plasmid, scale bar: 100 μm.

[0031] Figure B shows the RT-qPCR method to detect the transcription levels of GFP and RFP mRNA in transfected cells.

[0032] Figure 5 This is a diagram for identifying H-BDP transcriptional activity at the embryonic level.

[0033] The H-BDP group was medaka embryos after microinjection of H-BDP reporter gene plasmid observed under a fluorescence microscope.

[0034] The NC group was the negative control group, which was injected with the reporter gene plasmid without the promoter fragment.

[0035] Figure 6 Fluorescent gene expression was detected 48 hours after SG3 cells were transfected with pTol2-H-BDP-GFP-RFP.

[0036] Figure 7 Fluorescent gene expression was detected 48 hours after SG3 cells were transfected with pTol2-HY22956-GFP-RFP.

[0037] Figure 8 Detection of reporter gene expression levels mediated by H-BDP and HY22956. ns (not significant) indicates not significant, *p<0.05.

[0038] Fig. 9 The fluorescence expression results were observed 72 hours after the H-BDP and HY22956 fragment reporter plasmids were injected into medaka embryos. NC was the negative control. DETAILED DESCRIPTION

[0039] In order to better understand the present invention, the present invention is further described in detail below in conjunction with the embodiments and drawings. However, those skilled in the art understand that the following embodiments are not limitations on the scope of protection of the present invention, and any changes and modifications made on the basis of the present invention are within the scope of protection of the present invention.

[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0041] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0042] Example 1 Construction of bidirectional promoter reporter gene plasmid

[0043] 1. Sequence Acquisition

[0044] The bidirectional promoter fragment involved in the present invention is derived from the sequence before the start codon (ATG) of a pair of adjacent medaka histone genes (ENSORLG00000024975 and ENSORLG00000030596) with opposite transcription directions. Log in to the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, obtain the medaka genome (ASM223467v1) information, and intercept the sequence interval between the ATG of the two genes (Chr1: 3747234-3747586), and download the corresponding sequence FASTA file, named H-BDP.

[0045] The sequence of H-BDP is shown in SEQ ID NO: 1:

[0046] SEQ ID NO: 1

[0047] GTTTAAGGTTCTTATCTGATTCTACAGAGAAGAGAAAGTGAGCTGCAGAGTCGCTCTGCCTGCTTTAAATGGTCGCGAGCGCGGGTCGGTTTCCTGCCAGACCAATCAGAGGACAGGCTTCCAGCAGAGCAGCGGGAGGAGACCGCCTGTAAATCAGCGGTCTTTTTGAACGGAT CTGGGTCCAATCAGCGGCTCTCATTCGGGCGCGAGGCGTCTCGTTGAGCTGCAGGAGGAGCCGCTGTCCAATCAGGATCCAGATCTGTTAAGCTGCGTCAGTTTCTCGGCGGCTTTAAGAGCAGCGAGACTCCGCTACTGAAGCAGATGATTCTGTAAAGACAGACGAGTCAGTAAA

[0048] Its reverse complementary DNA molecule, namely the reverse sequence, is named H-BDPr. The sequence of H-BDPr is shown in SEQ ID NO: 2:

[0049] SEQ ID NO: 2

[0050] TTTACTGACTCGTCTGTCTTTACAGAATCATCTGCTTCAGTAGCGGAGTCTCGCTGCTCTTAAAGCCGCCGAGAAACTGACGCAGCTTAACAGATCTGGATCCTGATTGGACAGCGGCTCCTCCTGCAGCTCAACGAGACGCCTCGCGCCCGAATGAGAGCCCGTGATTGGACCCA GATCCGTTCAAAAAGACCGCTGATTTACAGAGCGGTCTCCTCCCGCTGCTCTGCTGGAAGCCTGTCCTCTGATTGGTCTGGCAGGAAACCGACCCGCGCTCGCGACCATTTAAAGCAGGCAGAGCGACTCTGCAGCTCACTTTCTCTTCTCTGTAGAATCAGATAAGAACCTTAAAC

[0051] Although the sequence of the bidirectional promoter H-BDP of the present invention differs from the bidirectional promoter HY22956 disclosed in the previous patent application of the inventor (publication number CN116987694A) by only one base number, the difference in sequence is relatively large. For specific sequence differences, see Figure 1 , see Example 3 for the difference in activity between the two.

[0052] like Figure 1 As shown, the similarity between the two is 90.06%, with 35 base differences. 2. Construction of bidirectional promoter reporter gene plasmid

[0053] 1. In vitro amplification of the target fragment H-BDP

[0054] (1) Extraction of medaka genomic DNA

[0055] A small amount of wild-type medaka tail fin tissue was cut into a 200 μL PCR centrifuge tube, 50 μL NaOH (50 mM) was added and lysed at 95°C for 30 minutes, and then 2.5 μL Tris-HCL (1 M) was added for neutralization to obtain medaka genomic DNA for subsequent fragment amplification.

[0056] (2) Primer design

[0057] Design PCR amplification primers based on the sequence obtained in step 1.

[0058] Upstream primer (F):

[0059] 5'-GTTTAAGGTTCTTATCTGATTCTACAGAGAAG-3' (as shown in SEQ ID NO: 3);

[0060] Downstream primer (R):

[0061] 5'-TTTACTGACTCGTCTGTCTTTACAGAATC-3' (as shown in SEQ ID NO: 4).

[0062] (3) PCR amplification to obtain target fragment

[0063] The PCR reaction was completed using 2×Phanta Master Mix kit (P511-01, Nanjing Novozymes Biotech Co., Ltd.).

[0064] First prepare the PCR system (100 μL):

[0065] Components Dosage 2×Phanta Master Mix 50μL Upstream primer F (10 μM) 4μL Downstream primer R (10 μM) 4μL Genomic DNA 10μL <![CDATA[ddH2O]]> 32μL

[0066] Carry out PCR reaction:

[0067]

[0068] After the reaction was completed, band detection was performed using 1.5% agarose gel electrophoresis, and the target band was excised and recovered using a Gel Extraction Kit (D2500, Omega bio-tech).

[0069] 2. Linearization of reporter gene plasmid

[0070] The reporter gene vector used in this study is pTol2-CMV-IE1-GFP-RFP. The plasmid map can be found in Figure 2 .

[0071] Use BamHI enzyme to cut out the sequence between red fluorescent protein (RFP) and green fluorescent protein (GFP) in the vector

[0072] The enzyme digestion system (20 μL) is as follows:

[0073] 20μl enzyme digestion system Sample volume buffer 2μl Original plasmid 0.2μl <![CDATA[H2O]]> 17.8ul B H 1μl

[0074] The enzyme digestion reaction conditions were 37°C for 30 minutes. The linearized plasmid after enzyme digestion was recovered by gel excision using a kit.

[0075] 3. Construction of H-BDP reporter gene plasmid

[0076] use IIOne Step Cloning Kit (C112, Nanjing Novogene Biotech Co., Ltd.) was used to connect the target fragment and the linearized vector. The connection map is shown in Figure 3 .

[0077] (1) Recombination reaction: Prepare 20 μL of the reaction system on ice.

[0078] Element Dosage Target fragment H-BDP 15ng Linearized vector 115ng 5×CE II Buffer 4μL Exnase II 2μL <![CDATA[ddH2O]]> Make up to 20 μL

[0079] Reaction conditions: incubate at 37°C for 30 minutes.

[0080] (2) Transformation of recombinant products: Thaw the competent cells for cloning on ice, take 10 μl of the recombinant product and add it to 100 μl of the competent cells, gently tap the tube wall to mix (do not oscillate to mix), and let it stand on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds, and immediately cool on ice for 2-3 minutes. Add 900 μl of SOC or LB medium (without antibiotics) and shake at 37°C for 1 hour (speed 200-250 rpm). Preheat the LB solid medium plate with the corresponding resistance in a 37°C incubator. Centrifuge at 5000 rpm (2400×g) for 5 minutes and discard 900 μl of supernatant. Resuspend the bacteria with the remaining medium and gently spread it evenly on the plate containing the correct resistance with a sterile spreader. Incubate inverted in a 37°C incubator for 12-16 hours.

[0081] (3) Identification of recombination products: Several clones on the recombination reaction transformation plate were selected for colony PCR identification, and the PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification.

[0082] (4) Plasmid propagation: The plasmid with the correct sequence was propagated by shaking, and the plasmid was extracted using the Plasmid Mini KitI kit (D6943, Omega Bio-tech) for subsequent verification.

[0083] Example 2 Identification of H-BDP transcriptional activity

[0084] The transcriptional activity of H-BDP fragments was verified at the cellular level and the individual level.

[0085] Cell level: The H-BDP reporter gene plasmid obtained in Example 1 was transfected into the medaka spermatogonia cell line (SG3) at a dosage of 500 ng per well (12-well plate), and the luminescence of red and green fluorescent proteins in the cells was observed under a microscope 48 hours after transfection. Total RNA was extracted from the cells, and the expression levels of GFP and RFP were detected by RT-qPCR to detect the expression difference between the two (the results are shown in Figure 2). Figure 4 shown).

[0086] like Figure 4 As shown, the H-BDP fragment exhibited bidirectional transcription initiation activity in medaka cells and was able to simultaneously initiate the expression of reporter genes on both sides; in addition, there was no significant difference in the expression levels of the genes on both sides, indicating that the fragment had equivalent promoter activity in either direction.

[0087] Individual level: Wild-type medaka embryos that developed to the 1-cell stage were collected and injected with recombinant plasmids (20 ng / ul) by microinjection. Each group was injected with 20-25 plasmids. After injection, the embryos were raised in a 28°C incubator. The luminescence of red and green fluorescent proteins in the embryos was observed 48 hours after injection (the results are shown in Figure 2). Figure 5 shown).

[0088] like Figure 5 As shown in the figure, H-BDP can also simultaneously promote the expression of reporter genes on both sides in medaka embryos. Since the H-BDP fragment is derived from between the histone gene pair, the fluorescence distribution in the figure shows that the promoter activity of this fragment is universal and has a wide range of effects in fish.

[0089] Example 3 Identification and comparison of transcriptional activities of bidirectional promoters H-BDP and HY22956

[0090] The transcriptional activity of H-BDP and HY22956 fragments was verified at the cellular level and individual level, respectively.

[0091] Cell level: H-BDP obtained in Example 1 and HY22956 reporter gene plasmids from the inventor's previous experiments were transfected into medaka spermatogonia cell line (SG3) at a dosage of 500 ng per well (12-well plate), and the luminescence of red and green fluorescent proteins in the cells was observed under a microscope 48 hours after transfection. Total RNA was extracted from the cells, and the expression levels of GFP and RFP were detected by RT-qPCR to detect the expression difference between the two (the results are shown in Figure 2). Figure 6 , 7 shown).

[0092] like Figure 6 , 7 As shown, both reporter genes showed significant fluorescence signals in the transfected cells, indicating that the two bidirectional promoter fragments can successfully drive the expression of the reporter genes.

[0093] like Figure 8 The results showed that GFP and RFP driven by the H-BDP fragment had a relatively uniform fluorescence distribution in the cells and a high expression level. In contrast, the expression of RFP driven by the HY22956 fragment was more obvious, while the expression of GFP was relatively weak, suggesting that the HY22956 fragment may have certain differences in regulating the expression of different reporter genes.

[0094] Individual level: Wild-type medaka embryos that developed to the 1-cell stage were collected and injected with recombinant plasmids (20 ng / ul) by microinjection. Each group was injected with 20-25 plasmids. After injection, the embryos were raised in a 28°C incubator. The luminescence of red and green fluorescent proteins in the embryos was observed 48 hours after injection (the results are shown in Figure 2). Fig. 9 shown).

[0095] like Fig. 9 As shown in the figure, the expression patterns of the two promoter fragments in the embryo are significantly different. In the embryos using the H-BDP promoter, the expression of GFP and RFP is relatively uniform, covering multiple areas of the embryo, showing a strong fluorescence signal, indicating that the promoter fragment can drive a wider range of gene expression. This expression pattern means that the H-BDP promoter has a high global activity and can effectively initiate the transcription of reporter genes in medaka embryos. In comparison, the distribution of fluorescent protein expression driven by the HY22956 promoter fragment in the embryo is more localized, showing strong local expression, but the fluorescence signal in the whole embryo is slightly weaker than that of H-BDP.

[0096] In summary, the present invention successfully obtains a bidirectional promoter derived from the histone gene of medaka, which can drive the expression of genes on both sides at the same time, effectively improving the efficiency of the multi-gene expression system. The fragment is only 353bp, short and concise, easy to introduce in different vectors and expression systems, reducing the occupancy of the vector capacity and being more flexible. It is derived from the intergenic region of histones, has strong transcriptional activity, and can maintain high levels of expression in a variety of cell types. It has strong advantages in gene expression in the fields of aquaculture, ecological research, and fish biology.

[0097] Although the specific implementation modes of the present invention are described above, those skilled in the art should understand that the specific implementation modes described are only illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A promoter, characterized in that The promoter is a bidirectional promoter derived from a Japanese medaka histone gene, and the nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. An expression cassette, recombinant vector, transgenic cell line, recombinant bacteria or recombinant virus containing the promoter according to claim 1.

3. The expression cassette according to claim 2, characterized in that The expression cassette consists of the promoter according to claim 1, a target gene transcribed by the promoter according to claim 1, and a terminator.

4. The recombinant vector according to claim 2, characterized in that The recombinant vectors are pGL3-basic, pGL2-Basic, pGL4.10, and pGLuc.

5. The recombinant bacterium according to claim 2, characterized in that: The recombinant bacteria are Escherichia coli, Bacillus subtilis, lactic acid bacteria and yeast.

6. Use of the histone gene source as claimed in claim 1 in constructing eukaryotic expression vectors, and in efficiently expressing foreign genes in fish cells or mammalian cells.

7. Use of the histone gene source as claimed in claim 1 in protein induction purification, transgenic strain research or gene therapy.

Images