Methods and applications of the low-temperature response gene PbbZIP44 in enhancing plant cold resistance

Abstract

This invention provides a cold-resistance gene containing a BRZL domain isolated and cloned from pear rootstock. PbbZIP44 This study also provides insights into the application of this gene in enhancing plant cold resistance. Through the construction of... PbbZIP44 Gene overexpression and silencing vectors were developed and introduced into Arabidopsis thaliana, *Pyrus pyrifolia* callus, and *Pyrus pyrifolia* seedlings using Agrobacterium-mediated genetic transformation. Stable and transient expression were achieved, resulting in stable overexpressing plants and TRV-mediated silencing lines for low-temperature resistance functional analysis. Results showed that under low-temperature stress, the overexpressing lines exhibited stronger growth, lower malondialdehyde content and relative conductivity, as well as higher photosynthetic efficiency and antioxidant capacity compared to wild-type plants; while the silencing lines showed the opposite physiological response.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of a low-temperature response gene, PbbZIP44, in enhancing plant cold resistance. Background Technology

[0002] Pear (Pyrus spp.) is one of my country's three major fruits, holding an important position and economic value in the national economy. However, in recent years, with drastic global climate change and frequent extreme weather events, pear trees face various biotic and abiotic stresses, among which low-temperature stress is one of the most severe adverse conditions. Low temperatures limit the cultivation areas of many excellent pear varieties, and frequent chilling injury during pear tree growth significantly reduces yield and fruit quality, resulting in severe economic losses to the pear industry and hindering its further development. In recent years, the intensification of global climate change and the frequent occurrence of extreme low-temperature events have brought even greater challenges to fruit tree cultivation.

[0003] Faced with this situation, cultivating new pear varieties with stronger cold resistance has become particularly urgent. However, cold-resistant pear breeding faces multiple challenges. As a perennial woody plant, pear has a complex genetic background, self-incompatibility, and a long juvenile period, making traditional breeding methods difficult to apply efficiently and resulting in a long breeding cycle. In recent years, the development of plant biotechnology, especially genetic engineering, has provided new opportunities for pear germplasm improvement. By discovering and functionally analyzing important stress-resistance genes, a foundation can be laid for the genetic improvement of pear trees, while also providing the possibility of cultivating new cold-resistant varieties. This can not only improve the adaptability of pear trees to low-temperature stress but also promote the sustainable development of the pear industry. Therefore, in-depth research on pear cold-resistance genes and their regulatory mechanisms, and exploring their physiological and molecular response processes under low-temperature conditions, has become a key area and development direction for fruit tree stress resistance research.

[0004] Basic leucine zipper (bZIP) transcription factors are among the most widely distributed and conserved transcription factors in eukaryotes, playing crucial regulatory roles in many biotic and abiotic stresses (Liu et al., 2023). The bZIP transcription factor structure comprises a basic region and a leucine zipper domain. The relatively conserved basic region, consisting of approximately 20 amino acid residues, contains a fixed nuclear localization signal N-(X)7-R / K, which specifically binds to DNA cis-elements. The leucine zipper domain is not conserved and consists of one or more repeating regions containing numerous hydrophobic amino acids such as leucine, isoleucine, and valine. These amino acids dimerize to form homodimers or heterodimers, thereby activating or repressing the transcription factor (Guo et al., 2024). The abiotic stress response network mediated by bZIP transcription factors is an important mechanism for plants to cope with various abiotic stresses (such as salinity, drought, waterlogging, and chilling injury). Plants inevitably face adverse environmental conditions during their growth and development, and bZIP transcription factors play a crucial regulatory role under these conditions. For example, in rice, the ABA response element (ABRE) and coupling element (CE) in the Rab16B gene together form the ABA response complex (ABRC), which enhances ABA-dependent transcription under stress conditions, thereby improving plant stress resistance (Roychoudhury et al., 2008; Banerjee and Roychoudhury, 2015). Furthermore, overexpression of OsbZIP71 enhances rice's tolerance to drought and salt stress, while knockout of OsbZIP71 leads to increased sensitivity to drought, abscisic acid, and salt stress (Liu et al., 2014). OsbZIP23, as a transcriptional regulator, regulates the expression of various stress-related genes through an ABA-dependent pathway to cope with abiotic stresses (Xiang et al., 2008). bZIP transcription factors also exhibit important functions in other plants. For example, DgbZIP2 and DgbZIP3 interact in chrysanthemum to promote DgPOD expression, thereby enhancing cold resistance (Baiet et al., 2018). In maize, bZIP60 enhances resistance to heat stress by regulating the unfolded protein response, while bZIP68 negatively regulates cold resistance by modulating the expression of a group of COR genes (Li et al., 2020, 2022). In soybean, GmbZIP44, GmbZIP62, and GmbZIP78 regulate the resistance of transgenic Arabidopsis to salt and cold stress through ABA-related pathways (Liao et al., 2008).

[0005] Pyrus pyrifolia, a widely used rootstock in the pear industry, exhibits strong stress resistance, making it an ideal material for studying the resistance of woody plants and cloning related stress-resistance genes. Therefore, cloning the PbbZIP44 cold-resistance gene from Pyrus pyrifolia and exploring its cold-resistance function is of great significance for the breeding of cold-resistant varieties. Summary of the Invention

[0006] This invention addresses the technical problem at hand and overcomes the shortcomings of existing technologies by providing an application of the low-temperature response gene PbbZIP44 in enhancing plant cold resistance. The transcriptional regulatory factor PbbZIP44 was isolated and cloned from pear leaves, and its application in the genetic improvement of plant cold resistance was demonstrated. After overexpression or silencing of this gene in plants, the plants exhibited enhanced cold resistance or low-temperature sensitivity, respectively.

[0007] One of the objectives of this invention is to provide a pear stress-related gene, PbbZIP44, whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] The further optimized technical solution of this invention is as follows:

[0009] The protein encoded by the pear stress-related gene PbbZIP44 has the amino acid sequence shown in SEQ ID NO.2.

[0010] The second objective of this invention is to provide a method for amplifying the pear stress-related gene PbbZIP44, which uses pear leaf cDNA as a template for PCR amplification. The PCR amplification conditions are as follows: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 90 seconds, for 35 cycles, followed by 72℃ extension for 10 minutes.

[0011] A third objective of this invention is to provide a primer pair for amplifying the pear stress-related gene PbbZIP44, the primer pair comprising a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is shown in SEQ ID NO.3 and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.4.

[0012] This invention involves treating *Pyrus pyrifolia* seedlings at a low temperature of 4°C, taking samples at corresponding time points, and using real-time quantitative PCR to analyze the relative expression levels of the coding genes provided by this invention.

[0013] The present invention also provides a recombinant expression vector containing the pear stress-related gene PbbZIP44, the base vector of which is pCAMBIA1300.

[0014] The present invention further provides a host bacterium containing the pear stress-related gene PbbZIP44, wherein the host bacterium is Agrobacterium tumefaciens.

[0015] The fourth objective of this invention is to provide the application of the pear stress-related gene PbbZIP44 in enhancing plant cold resistance.

[0016] In the above applications, a plant overexpression vector for the PbbZIP44 gene was constructed, and the PbbZIP44 gene was introduced into the plant using Agrobacterium-mediated genetic transformation, resulting in overexpression of the bZIP transcription factor PbbZIP44 in the pear tree, thus obtaining transgenic plants with significant cold resistance.

[0017] In the above applications, the plants are Arabidopsis thaliana seedlings, pear callus, and wild pear seedlings.

[0018] This invention provides a method for isolating and cloning the cold-resistance gene PbbZIP44 containing the BRZL domain from *Pyrus pyrifolia* rootstock, and offers its application in enhancing plant cold resistance. By constructing overexpression and silencing vectors for the PbbZIP44 gene, and using Agrobacterium-mediated genetic transformation, stable and transient expression were achieved in *Arabidopsis thaliana*, *Pyrus pyrifolia* callus, and *Pyrus pyrifolia* seedlings. This resulted in stable overexpressing plants and TRV-mediated silencing lines for low-temperature resistance functional analysis. The results showed that under low-temperature stress, the overexpressing lines exhibited stronger growth, lower malondialdehyde content and relative conductivity, as well as higher photosynthetic efficiency and antioxidant capacity compared to wild-type plants; while the silencing lines showed the opposite physiological response. In conclusion, the PbbZIP44 gene possesses the ability to significantly improve plant cold resistance. The discovery of the PbbZIP44 gene provides a new genetic resource for molecular breeding of plant cold resistance, provides a scientific basis for cold resistance breeding of fruit trees and other crops, and helps to improve the adaptability and growth performance of plants in cold regions. Attached Figure Description

[0019] Figure 1 This is a flowchart illustrating the technical process of the present invention.

[0020] Figure 2 This diagram illustrates the low-temperature expression pattern analysis and subcellular localization of PbbZIP44 in this invention. In the diagram, A is the low-temperature expression pattern analysis diagram of PbbZIP44, and B is the subcellular localization diagram.

[0021] Figure 3 This image shows the positive identification results of Arabidopsis thaliana seedlings after transformation with the PbbZIP44 gene in this invention. In the image, A shows the positive DNA identification results after transformation with the PbbZIP44 gene in Arabidopsis thaliana seedlings, and B shows the positive RNA identification results after transformation with the PbbZIP44 gene in Arabidopsis thaliana seedlings.

[0022] Figure 4This diagram illustrates the cold resistance analysis of PbbZIP44 gene overexpression in Arabidopsis thaliana in this invention. In the diagram, A shows the fluorescence phenotype of leaves from Arabidopsis thaliana seedlings overexpressing PbbZIP44 after 14 days of low-temperature treatment and 5 days of recovery; B shows the fluorescence phenotype of leaves from Arabidopsis thaliana seedlings overexpressing PbbZIP44 after 14 days of low-temperature treatment and 5 days of recovery; C shows the conductivity measurement results after low-temperature treatment; D shows the malondialdehyde (MDA) measurement results after low-temperature treatment; and E shows the photosynthetic efficiency measurement results after low-temperature treatment.

[0023] Figure 5 This image shows the results of reactive oxygen species (ROS) determination in Arabidopsis thaliana overexpressing the PbbZIP44 gene in this invention. In the image, A shows DAB staining of leaves from Arabidopsis thaliana seedlings overexpressing PbbZIP44 after 14 days of low-temperature treatment; B shows NBT staining of leaves from Arabidopsis thaliana seedlings overexpressing PbbZIP44 after 14 days of low-temperature treatment; C shows trypan blue staining of Arabidopsis thaliana seedlings overexpressing PbbZIP44 after 14 days of low-temperature treatment; D shows the results of hydrogen peroxide (H2O2) content determination after low-temperature treatment; and E shows the results of resistance to superoxide anion (Anti-O2) after low-temperature treatment. - The results of the activity assay are shown in the figure.

[0024] Figure 6 This image shows the positive identification results of callus from pear transformed with the PbbZIP44 gene in this invention. In the image, A shows the DNA identification results of callus from pear transformed with the PbbZIP44 gene, and B shows the RNA identification results of callus from pear transformed with the PbbZIP44 gene.

[0025] Figure 7 This figure shows the results of the cold resistance analysis of PbbZIP44 overexpression in pear callus in this invention. In the figure, A shows the phenotype of PbbZIP44 overexpression in pear callus under normal conditions and after 14 days of low-temperature treatment; B shows the weight of PbbZIP44 overexpression in pear callus under normal conditions and after 14 days of low-temperature treatment; C shows the MDA measurement results under normal conditions and after 14 days of low-temperature treatment; D shows the proline measurement results under normal conditions and after 14 days of low-temperature treatment; E shows the H2O2 measurement results under normal conditions and after 14 days of low-temperature treatment; and F shows the Anti-O2 measurement results under normal conditions and after 14 days of low-temperature treatment. - Measurement results diagram.

[0026] Figure 8This diagram illustrates the results of cold resistance analysis of PbbZIP44 gene silencing in pears according to the present invention. In the diagram, A shows the phenotype of the PbbZIP44-silencing lines after 14 days of low-temperature treatment; B shows the identification of VIGS materials after low-temperature treatment; C shows the conductivity measurement results after 14 days of low-temperature treatment; D shows the MDA measurement results after 14 days of low-temperature treatment; E shows the H2O2 measurement results after 14 days of low-temperature treatment; and F shows the Anti-O2 measurement results after 14 days of low-temperature treatment. - Measurement results diagram. Detailed Implementation

[0027] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.

[0028] This invention provides the encoding gene of the basic leucine zipper transcription factor PbbZIP44 from pear, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0029] This invention provides a basic leucine zipper transcription factor, PbbZIP44, whose amino acid sequence is shown in SEQ ID NO.2. The PbbZIP44 gene encodes 157 amino acids, has a protein size of 17.67 kDa, and an isoelectric point of 7.98. The PbbZIP44 transcription factor can enhance the plant's ability to scavenge reactive oxygen species (ROS) and reduce membrane damage at low temperatures, thus demonstrating that this gene has a cold-resistant function. In this invention, the PbbZIP44 gene vector is constructed using homologous recombination technology. There are no particular limitations on the recombination expression method; any recombination expression method well-known in the art can be used.

[0030] This invention provides primer pairs for cloning the cDNA sequence of the encoding gene, with the forward primer sequence shown in SEQ ID NO. 3 and the reverse primer sequence shown in SEQ ID NO. 4. The source of these primer pairs is not particularly limited; they can be synthesized by any biosynthetic company well-known in the art. In this embodiment of the invention, the primer pairs were synthesized by Shanghai Biotech Co., Ltd.

[0031] This invention provides the application of the encoding gene of the basic leucine zipper transcription factor PbbZIP44 in Pyrus pyrifolia, or the encoding gene amplified by primer pairs, in improving the salt tolerance of plants.

[0032] In this invention, the application preferably includes the following steps: overexpressing the basic leucine zipper transcription factor PbbZIP44 from pear in plants, resulting in overexpressed plants with cold resistance; silencing the PbbZIP44 gene in pear through VIGS mediation, resulting in interference plants with reduced salt tolerance.

[0033] In this invention, the preferred PCR amplification program is 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 90 s, 72℃ extension for 90 s, for 35 cycles, followed by a 72℃ extension for 10 min after each cycle. The encoding gene is preferably overexpressed in plants using the pCAM1300-GFP-PbbZIP44 recombinant vector and silenced in *Pyrus pyrifolia* using the pTRV2-PbbZIP44 recombinant vector. This invention does not impose any particular limitations on the construction methods of the pCAM1300-GFP-PbbZIP44 and pTRV2-PbbZIP44 recombinant vectors; any construction method well-known in the art can be used.

[0034] The preferred method for overexpressing and silencing gene-encoding genes in plants is Agrobacterium-mediated genetic transformation. This invention does not impose any particular limitation on the Agrobacterium-mediated genetic transformation method; conventional methods well-known in the art can be used. Preferred plants include Arabidopsis thaliana, *Pyrus pyrifolia* callus, and *Pyrus pyrifolia*.

[0035] In this invention, before testing the cold resistance of overexpressing plants and gene-silenced plants, it is preferable to further screen positive transgenic plants. The screening method for positive transgenic plants is preferably PCR amplification. During screening, the nucleotide sequence of the forward primer for PCR amplification is shown in SEQ ID NO.3; the nucleotide sequence of the reverse primer for PCR amplification is shown in SEQ ID NO.4 or SEQ ID NO.5; the PCR amplification reaction procedure is as follows:

[0036] Table 1 PCR amplification system

[0037]

[0038]

[0039] The PCR reaction system used for PCR amplification is as follows:

[0040] Table 2 Gene amplification system

[0041]

[0042] After PCR amplification, if the plant lines to be tested can amplify fragments of the expected size, it indicates that they are positive transgenic lines.

[0043] The preferred method for screening plants with positive gene overexpression is qRT-PCR to detect gene expression levels. The forward primer sequence for qRT-PCR during screening is shown in SEQ ID NO. 6; the reverse primer sequence is shown in SEQ ID NO. 7. The preferred method for screening plants with positive gene silencing is qRT-PCR to detect gene expression levels. The forward primer sequence for qRT-PCR during screening is shown in SEQ ID NO. 10 (agaacacgggggactctagaATGGCTTCTTCAAGCGGAAA); the reverse primer sequence is shown in SEQ ID NO. 11 (gcccttgctcaccatggatcc ATAGTATTGGTGAAGCATGT); the internal control primer Tublin sequence is shown in SEQ ID NO. 8 and SEQ ID NO. 9. The real-time quantitative PCR reaction procedure is as follows:

[0044] Table 3 qRT-PCR reaction procedure

[0045]

[0046]

[0047] The real-time quantitative PCR reaction system is as follows:

[0048] Table 4 qRT-PCR reaction system

[0049]

[0050] After real-time quantitative PCR amplification, if the gene expression level of the tested plant line is significantly higher than that of the wild-type plant, it indicates that they are positive overexpression lines; if the gene expression level of the tested plant line is significantly lower than that of the control plant, it indicates that they are positive gene silencing lines.

[0051] In this invention, the obtained overexpression lines and gene-silenced lines are subjected to low-temperature treatment, and the phenotypes and related physiological indicators of the overexpression lines and gene-silenced lines after treatment are measured to verify their anti-inflammatory function. The preferred method for measuring reactive oxygen species is to use DAB and NBT histochemical staining to detect hydrogen peroxide (H2O2) and superoxide anion (O2) in plant leaves. - The accumulation of staining was analyzed (based on the depth and extent of staining), observed visually and photographed. Conductivity, fresh weight, malondialdehyde (MDA), proline (Pro), H2O2, and anti-superoxide anion (Anti-O2) were measured. - There are no special restrictions on the extraction and determination methods of ), and any extraction and determination methods well known in the field can be used.

[0052] In this invention, the plant low-temperature stress condition is preferably not lower than 0°C.

[0053] In this invention, the pCAMBIA1300-35S-EGFP vector was constructed using homologous recombination. First, the pCAMBIA1300 vector was linearized using restriction endonucleases BamHI and SalI. Then, the EGFP gene was amplified by PCR using primers containing BamHI and SalI restriction sites, and the amplified product was obtained. This product was then ligated to the linearized pCAMBIA1300 vector using homologous recombinase. The ligated product was transformed into competent Escherichia coli DH5α, and positive clones were obtained through kanamycin selection. Finally, sequencing analysis verified the positive clones, confirming successful construction and the acquisition of the recombinant vector.

[0054] The following detailed description, in conjunction with embodiments, illustrates the PbbZIP44 in *Pyrus pyrifolia* provided by this invention and its application in improving plant cold resistance. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0055] Example 1

[0056] like Figure 1 As shown, the application of the low-temperature response gene PbbZIP44 in enhancing plant cold resistance follows a specific process:

[0057] (1) Cloning and vector construction of PbbZIP44 gene from Pyrus pyrifolia

[0058] A bZIP transcription factor, PbbZIP44, was screened from *Pyrus pyrifolia* using a yeast two-hybrid screening system. Primers (SEQ ID NO. 3 and SEQ ID NO. 4) were designed based on its gene sequence, and its full-length sequence was amplified from *Pyrus pyrifolia* using PCR. A single-band PCR product was obtained after amplification. After detection by 1% agarose gel electrophoresis, the target band was extracted and recovered using a gel extraction kit (Vazyme, Nanjing, China) according to the manufacturer's instructions. The recovered target gene was reacted with the intermediate vector Peasy at 37°C for 30 minutes. Single clones were then plated and cultured. Positive clones were sequenced, and after confirmation of the correct sequence, the recombinant vector PbbZIP44-Peasy was identified. The plasmid was extracted using a plasmid extraction kit (Vazyme, Nanjing, China). After adding XbaI and BamHI restriction sites to both ends of the PbbZIP44 gene, it was cloned and ligated into the linearized pCAMBIA1300-35S:GFP expression vector (preserved by the Horticulture and Plant Protection Laboratory of Yangzhou University). Using the correctly sequenced PbbZIP44-Peasy plasmid as a template, PCR amplification was performed using primers containing the restriction sites (SEQ ID NO. 10 and SEQ ID NO. 11). The amplification program was: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds, 58℃ annealing for 60 seconds, 72℃ extension for 90 seconds, for 35 cycles; and a final extension at 72℃ for 10 minutes. To achieve gene fusion with GFP, the stop codon TAG was removed from the 3′ end of the gene. After separation by 1% agarose gel electrophoresis, the target band was recovered using a gel extraction kit. The pCAMBIA1300-35S:GFP vector plasmid was digested with XbaI and BamHI restriction endonucleases, and purified after incubation at 37°C for 4 hours. Subsequently, the digested pCAMBIA1300-35S:GFP vector was ligated with the recovered PbbZIP44 fragment using recombinant ligase at 37°C for 30 minutes, and then transformed into competent E. coli DH5α cells. Positive clones were identified by PCR and sent for sequencing. The plasmid of correctly sequenced positive clones was the recombinant vector PbbZIP44-GFP. Finally, the constructed PbbZIP44-GFP recombinant vector was transformed into Agrobacterium tumefaciens competent strain GV3101 purchased from Weidi Biotechnology Co., Ltd. for later use. The double digestion system of the pCAMBIA1300-35S vector is detailed in Table 5, and the recombination reaction system is detailed in Table 6.

[0059] Table 5 Double enzyme digestion system

[0060]

[0061] Table 6 Reorganization System

[0062]

[0063] Bioinformatics analysis showed that the full-length cDNA sequence of the PbbZIP44 gene is 471 bp, the coding region contains 157 amino acids, the predicted protein molecular weight is 17.67 kDa, and the isoelectric point is 7.98.

[0064] (2) qRT-PCR analysis of PbbZIP44 gene under low temperature treatment

[0065] To investigate the low-temperature response pattern of the PbbZIP44 gene in *Pyrus pyrifolia*, qRT-PCR was used to analyze its expression pattern. Healthy *Pyrus pyrifolia* seedlings with no significant differences in growth were selected and treated at 4℃. Samples were taken at 0h, 3h, 6h, 9h, 12h, and after a 24h recovery period. Total RNA was extracted using a Novizan reagent kit, and the RNA was converted to cDNA using a Novizan reverse transcription kit. The experimental system and procedures were performed according to the manufacturer's instructions. Subsequently, the expression level of the PbbZIP44 gene was analyzed by qRT-PCR. The specific qRT-PCR system and procedures are detailed in Tables 3 and 4. The experimental results are as follows: Figure 2 As shown in Figure A, the expression pattern of the PbbZIP44 gene under low temperature conditions is demonstrated.

[0066] Figure 2 Figure A illustrates the expression of the PbbZIP44 gene under low-temperature stress. Samples were taken from *Pyrus pyrifolia* seedlings (non-transgenic) at different time points after low-temperature treatment, and the relative expression level of the PbbZIP44 gene was analyzed by real-time quantitative PCR. Figure 2 As shown in Figure A, the expression level of this gene gradually increased in the first 12 hours as the treatment time lengthened. This indicates that the PbbZIP44 gene is induced by low-temperature stress and is a gene with potential low-temperature response function.

[0067] (3) Subcellular localization of the gene encoding PbbZIP44

[0068] Agrobacterium-mediated transient transformation of tobacco: Agrobacterium PbbZIP44-GFP, green fluorescent protein GFP, and helper plasmid P19 were individually selected and activated in LB medium at 28°C and 220 rpm overnight. 10 μL of the overnight culture was transferred to 5 mL LB-MES medium, and 2 μL of 100 mM acetylsylgenone was added. The culture was incubated overnight at 28°C and 220 rpm for 16 h. The bacterial suspension was collected, and the target gene bacterial suspensions (PbbZIP44-GFP and GFP) and P19 were resuspended in 10 mM MgCl2. When the OD600 values ​​were 1 and 0.7, the target gene bacterial suspensions and P19 bacterial suspensions were mixed in equal volumes. Acetylgenone was added to the mixed bacterial suspensions at a ratio of 1:500, and the mixture was incubated at room temperature in the dark for 3 h. Leaves with good growth and smooth surfaces were selected for injection. After injection, the leaves were treated in the dark for 12 h, and then grown under normal conditions. The results were observed and verified after 2-3 days, with adequate water supply maintained during this period.

[0069] See results Figure 2 B. Figure 2 B represents the subcellular localization of the PbbZIP44-GFP encoding gene and the control GFP, including imaging of the control GFP gene and the PbbZIP44-GFP encoding gene in GFP field, DAPI field, bright field, and mixed field. Based on the subcellular localization, it can be seen that the PbbZIP44 gene is located in the cell nucleus.

[0070] (4) Identification of Arabidopsis overexpression lines

[0071] ① Steps of Agrobacterium-mediated genetic transformation in Arabidopsis thaliana

[0072] Agrobacterium culture: The cryopreserved Agrobacterium tumefaciens strain was streaked onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L rifampin, and incubated at 28°C for 36-48 hours until plaques appeared. The plaques were then scraped off and added to liquid MS medium (2.37 g / L MS + 50 g / L sucrose + 0.1 mg / L IBA, pH 5.8), and incubated at 28°C with shaking for 30 minutes until the OD600 reached 0.8-1.0. 200 μl / L of the surfactant sweet77 was added for inoculation.

[0073] Infection: Select wild-type Arabidopsis plants that are about 30 days old, with pods forming on the main inflorescence, secondary inflorescences 2-10 cm in length and a small number of flowers, and healthy growth. Before infection, cut off the flowering inflorescences, invert the plants and immerse them in the prepared Agrobacterium solution, vacuum to 0.05 MPa and maintain for 5 minutes, then place them in the dark for 24 hours.

[0074] Cultivation: Cultivate the plants according to conventional methods until they bear fruit, and harvest mature T0 generation seeds.

[0075] ② Screening of transgenic positive seedlings

[0076] After surface sterilization, the harvested T0 generation seeds were evenly sown on MS selective medium containing 50 mg / L hygromycin and 50 mg / L termethin. The medium was incubated at 22°C under 16 hours of light. After about one week, plants with fast growth and long roots were selected and transplanted into sterilized nutrient soil for further cultivation.

[0077] ③ Identification of transgenic Arabidopsis thaliana

[0078] a. DNA extraction from transgenic Arabidopsis thaliana

[0079] DNA was extracted from Arabidopsis thaliana transgenic with the PbbZIP44 gene using a DNA extraction kit. The procedure was followed according to the instructions, and specific primers were designed. Positive plants were identified by PCR amplification.

[0080] b. Detection of positive transgenic plants

[0081] PCR amplification was performed using gene-specific primers. The reaction conditions and systems are detailed in Tables 1 and 2. PCR detection was performed using the upstream primer for the gene and the downstream primer for the vector (SEQ ID NO. 10 and SEQ ID NO. 11). Samples that amplified the expected fragment were considered positive transgenic lines.

[0082] c. Detection of overexpression plants

[0083] qRT-PCR amplification was performed using upstream primers for the gene and downstream primers for the vector (SEQ ID NO.6 and SEQ ID NO.7). The reaction conditions and systems are detailed in Tables 3 and 4. The difference in expression levels between the transgenic lines and the wild-type was detected by quantitative real-time PCR to determine whether the lines were overexpressing transgenic.

[0084] like Figure 3 As shown, DNA testing identified six T0 generation transgenic positive lines (see...). Figure 3 (A) Subsequently, these positive lines were subjected to qRT-PCR detection, and finally, three overexpression lines with high expression levels were selected (see A). Figure 3 (B) Continue culturing until T3 generation transgenic Arabidopsis stably expressing PbbZIP44 is obtained, and used for subsequent cold resistance experiments.

[0085] (5) Identification of callus overexpression lines of pear

[0086] ① Steps of Agrobacterium-mediated genetic transformation of pear callus

[0087] Agrobacterium culture: The cryopreserved Agrobacterium tumefaciens strain was streaked onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L rifampin, and incubated at 28°C for 36-48 hours until plaques appeared. The plaques were then scraped off and added to liquid MS medium (2.37 g / L MS + 50 g / L sucrose + 0.1 mg / L IBA, pH 5.8), and incubated at 28°C with shaking for 30 minutes until the OD600 reached 0.8-1.0. 500 μl / L of the surfactant acetylsuccinyl ketone was added for staining.

[0088] Inoculation: Select 15-day-old wild-type pear callus, invert the callus and immerse it in the prepared Agrobacterium solution, shake evenly at 100 rpm for 15 minutes, absorb the liquid from the callus tissue, and spread it evenly on the symbiotic culture medium.

[0089] Screening of transgenic positive callus: After two days of dark culture in symbiotic medium, the callus was transferred to screening medium for further culture. After about 30 days, fast-growing callus was selected and transferred to screening plates for continued culture.

[0090] ② Identification of transgenic callus

[0091] a. DNA extraction from transgenic callus

[0092] DNA was extracted from callus of pear transgenic PbbZIP44 using a DNA extraction kit. The procedure was followed according to the instructions, and specific primers were designed. Positive plants were identified by PCR amplification.

[0093] b. Detection of positive transgenic plants

[0094] PCR amplification was performed using gene-specific primers. The reaction conditions and systems are detailed in Tables 1 and 2. PCR detection was performed using the gene upstream primer and the vector downstream primer (SEQ ID NO. 3 and SEQ ID NO. 5). Samples that amplified the expected fragment were considered positive transgenic lines.

[0095] c. Detection of overexpression plants

[0096] qRT-PCR amplification was performed using upstream primers for the gene and downstream primers for the vector (SEQ ID NO.6 and SEQ ID NO.7). The reaction conditions and systems are detailed in Tables 3 and 4. The difference in expression levels between the transgenic lines and the wild-type was detected by quantitative real-time PCR to determine whether the lines were overexpressing transgenic.

[0097] like Figure 6 As shown, DNA testing identified six T0 generation transgenic positive lines (see...). Figure 6(A) Subsequently, these positive lines were subjected to qRT-PCR detection, and finally, three overexpression lines with high expression levels were selected (see A). Figure 6 (B), and used for subsequent cold resistance experiments.

[0098] (6) Instantaneous transformation of pear seedlings

[0099] ① Construction of virus-induced gene silencing vector

[0100] The viral silencing vector was constructed according to the method in step (1). The viral silencing vector pTRV2 has two restriction enzyme sites: XbaI and SacI. Upstream and downstream primers (such as aaggttaccgaattctctaga AGGGGATCTGCATCGTCC as shown in SEQ ID NO.12 and ggcctcgagacgcgtgagctc TGATGTTTATGCTGGTCA as shown in SEQ ID NO.13) were designed according to primer design principles to amplify the PbbZIP44 gene and insert it between the two restriction enzyme sites on the vector, resulting in the recombinant vector pTRV2-PbbZIP44, which was then transformed into Agrobacterium GV3101 competent cells.

[0101] ② Virus-induced gene silencing in pear seedlings

[0102] a. Agrobacterium culture: Agrobacterium tumefaciens culture stored in an ultra-low temperature freezer was cultured in LB liquid medium supplemented with kanamycin 50 mg / L and rifampin 50 mg / L at 28°C and 220 rpm for 12 h. The cultured bacterial solution was centrifuged at 6000g for 10 min to collect the bacterial cells. The precipitate was resuspended in infection solution (10 mM MgCl2, 10 mM MES, 200 mM acetylsyl syringone, pH 5.6) until the concentration reached OD600 = 0.8-1.0.

[0103] b. Induction of bacterial culture: Place the bacterial culture with the adjusted OD value in the dark and induce at room temperature and 100 rpm for 4 hours;

[0104] c. Injection of pear seedlings: pTRV1 and pTRV2 bacterial solutions were mixed in a 1:1 ratio as the control group, and pTRV1 and pTRV2-PbbZIP44 bacterial solutions were mixed in a 1:1 ratio as the experimental group. The seedlings were injected with pear seedlings that were 45 days old, had consistent growth, and were in good health.

[0105] ③VIGS material identification

[0106] After injection, pear seedlings were treated in the dark at room temperature for 12 hours, followed by normal culture for 3 days. RNA was extracted from seedlings of both the control and experimental groups, and then reverse transcribed to obtain cDNA. Tublin from pear was then used as an internal control for amplification. The nucleotide sequence of the Tublin primers is as follows:

[0107] Tublin forward primer: 5'-TGGGCTTTGCTCCTCTTAC-3' (SEQ ID NO.8)

[0108] Tublin reverse primer: 5'-CCTTCGTGCTCATCTTACC-3' (SEQ ID NO.9)

[0109] The bands amplified using Tublin showed uniform brightness, indicating that the concentration of reverse-transcribed cDNA was the same. Then, qRT-PCR was performed using PbbZIP44-specific primers and the pear internal control primer Tublin to analyze the expression levels of the tested lines. The nucleotide sequence of the PbbZIP44-specific primers is as follows:

[0110] Forward primer: 5'-TGTCGAGTCGGAAAACTCGG-3' (SEQ ID NO.6)

[0111] Reverse primer: 5'-AGTGGCCATGATTGGTTGGT-3' (SEQ ID NO.7).

[0112] Based on the expression level of the PbbZIP44 gene, three plants with low expression levels were selected as virus-silencing positive lines and named PbbZIP44-VIGS.

[0113] The results of low-temperature treatment of gene-silenced plants are as follows Figure 8 As shown. Figure 8 B represents the detection of gene expression levels in gene-silenced positive plants using qRT-PCR with gene-specific primers and the internal control primer Tublin. This demonstrates that the PbbZIP44 gene in the virus-silenced positive lines of *Pyrus pyrifolia* seedlings was effectively silenced.

[0114] (7) Identification of cold resistance in Arabidopsis thaliana lines overexpressing PbbZIP44

[0115] To verify the biological function of the PbbZIP44 gene, healthy Arabidopsis thaliana plants overexpressing PbbZIP44, grown for 30 days and in similar condition, were subjected to low-temperature treatment. The plants were treated at 0℃ for 7 days and then restored to room temperature for 5 days. The experimental results are as follows: Figure 4 As shown, after low-temperature treatment, transgenic Arabidopsis thaliana exhibited stronger growth compared to the wild type (see...). Figure 4 (A), and has higher photosynthetic efficiency (see A). Figure 4 (B). Further testing of cold resistance indicators showed that the levels of malondialdehyde and electrical conductivity in transgenic Arabidopsis plants were lower than those in the wild type (see B). Figure 4 The results (C and D) indicate that the degree of cell membrane damage was low. Furthermore, the photosynthetic rate measurements showed that the photosynthetic efficiency of the plants was almost completely lost after low-temperature treatment (see [reference]). Figure 4 The reactive oxygen species (ROS) content and cell death rate of Arabidopsis thaliana plants after low-temperature treatment were also examined. DAB and NBT staining results showed that transgenic plants accumulated less hydrogen peroxide and superoxide anions, and the staining was lighter than that of wild-type plants, indicating...

[0116] PbbZIP44 overexpression significantly reduced reactive oxygen species levels (see [link]). Figure 5 (A and B). Quantitative analysis showed that, compared to the wild type, the transgenic plants had lower hydrogen peroxide content and higher superoxide anion resistance content (see A and B). Figure 5 (D and E). Trypan blue staining results showed that the transgenic Arabidopsis thaliana showed lighter staining, indicating a lower cell death rate (see D and E). Figure 5 (C). The above results indicate that PbbZIP44 enhances the cold resistance of Arabidopsis thaliana by reducing the accumulation of reactive oxygen species and decreasing membrane damage.

[0117] (8) Identification of cold resistance in pear callus tissue overexpressed with PbbZIP44

[0118] The cold-resistant effect of PbbZIP44 was further verified in pear callus. Transgenic and wild-type callus tissues, after 15 days of subculture, were subjected to low-temperature treatment. Under normal conditions, there were no significant differences in growth status and physiological indicators between transgenic and wild-type callus (see...). Figure 7 (A). After 14 days of low-temperature treatment at 4°C, the growth status and amount of transgenic callus were significantly higher than those of wild type, and its malondialdehyde and hydrogen peroxide content were lower than those of wild type, while its proline and superoxide anion resistance content were higher than those of wild type (see A). Figure 7 (B to F). These results indicate that overexpression of the PbbZIP44 gene enhances the cold resistance of pear callus.

[0119] (9) Identification of cold resistance in Pyrus pyrifolia with PbbZIP44 gene silencing

[0120] PbbZIP44 gene silencing experiments were conducted on *Pyrus pyrifolia* seedlings. The results after low-temperature treatment showed that, contrary to the transgenic plants, PbbZIP44-silenced plants exhibited higher electrical conductivity, hydrogen peroxide and malondialdehyde (MDA) content, while superoxide anion content was reduced, indicating that PbbZIP44 silencing decreased the plant's cold resistance.

[0121] Therefore, the results of PbbZIP44 overexpression and gene silencing experiments confirm that this gene plays a positive regulatory role in improving plant cold resistance.

[0122] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Pear stress-related genes PbbZIP44 Application in enhancing plant cold resistance, the pear stress-related gene PbbZIP44 The nucleotide sequence is shown in SEQ ID NO.2, and the plant is Arabidopsis thaliana seedling, pear callus and wild pear seedling.

2. The application according to claim 1, characterized in that, Build PbbZIP44 Plant overexpression vectors for genes were developed, and Agrobacterium-mediated genetic transformation was used to... PbbZIP44 Genes were introduced into plants, enabling the bZIP transcription factor in pear trees to... PbbZIP44 Overexpression in plants yields transgenic plants with significant cold resistance.

3. The application according to claim 2, characterized in that, pear stress-related genes PbbZIP44 The amplification method includes: PCR amplification using pear leaf cDNA as a template. The PCR amplification conditions are: 94℃ pre-denaturation for 3 minutes; 94℃ denaturation for 30 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 90 seconds, for 35 cycles, followed by 72℃ extension for 10 minutes.

4. The application according to claim 2, characterized in that, Used to amplify the pear stress-related gene as described in claim 1 PbbZIP44 The primer pair includes a forward primer F and a reverse primer R, wherein the nucleotide sequence of the forward primer F is shown in SEQ ID NO.3 and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.

4.

5. The application according to claim 2, characterized in that, pear stress-related genes PbbZIP44 The plant overexpression vector is based on the pCAMBIA1300 vector.

6. The application according to claim 2, characterized in that, Contains the pear stress-related gene. PbbZIP44 The Agrobacterium is Agrobacterium tumefaciens.

Images