Haplotype related to growth, meat production and feed conversion rate of pigs and breeding application

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a haplotype related to pig growth, meat production and feed conversion rate and breeding application. The genetic marker clones 22 loci from an lncMGPF gene promoter region of a pig No.8 chromosome. SNPs loci are typed through a direct sequencing technology, a linkage imbalance analysis result shows that 22 loci are all in a strong linkage imbalance state, haplotype analysis is further carried out, and a result shows that two main haplotypes are generated. Association analysis shows that compared with other combined haplotype individuals, the combined haplotype H1-H1 individuals have the characteristics that the day age time is short when the combined haplotype H1-H1 individuals reach 100 kg, the eye muscle thickness is large, and the average feed conversion ratio is small when the combined haplotype H1-H1 individuals are 30-100 kg. The invention provides a new marker for molecular breeding of pig meat traits.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering technology, and in particular relates to a haplotype of traits related to pig growth, meat production and feed conversion rate and breeding application thereof. Background Art

[0002] In the lives of Chinese residents, pork is the main agricultural and livestock product and the main source of meat. While people's requirements for pork quality continue to increase, lean meat quality has also received special attention. Effective pig breeding can improve pork production and quality [1]. Feed efficiency (FE) is an extremely important trait. However, the measurement of FE is cumbersome and expensive, which makes it difficult to collect large amounts of data to accurately select individuals with better FE performance. Therefore, identifying single nucleotide polymorphisms (SNPs) related to FE-related traits (average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR)) and using them for genetic evaluation is of great significance for improving the accuracy of predictions and promoting the genetic progress of these traits in pig breeding programs [2]. The meat production traits of pigs include body length, fat thickness, eye muscle area, and daily weight gain, and many genetic genes will affect these traits [3]. However, important economic traits of pigs, such as reproduction, fattening, and carcass, are all quantitative traits. The phenotype is affected by the interaction between genes and the environment, and multiple quantitative trait loci (QTL) work together, which makes it difficult for traditional breeding programs to achieve significant genetic progress.

[0003] In the field of pig breeding, the positioning of quantitative trait QTLs has been the focus of research in order to explore the genetic variation of quantitative traits and improve the genetic progress during the breeding cycle [4]. In order to explore the genetic variation of quantitative traits and improve the genetic progress during the pig breeding cycle, the positioning of quantitative trait QTLs has been the focus of research in the field of pig breeding [5]. With the research, development and rapid development of SNP, it has become an important research tool for pig genome analysis. SNP provides strong support for the positioning of QTLs for pig economic traits and the selection of excellent traits. It is currently widely used in the field of pig molecular breeding [6]. At the same time, SNP is used for gene positioning like phenotype and pedigree. Genome-Wide Association Study (GWAS) based on SNP, phenotype and pedigree information association analysis has the advantages of detecting small-effect phenotypic association variations and exploring association variations in narrow genomic regions compared to traditional QTL positioning. Therefore, GWAS is a key technology for exploring the major effect genes of pig breeding quantitative traits and the main way to analyze their genetic mechanisms [7]. Marker Assisted Selection (MAS) is a method that combines molecular genetics and traditional breeding techniques to accelerate the genetic improvement of crops and livestock. By identifying molecular markers that are closely linked to target traits, the performance of adult traits can be predicted at a young age. Breeders can then eliminate individuals that do not meet expectations at an early stage, thereby improving breeding efficiency[8].

[0004] At present, the physiological functions and regulatory mechanisms of long non-coding RNA (lncRNA) in many muscles remain to be explored. Some scholars [9] found that lncMGPF (lncRNA muscle growth promoting factor) is highly expressed in muscles, positively regulated by MyoD, and promotes muscle cell differentiation. Knockout of lncMGPF in mice reduces growth rate, reduces muscle mass, and impairs muscle regeneration. Overexpression in muscle can rescue the phenotype of knockout mice and promote muscle growth in wild-type mice. Mechanistically, lncMGPF acts as a miR-135a-5p molecular sponge to promote muscle differentiation, increase MEF2C expression, and stabilize myogenic regulatory genes (such as MyoD and MyoG) through HuR. In short, lncMGPF is a new type of positive regulator of muscle generation in mice, pigs and humans, and plays an important role in regulating muscle differentiation at the transcriptional level

[10] . Therefore, the functional variation of the lncMGPF gene is an important part of studying the genetic basis of pig growth and meat production traits. Summary of the invention

[0005] The technical purpose of the present invention is to screen genetic markers associated with pig growth, meat production traits and feed conversion rate. By cloning the gene sequence of the 120807212-120805413 segment of pig chromosome 8, and using direct sequencing to find SNP sites and genotyping methods, the correlation with pig growth, meat production traits and feed conversion rate is analyzed, thereby establishing a new marker-assisted selection site for pig meat production traits and improving pig muscle yield.

[0006] To achieve the above technical objectives, the present invention provides a SNPs haplotype site related to pig growth, meat production and feed conversion rate and breeding application.

[0007] In the study of this application, we found 22 SNPs sites located in the promoter region of the lncMGPF gene. Through association analysis, the 22 SNPs sites were significantly associated with the growth rate, meat production and feed conversion rate of pigs. Further analysis found that this group of SNPs was in a strong linkage disequilibrium state. Haplotype analysis was performed and two main haplotypes were found, and there were significant differences in traits related to growth rate, lean meat rate and feed conversion rate. This group of SNPs may affect the growth, differentiation process and muscle mass expression of muscle cells by changing the expression level of the lncMGPF gene.

[0008] In view of the important role of the haplotype loci composed of 22 SNPs discovered in this application in pig growth, meat production traits and feed conversion rate, this group of SNPs can be used as an effective molecular marker in the genetic improvement of pigs. By using this group of SNPs for molecular marker-assisted selection, the breeding efficiency can be significantly improved, and breeding pigs with excellent growth performance and meat quality characteristics can be bred, providing efficient and accurate genetic improvement tools for pork production. This discovery provides a new target for molecular breeding of pigs, which has broad application prospects and important economic value. Incorporating the haplotype loci composed of this group of SNPs into the breeding strategy can further optimize the genetic structure of pigs and enhance the competitiveness of the pork industry.

[0009] The present invention obtains the gene sequence of the 120807212-120805413 segment of pig chromosome 8, and the length of the segments is 912bp and 1193bp respectively. The nucleotide sequence of the segment is shown in SEQ ID NO.1, and the nucleotide sequence of the fragment is shown in SEQ ID NO.2 and SEQ ID NO.3 respectively. By performing BLAST comparison on the NCBI website, it is found that there are 22 nucleotide polymorphism (SNP) sites in the amplified fragment of the region, specifically as follows Figure 2The mutation of the SNPs site is specifically at the 120806935th base of chromosome 8, the base changes from A to G, the 120806870th base, the base changes from C to T, the 120806758th base, the base changes from T to C, the 120806686th base, the base changes from A to G, the 120806658th base, the base changes from G to A, the 120806572nd base, the base changes from A to G, the 120806569th base, the base changes from A to G, the 120806500th base, the base changes from G to T, the 120806466th base, the base changes from A to G, the 120806421st base, the base changes from T to C, the 120806354th base , the base changed from C to T, at the 120806191th base, the base changed from T to A, at the 120806010th base, the base changed from C to T, at the 120805996th base, the base changed from A to T, at the 120805993rd base, the base changed from G to A, at the 120805969th base, the base changed from T to C, at the 120805960th base, the base changed from C to T, at the 120805944th base, the base changed from T to C, at the 120805937th base, the base changed from G to T, at the 120805934th base, the base changed from G to A, at the 120805928th base, the base changed from C to T, and at the 120805898th base, the base changed from T to C. According to the naming rules of the Ensembl database, the 22 mutation sites were named rs330976547, rs338784877, rs81301734, rs81403973, rs326146572, rs342204085, rs337352483, rs343829296, rs333719775, rs34522399 5. rs322507337, rs323169181, rs336777076, rs329888236, rs318628273, rs704696628 , rs703204935, rs338044940, rs698674853, rs702534495, rs343794961, rs336673575.

[0010] The experimental material was selected as Large White pig. Whole genome DNA was extracted from the blood of Large White pig, and two pairs of primers were designed based on the pig gene sequence (NC_010450.4) published in the NCBI database. The sequences of the primer pairs are as follows:

[0011] Forward primer 1 (SEQ ID NO. 4): 5'-CTGAAGGCTGCATTGTAACATCACTAA-3',

[0012] Reverse primer 1 (SEQ ID NO. 5): 5'-TGTCATCCTTGGTCATTGCTATTGGTA-3'.

[0013] Forward primer 2 (SEQ ID NO. 6): 5'-AGGCAAGGTCCTAATAGATACACTACA-3',

[0014] Reverse primer 2 (SEQ ID NO. 7): 5'-TGGCTGAACTATGAGAATGCTTAAGAG-3'.

[0015] The above primer pair can detect and type the SNPs sites in the gene region of the 120807212-120805413 segment of pig chromosome 8.

[0016] After PCR amplification, purification of PCR products, cloning and sequencing, and sequence comparison analysis using the above primer pairs, 22 genetic markers associated with pig meat production traits were screened. The nucleotide sequence of the genetic marker is as follows, wherein the mutation sites are located at positions 278, 343, 455, 527, 555, 641, 644, 713, 747, 792, and 859 of SEQ ID NO.2; and positions 415, 596, 610, 613, 637, 646, 662, 669, 672, 678, and 708 of SEQ ID NO.3. The specific sequences are as follows:

[0017] SEQ ID NO.1

[0018]

[0019] SEQ ID NO.2:

[0020] ACAGTAGGAACCAGTAACGATAACCATACCGATCTCGACCTCCCTTTAGTTCTCAAATGTAAGATGGAGTGACGGGGTTTGTCCAGTAAGAAGTCTGAGGTTTGTTAAGCACTCCCTACCCTTATACGTTGATGCCTCCTTTAGTGACTTCTTCTTTTTATTACGAGAGGGGAGTATCGTTTTCAGCCTAAGGATCTCCCGTTTTCTTCAAACTATGGAAAAACTTTACTTGAATTAAAATTTACGTTGGTGACCGAGAGGTCATTAAGTTCGGTAAR(A / G)ATACACTTCCGTTGTTTATCACAGTACCGTAACTTGTTTACCCTTTTAATTTTGATCCGTGTGTR(C / T)CAATTTTGGTGACAAAAAGTGTTAGTGTAAACTTTAGTACGCTTTGGGTTATTTTCTCGTACATTTTGTATTGGTTCTCTTGCTGATCCGAACCGACCACATCCTAAGTGTR(T / C)ACGTCTGGGTG GTATAAATTTAGGTTTGTTTACGATGTCGAGACGGTCGATCAGGACTATATAAGGTTCTTR(A / G)AATATCCCTCTAGACACTAGGTTTAATGACTAAACGACGAAACCAAATGTTATC TTGGGTAGGATAAGACAACATATACAACCGACTTGATACTCTTACGAATTCTCTAACAAR(A / G)CGR(A / G)ATCAGCGTTTACGTCCTCCCCTTCTACTTATCTTTCGAATATAGGAC ATAATTTCATATTTTTCTTTAR(G / T)CAAAATGTGTCCTTTTTTTTTATTACGTGGGTAR(A / G)GTTAGTCGAATCACTTTGATTTTATTGTGTTTGACAGAATTGTCR(T / C)CAATAAGTCTTTTTATATCTTTGAATGTGTGAACCAAATATTCTTCGTTTTTGATACTTATTGTGTR(C / T)CATCTCCTTCAAAAAGTTTACCTAAGAATCACTACAATGTTACGTCGGAAGTC

[0021] SEQ ID NO.3:

[0022] ACCGACTTGATACTCTTACGAATTCTCTAACAAACGAATCAGCGTTTACGTCCTCCCCTTCTACTTATCTTTCGAATATAGGACATAATTTCATATTTTTCTTTAGCAAAATGTGTCCTTTTTTTTTATTACGTGGGTAAGTTAGTCGAATCACTTTGATTTTATTGTGTTTGACAGAATTGTCTCAATAAGTCTTTTTATATCTTTGAATGTGTGAACCAAATATTCTTCGTTTTTGATACTTATTGTGTCCATCTCCTTCAAAAAGTTTACCTAAGAATCACTACAATGTTACGTCGGAAGTCTAAATTTTTCAAAACAGGTAGAAAGGCAGAACAAGGATATTTGTTTGTATCAGTTTCTTTTCTAACAATCAAGATTTAAAGTGAGAAGTTTTTGGTTCTTTTTACGGTTR(T / A)TATATAGGATAAATTGATAAACCGATTAAAGTTACAATTGTTACTACTTCAAGTGTAAAATTTTACACAAATCA CTTACACAAAGACTTAGATAATGTGTAGTATGACTGAAGTCCTTTGACAGGATCCTCAAGGACAGTATC GGGTCGTCTTTACTTAGGCTGATCCTTGGTACTCTAAR(C / T)ACCCAAGCTAGGGR(A / T)CTR(G / A)GA ACGAGTCACCCAATTCTTAGGR(T / C)CGTAACGGR(C / T)ACTCGACACCACATCR(T / C)AACGTCR(G / T)ACR(G / A)CCGAGR(C / T)CTAGGGCGCAACGACACCGAGACCGTATCR(T / C)GGCCCCCGATCTCGAGGTTAATCTGGGGATCAGACCCTTGGAGGTATACGGTGCCCACACCGGGATTTTTCTGTTTTCTGTTTTATTTATTTATTTATTTATTCTTTAACAGAATTTACCTTGAAGAGAAACTTTAAACTTAATTTATGTCAGTTGGTAAGTTTTTAACTAAAATCTCAATTTATAAATCAAAGTAACTTTGGTAGGTATTGTCTGTAGTTTATCACATTTTCTATACAAGGATTTTATACG TCTTCACCATTTGATTTAACTTTGTAAACTTTAAATAGTACTCAATAATTAGATTTACTTATTTGAGTTTAATATATCTTAAAGTATGACACGGAAAACAAATTTTACTCTATATGACCAATCTCGGATATTAAATCAAGTTAGGTAAGATTCTGTTGTAACGGTACAAGTTTTCGAATGACTTTCAATCGGGAAAGAAAGAGAGAGACATCACATAGATAATCCTGGAACGGA

[0023] The present invention also provides a method for screening genetic markers associated with pig growth, meat production traits and feed conversion efficiency, the method comprising the following steps:

[0024] Genomic DNA was extracted from the blood of Large White pigs. Primers were designed based on the genomic sequence from +168 downstream to +1632 bp upstream of the lncMGPF transcription start site. The above primers were used to amplify the pig genomic DNA by PCR, and the nucleotide sequence from +168 downstream to +1632 upstream of the lncMGPF transcription start site was obtained by direct sequencing (see SEQ ID NO.1 for details), which contained 22 SNP sites. The haplotype composed of 22 mutation sites can be used as a genetic marker to conduct association analysis on the growth rate, meat production and feed conversion rate related traits of pigs.

[0025] The present invention provides a genotyping method for detecting SNP sites in the above sequence.

[0026] The present invention provides an application of haplotype analysis of genotyping individuals by identifying 22 SNPs polymorphic sites.

[0027] The present invention further provides an application of using direct sequencing to determine the association analysis between individuals with different genotypes and traits related to growth rate, meat production and feed conversion rate.

[0028] For more detailed technical solutions, please see the "Specific Implementation Methods".

[0029] Compared with the existing technology, the advantages and beneficial effects are:

[0030] The present invention provides a molecular marker for the promoter region of the lncMGPF gene; the polymorphic sites involved are significantly correlated with age, eye muscle thickness and (30-100kg) feed-to-meat ratio traits in Large White pigs (P<0.05). Among them, the age and average feed-to-meat ratio of individuals with the combined haplotype H1-H1 genotype are significantly lower than those of individuals with the combined haplotype H2-H2 genotype (P<0.05); the eye muscle thickness of individuals with the combined haplotype H1-H1 genotype is significantly higher than that of individuals with the H2-H2 genotype (P<0.05). From the perspective of genetic stability and genetic progress, the combined haplotype H1-H1 has obvious advantages in reducing the age and (30-100kg) feed-to-meat ratio by up to 100kg body weight and increasing the eye muscle thickness trait. Explanations of the Figures

[0031] Figure 1 : The present invention clones and detects the segment 120807212-120805413 of porcine chromosome 8. The concentration of agarose gel is 1.5%. Explanation of reference numerals: Lanes 1-2, 3-4: 2 pairs of PCR amplification products, respectively, Lane M: DL2000Maker;

[0032] Figure 2 : Nucleotide sequence of segment 120807212-120805413 of porcine chromosome 8. Explanation of reference numerals: There are 22 mutation sites in the sequence shown, which are specific sites causing polymorphism in this segment;

[0033] Figure 3 : Sequencing results of the genetic marker sequence of the present invention. There are 22 double peak patterns, which are respectively from the base "A" mutated to "G", "C" mutated to "T", "T" mutated to "C", "A" mutated to "G", "G" mutated to "A", "A" mutated to "G", "A" mutated to "G", "G" mutated to "T", "A" mutated to "G", "T" mutated to "C", "C" mutated to "T", "T" mutated to "A", "C" mutated to "T", "A" mutated to "T", "G" mutated to "A", "T" mutated to "C", "C" mutated to "T", "T" mutated to "C", "G" mutated to "T", "G" mutated to "A", "C" mutated to "T" and "T" mutated to "C";

[0034] Figure 4 :The linkage disequilibrium analysis diagram of 22 SNPs polymorphic sites of the present invention, the left figure represents the D' value, and the right figure represents r 2 value. DETAILED DESCRIPTION

[0035] The present invention is described in detail below:

[0036] Example 1: Obtaining DNA fragments from the 120807212-120805413 region of porcine chromosome 8 and establishing a SNP detection method

[0037] Large White pigs were selected for the experiment, and two pairs of primers were designed based on the genome sequence of the 120807212-120805413 segment of chromosome 8 of pigs. The specific sequences are as follows:

[0038] Forward primer 1 (SEQ ID NO. 4): 5'-CTGAAGGCTGCATTGTAACATCACTAA-3',

[0039] Reverse primer 1 (SEQ ID NO. 5): 5'-TGTCATCCTTGGTCATTGCTATTGGTA-3'.

[0040] Forward primer 2 (SEQ ID NO. 6): 5'-AGGCAAGGTCCTAATAGATACACTACA-3',

[0041] Reverse primer 2 (SEQ ID NO. 7): 5'-TGGCTGAACTATGAGAATGCTTAAGAG-3'.

[0042] The above primers were used to perform PCR amplification on genomic DNA of pigs from different groups.

[0043] The PCR reaction system is shown in Table 1.

[0044] Table 1 PCR reaction system

[0045]

[0046] The PCR reaction conditions are shown in Table 2.

[0047] Table 2 PCR reaction conditions

[0048]

[0049] After the PCR products were purified and cloned, they were commissioned to Wuhan Hece Gene Technology Co., Ltd. for sequence determination. BLAST comparison analysis revealed 22 base mutations in the two sequences.

[0050] Example 2: Haplotype analysis and application of the genetic markers of the present invention and large white pigs

[0051] In order to determine the linkage disequilibrium relationship of 22 SNPs in the region 120807212-120805413 of chromosome 8 of pig, this embodiment selects large white pigs (741 heads) as experimental materials. Polymorphism detection is carried out by direct sequencing, and the correlation between polymorphic sites and haplotypes is analyzed. Haploview 4.1 software is used for linkage disequilibrium analysis and haplotype analysis, wherein 22 polymorphic sites are all in a strong linkage disequilibrium state, and the results show that 5 haplotypes can be formed, as shown in Table 3. The elimination frequency is less than 0.03, and two major haplotypes are generated, namely H1 (SEQ ID NO.8): GTCGAGGTGCTACTGCTCGATC, H2 (SEQ ID NO.9): ACTAGAAGATCTTAATCTTGCT.

[0052] Table 3 Haplotype analysis of lncMGPF gene in Large White pigs

[0053]

[0054] Example 3: Association analysis and application of the genetic markers of the present invention with growth, meat production traits and feed conversion rate of Large White pigs

[0055] In order to determine the correlation between the haplotype composed of 22 SNPs in the 120807212-120805413 region of chromosome 8 and the phenotypic differences of pigs, this example selected large white pigs (741 heads) as experimental materials. Polymorphism detection was performed by direct sequencing, and the correlation between polymorphic sites and pig growth, meat production traits and feed conversion rate was analyzed. The mixed linear model (Mixed) in SAS 8.0 statistical software was used to analyze the association between genotype and phenotypic values. Among them, the analysis model of large white pigs is as follows: ijkl =u+G i +F j +S k +B l +ε ijklm , where Y ijkl is the observed value of the trait; u is the total average value of the trait; G i is the genotype effect; F j , S k , B l are fixed effects, namely family, gender, and batch effects; ε ijklm is a random error, assuming that it obeys N(0, σ 2 )distributed.

[0056] After polymorphism detection of 22 loci in the 120807212-120805413 region of chromosome 8, three genotypes were detected in the above-mentioned Large White pig population. The genotype frequencies and their distribution are shown in Table 4.

[0057] Table 4 Genotype frequency and allele frequency of polymorphic loci in Large White pig population

[0058]

[0059] It can be concluded from Table 4 that the frequency of H1-H1 allele in the polymorphic site is higher than that of H2-H2 allele in the Large White pig population.

[0060] Table 5 Association analysis between polymorphic loci and traits related to growth, meat production and feed conversion rate

[0061]

[0062] Note: The above values ​​are least squares mean ± standard error. In each pig breed, capital letters in the same column indicate extremely significant differences (P<0.01), lowercase letters indicate significant differences (P<0.05), the same letters in the same column indicate no significant differences (P>0.05), different letters indicate significant differences (P<0.05), and unmarked letters indicate no significant differences (P>0.05).

[0063] The analysis of Table 5 showed that the polymorphic loci were significantly correlated with age, eye muscle thickness and (30-100kg) feed-to-meat ratio in Large White pigs (P<0.05). Among them, the age and average feed-to-meat ratio of individuals with combined haplotype H1-H1 were significantly lower than those of individuals with combined haplotype H2-H2 genotype (P<0.05); the eye muscle thickness of individuals with combined haplotype H1-H1 was significantly higher than that of individuals with H2-H2 genotype (P<0.05). From the perspective of genetic stability and genetic progress, combined haplotype H1-H1 has obvious advantages in reducing age at 100kg body weight and (30-100kg) feed-to-meat ratio and increasing eye muscle thickness. Based on the above results, the haplotype loci composed of 22 SNPs can be used as molecular breeding markers to increase pig growth, meat production traits and feed conversion rate.

[0064] In summary of the specific implementation methods, it should be noted that: the above embodiments are only used to explain the technical methods of the present invention, and the application scope of the present invention is not limited to the examples listed; through the explanation of the present invention by the above embodiments, researchers in the field should understand that: researchers can modify the technical solutions described in the above embodiments, and replace part or all of the technical features of the embodiment solutions with equivalents; and these modifications and replacements, as long as the technical solutions produced do not deviate from the essence of the technical solution of the present invention, are all within the scope of implementation of the technical solution of the embodiment of the present invention.

Claims

1. A haplotype for traits related to pig growth, meat production and feed conversion efficiency, characterized in that: The haplotype includes a polymorphic site, which is located on the gene sequence of the 120807212-120805413 segment of pig chromosome 8, and the nucleotide sequence of the segment is shown in SEQ ID NO.

1. There are 22 SNP sites in the segment.

2. A haplotype for traits related to pig growth, meat production and feed conversion efficiency, characterized in that: The haplotype includes polymorphic sites, which are located on two interval gene sequences in the 120807212-120805413 segment of pig chromosome 8. The nucleotide sequences of the two intervals are shown in SEQ ID NO.2 and SEQ ID NO.

3. There are 22 SNP sites in the two intervals.

3. The haplotype according to claim 1 or 2, characterized in that: The mutations of the sites are respectively in the following positions of porcine chromosome 8: at base 120806935, the base changes from A to G; at base 120806870, the base changes from C to T; at base 120806758, the base changes from T to C; at base 120806686, the base changes from A to G; at base 120806658, the base changes from G to A; at base 120806572, the base changes from A to G; at base 120806569, the base changes from A to G; at base 120806500, the base changes from G to T; at base 120806466, the base changes from A to G; at base 120806421, the base changes from T to C; at base 120806354 , the base changes from C to T; at the 120806191th base, the base changes from T to A; at the 120806010th base, the base changes from C to T; at the 120805996th base, the base changes from A to T; at the 120805993rd base, the base changes from G to A; at the 120805969th base, the base changes from T to C; at the 120805960th base, the base changes from C to T; at the 120805944th base, the base changes from T to C; at the 120805937th base, the base changes from G to T; at the 120805934th base, the base changes from G to A; at the 120805928th base, the base changes from C to T; at the 120805898th base, the base changes from T to C.

4. Application of a haplotype related to pig growth, meat production and feed conversion rate in pig breeding.

Images