Application of plant miRNA156a in preparation of medicine for treating myocardial injury diseases

Abstract

The invention relates to application of plant miRNA156a in preparation of a medicine for treating myocardial injury diseases, the miRNA156a is the plant miRNA156a, the plant is selected from salvia miltiorrhiza, liquorice, spinach, cabbage and broccoli, preferably, the miRNA156a is the salvia miltiorrhiza miRNA156a, the miRNA156a has the following nucleotide sequence: UGACAGAAGAGUGAGCAC (5 '-3'), and the miRNA156a can be modified by a chemical group, for example, the 3'end is modified by 2 '-O-CH3.

Description

Technical Field

[0001] The present invention relates to an application of a nucleotide fragment, and in particular to an application of miRNA156a in preparing a medicine for treating myocardial injury diseases. Background Art

[0002] MicroRNA (miRNA) is a type of non-protein coding short RNA molecule with a length of about 19 to 25 nucleotides (nt) widely found in eukaryotes. It is generated by a single-stranded RNA precursor (pre-miRNA) with a hairpin structure of 70-80 nt, which is cut by Dicer enzyme. It is highly conservative, time-specific and tissue-specific. After these non-coding small RNA molecules are complementary to the 3' uncoding region (3'UTR) of the target gene mRNA molecule, they can participate in the regulation of target gene expression by reducing the stability of mRNA molecules and inhibiting translation. They can regulate gene expression in a sequence-specific manner and play a role that cannot be ignored in development, apoptosis, metabolism and human diseases. According to computer calculations, about 1% of known human genes may encode miRNAs, and miRNAs may regulate 10% to 30% of the genes in the human genome. The scope of their participation in regulation involves multiple processes such as cell differentiation, proliferation, apoptosis, metabolism and growth and development. Due to its powerful and specific gene regulation capabilities, it has been widely used in basic research on gene function and research on human disease models, including screening of drug targets, analysis of potential side effects of candidate drugs, testing of gene therapy, and screening of functional defects.

[0003] miRNA is one of the current research focuses and hotspots in the cardiovascular field. Many research results suggest that miRNA plays an important role in the pathogenesis of cardiovascular diseases. For example, miR-1, miR-133, miR-155, miR-122, miR-221 / 222, miR-21, miR-145, miR-126, miR-320, etc. However, these miRNAs all come from animals. Since animals and plants are two completely different directions in the evolutionary process, specifically: in terms of mode of action, animal miRNA and its target gene are not completely complementary base pairing, while plant miRNA generally binds to the targeted mRNA in a nearly completely complementary manner. Structurally, unlike animal miRNA, the 3' end of plant miRNA is methylated, and the structure determines the properties, so miRNAs from different sources may exhibit different regulatory effects.

[0004] Plant miRNAs are usually modified by oxygen methylation at the 3' end, which makes them relatively stable and not easily degraded. The structure of plant miRNA is very similar to that of human miRNA, but not exactly the same. It has been found that exogenous plant miRNAs can enter the animal body through the digestive system or blood system and regulate the functions of tissues and cells. For example, miRNA2911 in honeysuckle can be detected in the serum and urine of mice, and the molecular level of miRNA2911 is related to the level of dietary intake. In addition, stable miR2911 was also found in the decoction of honeysuckle liquid, which can directly target multiple subtypes of influenza viruses (H1N1, H5N1 and H7N9) in animals, inhibit viral replication, prevent weight loss in mice caused by viral infection, and significantly reduce the mortality of mice caused by H5N1 virus infection.

[0005] Studies have reported that in vitro experiments of miR156a from vegetables showed that plant miR156a can target junction adhesion molecule-A (JAM-A), which is upregulated in patients with atherosclerosis. miR156 reduces the adhesion of monocytes to vascular endothelial cells induced by inflammatory cytokines by inhibiting the expression of JAM-A, thereby protecting blood vessels and improving the development of atherosclerosis.

[0006] At present, there are relatively few studies on the phenomenon of plant miRNA cross-border regulation of animal cell gene expression. The miRNAs and corresponding targets that have been discovered include miR168a: LDLRAP1; miR156a: JAM-A, etc. The former affects blood lipid metabolism, and the latter has anti-tumor activity. MiRNA156 has a certain cross-border regulatory effect, and its indications include atherosclerosis, tumors, and improvement of intestinal and immune system functions. The existing patents also disclose content related to miRNA156a regulating plant growth response, but there is no technical disclosure of its cross-border regulatory related effects. It is still unknown whether miRNA156 can also play a role in controlling other diseases in the human body. Summary of the invention

[0007] The present invention provides use of miRNA156a in preparing a medicine for treating myocardial injury diseases.

[0008] The miRNA156a is plant miRNA156a.

[0009] The plants are selected from the group consisting of: salvia miltiorrhiza, liquorice, spinach, cabbage, and broccoli.

[0010] Preferably, the miRNA156a is Salvia miltiorrhiza miRNA156a

[0011] The Salvia miltiorrhiza miRNA156a has the following nucleotide sequence:

[0012] UGACAGAAGAGAGUGAGCAC(5'-3').

[0013] Wherein, the miRNA156a may be modified by chemical groups, such as: the 3' end is modified by 2'-O-CH3;

[0014] The drug is a pharmaceutical composition with miRNA156a as the active ingredient, and the pharmaceutical composition is in the form of a unit-dose pharmaceutical preparation that can be taken, such as tablets, capsules, granules, pills, powders, and injections. The dosage of miRNA156a as the active ingredient when used in humans or animals is 1ug-0.2mg / kg.

[0015] Among them, the myocardial injury disease is selected from: myocardial ischemia, myocardial infarction, myocardial ischemia-reperfusion injury, and coronary heart disease.

[0016] The nucleotide sequence and structure of the plant miRNA156a described in the present invention belong to the prior art and can be prepared by chemical synthesis or purchased.

[0017] Chemical synthesis method: Oligonucleotides are synthesized using the solid phase phosphoramidite triester method.

[0018] The compound in which the 3' end of miRNA156a is modified with 2'-O-CH3 can be prepared by the following method: terminal modification of the monomer is performed by chemical synthesis, and then the modified monomer is connected with other sequences.

[0019] Beneficial Effects

[0020] As a single component, plant miRNA156a can exist stably in the body and play a cross-border regulatory role. Experiments have shown that plant miRNA156a can match the HIF3A 3'UTR region and significantly inhibit HIF3A expression. The two have an obvious targeting relationship. Plant miRNA156a significantly increases the proliferation rate of cardiomyocytes, significantly improves cardiomyocyte damage, has a protective effect on the heart, and can reduce the area of ​​myocardial ischemia in rats with myocardial ischemia (the degree of improvement is close to 60%), which indicates its potential therapeutic effect. The new structure of plant miRNA156a provides data support for the development of small nucleic acid drugs and the analysis of the mechanism of traditional Chinese medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Target gene validation of miRNA

[0022] Figure 2Relative content of miRNA156a in serum of rats at different time points after intragastric administration of Salvia miltiorrhiza aqueous extract

[0023] Figure 3 Relative content of miRNA156a in serum of rats at different time points after intragastric administration of miRNA156a

[0024] Figure 4 Preliminary Experimental Exploration of H2O2 Modeling Concentration

[0025] Figure 5 Improvement effect of plant miRNA156a on cardiomyocyte injury model

[0026] Figure 6 Exploration of drug efficacy based on ISO-induced model. A. Blood flow velocity, B. Cardiac output

[0027] #,P<0.05vs Control.*,P<0.05vs model.##,P<0.01vs control.**,P<0.01vsmodel

[0028] Note: In the miRNA156-OH group, only the 5μM concentration of the fish hatched successfully, while the other concentrations did not hatch successfully

[0029] Figure 7 Effects of the test substances on ISO-induced myocardial ischemia in rats

[0030] Figure 8 TTC staining results of heart tissues in each group

[0031] Fig. 9 Expression of HIF3A in myocardial tissue samples of each group DETAILED DESCRIPTION

[0032] Example 1 Target gene verification of miRNA156a

[0033] Objective: To use the dual luciferase reporter gene detection experiment, that is, insert the target gene sequence predicted to bind to miRNA into the reporter plasmid vector to construct the luciferase plasmid. After co-transfection, the fluorescence value is used to determine whether the miRNA binds to the predicted target gene.

[0034] Experimental Materials

[0035] 1) Experimental cells: Human embryonic kidney cells (HEK293T), provided by the cell bank of the Center for Pharmacology and Toxicology Research.

[0036] 2) Test products: Synthetic mature miRNA mimics (numbered 156a, with -2'-O-CH3 modification at the 3' end of the sequence) were purchased from Jinweizhi Biotechnology, and the luciferase reporter gene plasmid used in the experiment was purchased from Promega and Nanjing Jinbeijin Biotechnology.

[0037] 3) Other drugs and reagents:

[0038] name company DMEM medium Gibco Universal Plant microRNA (miRNA) Extraction Kit Beijing Biotech Biotechnology Co., Ltd. Dual luciferase reporter gene assay kit Biyuntian Biological <![CDATA[Lipofectamine TM 3000 Transfection Reagent]]> Thermo Fisher Scientific (China) Co., Ltd.

[0039] 4) Experimental instruments

[0040] name company BS224s electronic balance Beijing Sartorius Instrument Systems Co., Ltd. LDZ5-2 centrifuge Beijing Medical Centrifuge Factory Z323K Desktop Low Temperature Centrifuge HermLe Company of Germany KQ-250E Ultrasonic Cleaner Kunshan Ultrasonic Instrument Co., Ltd. Infinite M200 Multi-function Microplate Reader Tecan

[0041] Experimental methods

[0042] 1 Cell culture

[0043] This study used HEK293T cells, a tool cell with high transfection efficiency:

[0044] (1) DMEM complete medium (DMEM + 10% FBS + 1% P / S) was used to culture the cells at 37°C and 5% CO2;

[0045] (2) When the cells grow to 70-90% density, the cells are collected by digestion, centrifugation, and resuspending with 1 ml of culture medium. 10 μL of the cells are placed on a cell counting plate for counting. The above cells are set aside for transfection.

[0046] 2 Experimental Grouping

[0047] The experiment was carried out in the following groups, with three replicate wells in each group.

[0048]

[0049]

[0050] Note: 1. The synthesized miRNA has 2′-O-CH3 modification at the 3′ end. 2. In the construction of the dual luciferase vector, the RNAhybrid database is first used to predict the binding match between the miRNA seed region and the target gene, and the plasmid is constructed accordingly. WT is the wild type constructed by the miRNA corresponding to the 3'UTR site sequence of the target gene into the pGL3-basic vector. MuT is the mutant type constructed by the miRNA corresponding to the target gene target site after base mutation.

[0051] based on 3000 reagent for cell transfection

[0052] First, a dual-luciferase reporter gene vector containing the 3'UTR sequence of the target gene is constructed, and then the microRNA is co-transfected. The decrease in luciferase activity indicates that it is the target sequence. 3000 reagent, co-transfect the vector and miRNA according to the operating instructions, and simultaneously transfect phRL-tk (Renilla luciferase) as an internal control.

[0053] Dual luciferase reporter gene assay analysis

[0054] This part adopts dual luciferase reporter gene detection kit (Dual Luciferase Reporter Gene Assay Kit) to carry out, first with luciferin (luciferin) as substrate to detect firefly luciferase (Fireflyluciferase), after with enteroluminal element (coelenterazine) as substrate to detect Renilla luciferase (Renillaluciferase), and when adding Renilla luciferase substrate in the follow-up, add the material that suppresses firefly luciferase catalysis luciferin luminescence simultaneously, make subsequent detection only detect the activity of Renilla luciferase, realize dual luciferase reporter gene detection.Measure RLU (relative light unit) value in the above-mentioned dual luciferase gene detection experiment by microplate reader, when with Renilla luciferase as internal reference, measure the RLU value obtained with firefly luciferase divided by the RLU value obtained by Renilla luciferase.Compare the activation degree (Relative luciferase activity) of purpose reporter gene between different samples according to the ratio obtained.

[0055] Data processing

[0056] The research data were expressed as mean ± standard deviation (Mean ± SD), and the independent sample T test (T-Test) was used for comparison between groups. P < 0.05 indicated that the statistical data had a significant difference.

[0057] Experimental Results

[0058] Depend on Figure 1 As shown in the figure, in the miRNA156a and HIF3A group, the ratio of miR156a to HIF3A-WT (i.e., wild-type group) was significantly lower than that of miR156a to HIF3A-MuT (i.e., mutant group), and the ratio of the wild-type group was also significantly lower than that of ncRNA to HIF3A-WT (i.e., negative control group), which further indicates that miR156a can match the HIF3A 3'UTR region and significantly inhibit HIF3A expression, and the two have an obvious targeting relationship.

[0059] Example 2 In vivo pharmacokinetic characteristics of plant miRNA156a

[0060] Objective: To analyze the content of miRNA156a entering the body by RT-qPCR experimental technology, determine the stability of exogenous miRNA, and provide a reference for the design of subsequent efficacy experiments.

[0061] 1. Experimental Materials

[0062] 1.1 Test sample

[0063] (1) Salvia miltiorrhiza aqueous extract: provided by the Institute of Pharmacology and Toxicology of Tasly Pharmaceutical Group Co., Ltd.

[0064] (2) Primers: 5X ath-miR156a (reverse transcription primer), 20X ath-miR156a (qPCR primer probe) and 5X cel-miR-39 primer (reverse transcription primer), 20X cel-miR-39 (qPCR primer probe). The above primers were purchased from Thermo Fisher Scientific and Tianjin Qianhui Technology, respectively.

[0065] 1.2 Experimental instruments

[0066] name company LDZ5-2 centrifuge Beijing Medical Centrifuge Factory Z323K Desktop Low Temperature Centrifuge HermLe Company of Germany KQ-250E Ultrasonic Cleaner Kunshan Ultrasonic Instrument Co., Ltd. VS-1300U clean bench -- Nucleic acid analyzer (ultra-micro spectrophotometer) -- 7500 Fluorescence Quantitative PCR Instrument Thermo AF100 Ice Maker --

[0067] 1.3 Other reagents and materials

[0068]

[0069] 2. Experimental Animals

[0070] Twenty-one SD male rats that met the SPF standard were selected, and the experimental animal quality certificate number was: No.110011230102585052.

[0071] Supplier: Beijing Weitonglihua Experimental Animal Technology Co., Ltd., production unit license number: SCXK(Beijing)2021-0006.

[0072] 3. Experimental Methods

[0073] 3.1 Experimental groups and drug administration

[0074] SD rats were randomly divided into a blank control group, a Salvia miltiorrhiza water extract group, and a miRNA156a (with -2'-O-CH3 modification at the 3' end of the sequence) group. The experimental groups and animal dosing conditions are shown in Table 1.

[0075] Table 1 Experimental groups and drug administration

[0076]

[0077] 3.2 Experimental design

[0078] The SD rats were randomly divided into groups according to the above grouping arrangement, and then placed in an SPF-grade breeding room, given sufficient normal feed and water every day, and raised in a 12-h day / 12-h night light environment for 1 week. [1,2] , the drugs were administered according to the above experimental grouping, and the rats were fasted and deprived of water within 12 hours before administration. After the administration, blood and heart tissue samples (for backup) were collected from the above two groups of rats at different time points (0, 3, 6, and 12 hours), and samples from 3 rats were taken at each time point. After the fresh blood was collected, it was placed at room temperature for 20-60 minutes. After the blood was completely coagulated, it was centrifuged at 1600g for 10 minutes at 4°C; the supernatant was carefully transferred to a new sample tube, centrifuged at 16,000g for 10 minutes, and the supernatant was transferred to a new enzyme-free sample tube. After collecting the serum, the tubes were clearly labeled for RNA extraction and determination.

[0079] 3.3 Sample processing

[0080] (1) After fresh blood is collected, place it at room temperature for 20-60 minutes. After the blood is completely coagulated, centrifuge it at 4°C, 1600g (3000rpm) for 10 minutes. Carefully transfer the upper light yellow serum to another centrifuge tube (conical bottom). The first centrifugation can remove cells and platelets.

[0081] (2) Centrifuge the supernatant at 4°C, 16,000 g for 10 min to remove cell debris and transfer the supernatant to another sterile EP tube. If the sample is to be used on the same day, it can be directly stored at 4°C. If it needs to be stored for a long time, place it in a -80°C refrigerator.

[0082] 3.4 Extraction of total RNA from serum

[0083] Serum separation process: Before use, the serum was thawed at room temperature. To further remove the precipitate, the sample was centrifuged at 4°C, 3000 rpm for 5 min, and the supernatant was taken for later use. RNA was extracted from the serum according to the instructions of the miRNeasy Serum / Plasma Kit.

[0084] 3.5qPCR experimental steps

[0085] (1) Preparation of reverse transcription premix: Thaw the Taqman MicroRNA Reverse Transcription Kit on ice and vortex to mix. Prepare the reverse transcription premix on ice and in a nuclease-free tube:

[0086] Composition Reaction system 100mM dNTPs (with dTTP) 0.15μl Reverse transcriptase 1.00μl 10X reverse transcription buffer 1.50μl RNase inhibitors 0.19μl Nuclease-free H2O 4.16μl Total volume 7.00μl

[0087] Vortex mix, centrifuge, and place on ice until ready to use

[0088] (2) Melt the 5X reverse transcription primer and RNA template on ice and vortex to mix.

[0089] (3) Add 1-10 ng RNA (5 ul), 7 ul reverse transcription premix, and 3 ul reverse transcription primer to 15 ul reverse transcription system, vortex to mix, and centrifuge.

[0090] (4) Place on ice for 5 min and perform reverse transcription experiment.

[0091] (5) Set up the reverse transcription step: Place the reaction tube into the PCR instrument and set up the reaction according to the following procedure.

[0092] Mode: Standard mode, Reaction volume: 15 μl

[0093]

[0094]

[0095] 3.6 Quantitative PCR reaction system

[0096] (1) Melt the components used in the reaction on ice, mix them well and place them on ice for later use;

[0097] Composition Reaction system <![CDATA[TaqMan Universal PCR Master Mix II,no UNG 1 ]]> 10.00μl ddH2O 7.67μl Taqman MicroRNA Assay (20X) 1.00μl Reverse transcription product (cDNA) from step 4.5 <![CDATA[1.33μl 2 ]]> Total volume 20.00μl

[0098] 1.Taqman Universal PCR Master Mix II with UNG can also be used for TaqMan MicroRNA Assay.

[0099] 2. Add up to 1.33 μl of reverse transcription product to each reaction

[0100] (2) Calculate the required amount of reagents based on a 20 μl reaction system. Add each component to a centrifuge tube, vortex to mix, and centrifuge.

[0101] Note: It is recommended to perform 3 replicates for each reaction.

[0102] (3) Prepare the quantitative PCR reaction plate

[0103] i. Add 20 μl of reaction solution to each reaction well.

[0104] ii. Seal the membrane of the reaction plate or cover the cap of the eight-tube strip tightly and centrifuge to avoid generating bubbles.

[0105] (4) Run the quantitative PCR reaction program

[0106] i. Reaction program: Standard mode; Reaction volume: 20 μl; Set the reaction program as follows

[0107] TaqMan TM Fast Advanced Master Mix(7500 and 7500 Fast systems with fastcycling mode)

[0108]

[0109] (5) Place the reaction plate into the quantitative PCR instrument and start the reaction.

[0110] 4. Detection indicators

[0111] 4.1 Relative content of miRNA156a

[0112] Relative quantitative calculation formula:

[0113] ΔCt to be tested = Ct to be tested - Ct internal reference (to be tested)

[0114] ΔΔCt to be tested = ΔCt to be tested - ΔCt control

[0115] F=2 -ΔΔCt

[0116] F=2 -(待测组目的基因平均Ct值-待测组内参基因平均Ct值)-(对照组目的基因平均Ct值-对寨组内参基因平均Ct值)

[0117] Note: The above formula presents the calculation method of relative quantification. The final result will be automatically exported in the instrument without calculation.

[0118] 5. Experimental Results

[0119] In this experiment, a single intragastric administration of Salvia miltiorrhiza water extract and miRNA156a was performed, and blood was collected from the abdominal aorta at 0h, 3h, 6h, and 12h, respectively. Serum was collected by centrifugation, and total RNA in the rat serum was extracted using an RNA extraction kit. Relative fluorescence quantification experiments were performed using the Taq-Man probe method to detect the miRNA156a content in each time period and to determine the kinetic level of exogenous miRNA in vivo.

[0120] 5.1 Detection and analysis of miRNA156a in rat serum samples

[0121] After intragastric administration of Salvia miltiorrhiza water extract ( Figure 2 ), the relative content of plant miRNA156 in the circulatory system showed a trend of first increasing and then decreasing, and reached the maximum absorption peak at 3h and gradually decreased to the basic level at 12h, indicating that miRNA156a in the water extract has a certain stability in vivo.

[0122] Different from the above-mentioned intragastric administration of water extract, after administration of plant miRNA156a, the relative content of circulating miRNA156a showed two absorption peaks ( Figure 3 ), 3h and 12h after administration, respectively. Preliminary analysis shows that the above situation may be caused by the special absorption mechanism of miRNA. From the perspective of traditional digestive physiology, the stomach is an organ for storing food, and its own absorption function is very weak. It only absorbs a small amount of water, inorganic salts, and a few substances (such as alcohol and aspirin), while large molecular nucleic acids must be digested into small molecular nucleotides, nucleosides and bases through the intestine before being absorbed into intestinal epithelial cells. Earlier, Zhang Chenyu's team found that the basal level of exogenous miRNA in the blood of SIDT1 knockout mice was significantly reduced, and the absorption function of exogenous miRNA was impaired. Therefore, exogenous miRNA can remain stable and be absorbed in the digestive tract. Its main absorption mechanism is SIDT1 on the apical cells of the gastric mucosa in animals. This protein is a key protein for the intake of food miRNA, thus clarifying that the stomach is the main site for the absorption of food miRNA.

[0123] 6. Experimental Conclusion

[0124] The study found that by directly administering Salvia miltiorrhiza water extract or exogenous miRNA156a, plant miRNA156a can be detected in the circulatory system, and the maximum absorption is reached in 3 hours, and then gradually returns to the basic level. Therefore, plant miRNA156a has a certain stability in the body, and this study provides a reference for the setting of the dosing cycle in subsequent drug efficacy.

[0125] Example 3 Experiment on the effect of miRNA156a on myocardial cell injury in vitro

[0126] Objective: To establish a H2O2-induced H9c2 rat cardiomyocyte injury model and investigate the cardiomyocyte protective effect of plant miRNA.

[0127] 1. Experimental Materials

[0128] 1) Experimental cells: rat cardiomyocytes (H9c2), source: provided by the cell bank of the Center for Pharmacology and Toxicology Research, generation P4.

[0129] 2) Test products: Synthetic mature miRNA mimics (numbered 156a, with -2'-O-CH3 modification at the 3' end of the sequence; 156a-OH, with no modification at the 3' end of the sequence) were purchased from GeneWeiZhi Biotechnology.

[0130] 3) Other drugs and reagents:

[0131]

[0132] 4) Experimental instruments

[0133] name company LDZ5-2 centrifuge Beijing Medical Centrifuge Factory Z323K Desktop Low Temperature Centrifuge HermLe Company of Germany KQ-250E Ultrasonic Cleaner Kunshan Ultrasonic Instrument Co., Ltd. Infinite M200 Multi-function Microplate Reader Tecan

[0134] 2. Experimental Methods

[0135] In this study, rat cardiomyocytes (H9c2) were used to construct the model and evaluate the efficacy of the drug.

[0136] 2.1 Cell culture

[0137] (1) DMEM complete medium (DMEM + 10% FBS + 1% P / S) was used to culture cells at 37°C and 5% CO2 (refer to internal SOP);

[0138] (2) When the cells grow to 70-90% density, the cells are collected by digestion, centrifugation, and resuspending with 1 ml of culture medium. 10 μL of the cells are placed on a cell counting plate for counting. The above cells are set aside for plating.

[0139] 2.2 Experimental Grouping

[0140] The experiment was carried out in the following groups, with three replicate wells in each group, and the cell density was 5000 / well.

[0141]

[0142] *Note: The dosage setting refers to the recommended dosage of the transfection kit

[0143] 2.3 Construction of H2O2-induced myocardial injury model

[0144] Studies have shown that hypoxia-inducible factor (HIF) can participate in angiogenesis, energy metabolism, and cell apoptosis in an oxygen-level-dependent manner, and cause drastic changes in the gene expression profiles encoding glycolytic enzymes, vascular endothelial growth factor, erythropoietin, and other factors in a tissue-specific manner, thereby showing the response of cells to hypoxia. Oxidative stress plays an important role in the process of myocardial cell necrosis and apoptosis in myocardial ischemia-reperfusion. It is the excessive production of reactive oxygen free radicals in the body, the imbalance of the oxidative system and the antioxidant system, which leads to tissue and cell damage. Free radicals are produced by excessive reactive oxygen and reactive nitrogen free radicals, which can damage fats, proteins, and nucleotides. Reactive oxygen free radicals, nitrogen free radicals, and hydrogen peroxide play an important role in myocardial ischemia / reperfusion damage. Therefore, this part uses a hydrogen peroxide-induced model to simulate the above pathological changes.

[0145] In this experiment, the in vitro drug efficacy evaluation was carried out using the H2O2-induced cardiomyocyte injury model. The specific operation was as follows: routine cell culture and plating were performed according to 2.1. According to the previous modeling agent concentration exploration experiment, 500-600 μM H2O2 was added to the 96-well plate to treat the cells (such as Figure 4 As shown, the initial modeling concentration has been explored in preliminary experiments and selected), and conventional culture for 2 hours can cause cell damage.

[0146] 2.4 Cell transfection

[0147] Lipofectamine TM RNAiMAX transfection reagent provides high transfection efficiency in a variety of cell types for siRNA-mediated gene knockdown experiments. TM RNAiMAX is a proprietary RNAi-specific cationic lipid formulation designed for delivery of siRNA and miRNA to all cell types. RNAiMAX Reagent Kit Instructions.

[0148] 3. Observation indicators

[0149] Cell Counting Kit-8 (CCK-8) is a highly sensitive, non-radioactive colorimetric method used to detect the number of live cells in cell proliferation and cytotoxicity experiments. According to the instructions of the kit, the OD value of each well was measured at a detection wavelength of 450nm using an ELISA reader to calculate the effect of the drug-treated group on the cell survival rate relative to the non-drug-treated group.

[0150] 4. Experimental Results

[0151] In this experiment, 600 μM was used as the modeling concentration to evaluate the in vitro efficacy of plant miRNA. Figure 5 As shown in the figure, in the miRNA156a transfection group, the cell proliferation rate increased significantly at a dose of 5-200pmol (P<0.05), which means that it has a potential protective effect on cardiomyocytes. It increased in a dose-dependent manner at 5-10pmol, and the effect gradually weakened with the increase of the intervention dose. This proves that miRNA156a has the greatest positive effect on cell survival rate at a dose of 10pmol.

[0152] In order to evaluate the reliability of the above effects, a control group was set up in this experiment to explore the potential effects of non-plant-derived miRNA156a-OH without methoxy modification at the 3' end. The results showed that ( Figure 5 ), under the same transfection conditions, only 5pmol showed a trend of myocardial protection, but there was no significant difference (P>0.05). After 10-200pmol intervention, the effect of miRNA156a-OH gradually weakened and even aggravated cell damage. The above results preliminarily prove that plant-derived miRNA156a has a specific protective effect on myocardial injury cell models.

[0153] 5. Experimental Conclusion

[0154] By establishing a H2O2-induced H9c2 cardiomyocyte injury model, it was preliminarily demonstrated that plant miRNA156a significantly increased the proliferation rate of cardiomyocytes and had a significant effect on improving cardiomyocyte injury.

[0155] Example 4: Pharmacological efficacy experiment of miRNA156a against zebrafish myocardial injury model

[0156] Objective: To evaluate the pharmacological effects of miRNA156, this study plans to use zebrafish model animals to construct a myocardial injury model based on different induction mechanisms (ISO, verapamil) and comprehensively evaluate the cardioprotective effect of plant miRNA156a.

[0157] 1. Experimental Materials

[0158] 1.1 Test samples

[0159] (1) Positive drug: Digoxin, white powder, batch number 002q2r, purchased from European Pharmacopoeia Reference Stardard, prepared with DMSO to a stock solution of 1 mg / mL before use.

[0160] (2) Experimental samples: Synthetic mature miRNA mimics (numbered 156a, with -2'-O-CH3 modification at the 3' end of the sequence; 156a-OH, with no modification at the 3' end of the sequence) were purchased from GeneWeiZhi Biotechnology and prepared immediately before use.

[0161] 1.2 Other reagents used in the experiment

[0162] (1) Isoproterenol hydrochloride (molecular weight: 247.72), white powder, batch number: MI5VB-DI, purchased from TCI (Shanghai) Chemical Industry Development Co., Ltd., prepared into a 60 mg / ml liquid using filtered zebrafish culture medium.

[0163] (2) Dimethyl sulfoxide (DMSO, Sigma, batch number BCBN0845V).

[0164] (3) Zebrafish culture medium Holt buffer: NaCl 3.5 g, KCl 0.05 g, NaHCO3 0.025 g, CaCl2 0.1 g were dissolved in double distilled water.

[0165] (4) Phenol red (molecular weight: 354.38), dark red powder, batch number: P8460, purchased from Solebol.

[0166] (5) Agarose 100g: (molecular weight 306.26), white or slightly yellow powder, batch number 9012-36-6.

[0167] 2.3 Instruments and reagents

[0168] (1) Microscope (BX-53, OLYMPUS);

[0169] (2) Heartbeat and blood flow analysis system (Zebralab3.3 (PB2084C), ViewPoint Life Sciences, France);

[0170] (3) 12-well plate (Costar, Corning Incorporated, 3513);

[0171] (4) Precision electronic balance (XP205, METTLER TOLEDO); electronic balance (JJ100B, G&G);

[0172] (5) Stereo fluorescence microscope (OLYMPUSBX53)

[0173] (6) Oil-free bass air compressor (750A, Taizhou Fujiwara Tools Co., Ltd.);

[0174] (7) PC-100 Needle Puller

[0175] 2. Experimental Animals

[0176] Wild-type AB zebrafish were bred by natural pair mating. The age was 2 days after fertilization (cardiac phenotype can appear as early as 48 hpf in the embryonic stage). Zebrafish were raised in 28°C fish water (the Aisheng zebrafish breeding equipment automatically adjusts the water quality: pH 7.2-7.6; resistivity 500-550), and were bred and provided by the zebrafish laboratory of the Tasly Institute of Pharmacology.

[0177] 3. Experimental Methods

[0178] 3.1 miRNA microinjection

[0179] After egg collection, turn on the zebrafish stereo microscope, air pump, microinjection pump, computer, and needle puller in sequence. Adjust the needle puller parameters to step 1:90 and step 2:90 (default values), install the glass needle, and press the switch. The needle puller will be completed in about 10 seconds.

[0180] After 200ul of phenol red solution is sucked up with a gun, the phenol red solution is injected into the drawn glass needle for microinjection through the sample injection needle, and the needle is gently broken with tweezers under a microscope;

[0181] Adjust the balance parameters of the syringe pump under the microscope until there are no bubbles or back suction in the glass needle;

[0182] Under a microscope, quantification was performed by adjusting the injection parameters (pressure and intensity) on a calibration ruler dripped with mineral oil. The injection volume in this experiment was 4 nl;

[0183] After the quantitative injection of the glass needle is completed, an appropriate amount of fish eggs are drawn from the culture dish and arranged neatly on the mold. After adjusting to the appropriate field of view under the microscope, the left hand fixes the mold, the right hand holds the operating lever to control the injection needle to penetrate the egg membrane and pierce the yolk, and the right foot controls the injection. After the injection is completed, the fish eggs are collected in the culture dish for subsequent experiments.

[0184] 3.2 Experimental Grouping

[0185] The whole experiment was conducted in two batches, namely, the myocardial injury evaluation model induced by ISO and verapamil, and the specific experimental operations were consistent. 180 zebrafish were randomly divided into 18 groups, 10 in each group (Table 2). Except for the normal group, the zebrafish myocardial injury model was constructed in the other groups according to the above model construction method, and the relevant indicators were tested after the experiment.

[0186] Table 2 Grouping and drug administration based on ISO induction model

[0187]

[0188] 4. Observation indicators

[0189] 1) Effect on cardiac output

[0190]

[0191] 2) Effect on blood flow velocity

[0192]

[0193] Statistical analysis was performed using analysis of variance and Dunnett's T-test, and p < 0.05 indicated a significant difference.

[0194] 5. Experimental Results

[0195] 5.1 Efficacy evaluation based on ISO-induced model

[0196] Cardiac output and blood flow velocity are important indicators for evaluating cardiac function and circulatory system. They reflect the heart's pumping function and are also used to evaluate the condition of patients with heart disease. Therefore, this experiment uses cardiac output as the main evaluation indicator. The experimental results show that ( Figure 6and Table 3). Compared with the ISO-induced myocardial injury model group, the Salvia miltiorrhiza-derived miRNA156a showed a dose-dependent decrease in blood flow velocity and cardiac output at a concentration of 5-20 μM, and only at a concentration of 5 μM had a significant effect on improving blood flow velocity and cardiac output (P<0.01), but the increase rate of cardiac output and blood flow velocity was lower than that of the positive drug digoxin group. At the same concentration, the non-methylated miRNA156a (miRNA156a-OH) group only hatched embryos at a concentration of 5 μM, and did not significantly improve blood flow and cardiac output, and the increase rate of indicators was lower than that of the miRNA156a group. The above studies preliminarily proved that plant-derived miRNA156a has a certain protective effect on the ISO-induced zebrafish myocardial injury model, and presents certain side effects at high concentrations.

[0197] Note: In the miRNA156-OH group, only the 5 μM concentration resulted in fish hatching, while the other concentrations did not result in fish hatching.

[0198] Table 3 Improvement of cardiac function in each group based on ISO-induced model

[0199]

[0200] 6. Conclusion

[0201] Plant-derived miRNA156a can significantly increase the hemodynamics of the ISO-induced zebrafish myocardial injury model (improvement degree >60%) and has a protective effect on cardiac function.

[0202] Example 5 Experiment on the effect of miRNA on myocardial ischemia rat model

[0203] Objective: To establish an isoproterenol-induced ischemic myocardial injury rat model, evaluate the area of ​​myocardial ischemia by TTC staining, and detect the expression level of the target protein by Western blot, so as to confirm the role of miRNA156a in myocardial ischemia.

[0204] 1 Experimental Materials

[0205] 1.1 Test Articles

[0206] (1) Salvia miltiorrhiza aqueous extract: provided by the Pharmacology and Toxicology Research Center of Tasly Research Institute;

[0207] (2) Synthetic mature miRNA mimics (numbered 156a, with -2'-O-CH3 modification at the 3' end of the sequence; 156a-OH, with no modification at the 3' end of the sequence) were purchased from Jinweizhi Biotechnology and prepared with sterile water before use.

[0208] 1.2 Other reagents and consumables for the experiment

[0209] (1) Isoproterenol hydrochloride (molecular weight: 247.72): off-white powder, batch number: MI5VB-DI, purchased from TCI (Shanghai) Chemical Industry Development Co., Ltd., prepared with sterile water before use.

[0210] (2) Universal Plant MicroRNA Extraction Kit (centrifugal column type): Product number: RP5331, brand: Bio Teke, specification: 50 times / box

[0211] (3) miRNeasy Serum / Plasma Spike-In Control Kit: Catalog No.: 219610, Brand: QIAGEN

[0212] (4) miRNeasy Serum / Plasma Kit (50) Kit: Catalog number: 217184, Brand: QIAGEN

[0213] (5)TTC staining reagent:

[0214] Sodium dihydrogen phosphate anhydrous (99%, Reagent grade): Item No.: ST1660-250g, Brand: Biyuntian

[0215] Disodium hydrogen phosphate (99%, Reagent grade): Item No.: ST1655-500g, Brand: Biyuntian

[0216] TTC staining solution (2%): Product number: G3005, Brand: Solarbio

[0217] 1.3 Experimental instruments

[0218] name company Mcirofuge 22B benchtop microcentrifuge Beckman Z323K Desktop Refrigerated Centrifuge HermLe Company of Germany KQ-250E Ultrasonic Cleaner Kunshan Ultrasonic Instrument Co., Ltd. GLS Aqua 18plus Water Bath Shaker -- BCD-286LECK Meiling Refrigerator Meiling VS-1300U clean bench --

[0219] 2 Experimental animals

[0220] A total of 65 SD male rats (180-220 g) that met the SPF standard were selected, with the experimental animal quality certificate number: No.110011230102289387 (65 rats, used for formal experiments).

[0221] Supplier: Beijing Weitonglihua Experimental Animal Technology Co., Ltd., production unit license number: SCXK(Beijing)2021-0011.

[0222] 2.1 Receipt and Inspection of Animals

[0223] After the experimental animals arrive, the experimental staff, veterinarians and animal protection department receive them together. When receiving, first check whether the transportation vehicle meets the requirements, then check the animal qualification certificate provided by the animal supplier, and confirm that the content of the certificate is consistent with the species, grade, quantity and gender of the animals applied for purchase. Then check whether the outer packaging meets the requirements and whether the animal outer packaging is damaged. The animal outer packaging is transferred to the quarantine room through the first transfer cabinet. The experimental tools and experimental records are transferred through the second transfer cabinet.

[0224] Open the outer packaging of the animals in the quarantine room and check whether the sex and quantity of the animals are consistent with the items in the animal qualification certificate. Perform an appearance check on each animal (including sex, weight, head, trunk, tail, limbs, fur, spirit, activity, etc.), and fill in the "Record of Receipt of Laboratory Animals" and "Record of Quarantine of Laboratory Animals". After the inspection, the animals are placed in animal cages, and quarantine period labels are hung on the cages, and then placed in the quarantine room for the adaptation period.

[0225] The animal adaptation period is 3 days. The animals are observed every day, including weight, head, trunk, tail, limbs, fur, spirit, activity, etc.

[0226] 2.2 Experimental Animal Facilities

[0227] Breeding facilities: Tasly Holding Group Co., Ltd. Animal Barrier System;

[0228] Facility address: In the factory area at the intersection of Huaihe Road and Tingjiang West Road, Beichen Science and Technology Park, Pujihe East Road, Beichen District, Tianjin;

[0229] Experimental unit use license number: SYXK(Tianjin)2022-0004;

[0230] Feeding conditions: The environmental conditions of this facility meet the relevant standards of the Chinese national standard "Experimental Animal Environment and Facilities" (GB14925-2010) for barrier animal experimental facilities. The animal feeding management and animal experimental operations meet the requirements of the "Tianjin Laboratory Animal Management Regulations" and other regulations. Temperature: 20-26℃, humidity: 40-70%, light: 12 hours light and 12 hours dark, ventilation: ≥15 times / hour fresh air, animals drink sterile water prepared by a 1T / h multiple microporous membrane filtration system (four-stage filtration and ultraviolet sterilization).

[0231] The animal protection department is responsible for animal management. Except for fasting, feed is added regularly and quantitatively. SPF mice and rats are maintained with compound feed (produced by Keao Xieli (Tianjin) Feed Co., Ltd.), and drinking bottles are changed once a day. Animal cage bedding is changed twice a week, and can be changed at any time under special circumstances. Cages are changed once a week.

[0232] 3 Experimental methods

[0233] 3.1 Model construction

[0234] Injection of isoproterenol (ISO) can increase myocardial oxygen consumption by accelerating heart rate, enhancing myocardial contractility, and stimulating sympathetic nerves, thereby increasing myocardial energy demand and insufficient energy supply, causing myocardial circulatory disorders, coronary artery spasm, myocardial infarction-like changes, myocardial necrosis and fibrosis, ventricular remodeling, and even sudden death. It is a non-invasive model making method. [1] Histological analysis showed that the myocardial pathophysiology and morphological abnormalities produced by ISO-induced myocardial injury in rats were similar to those in patients with ischemic heart disease. Currently, ISO-induced animal myocardial ischemic injury models are widely used to evaluate the effects of cardioprotective drugs and their mechanism studies.

[0235] The rat myocardial ischemic disease model was established by subcutaneous injection of ISO at multiple points in the back of the neck, with an ISO dose of 5 mg / kg and an injection volume of 0.1 mL / 100 g. A 5 mg / mL ISO physiological saline solution was prepared separately, and after 3 days of adaptive feeding, the Sprague Dawley rats were injected with ISO for modeling experiments, and the modeling was continued for 14 days (24 hours interval). The above modeling method refers to the protocol of researchers engaged in related experiments in this center. Note: Before the formal start of the experiment, a preliminary experimental exploration will be carried out to verify the success rate of the modeling.

[0236] 3.2 Experimental groups and drug administration

[0237] According to the modeling situation, the model rats were randomly divided into model group (n=8), Salvia miltiorrhiza water extract group (n=8), miRNA156a group (n=8), and unmethylated miRNA-156a group (n=8). Except for the normal group, the models of rats in other groups were constructed according to the above method, and the rats in each group were treated with drugs according to the dosage in the table below before modeling.

[0238] The dosage of miRNA156a is 2nmol / kg for rats, which is about 19nmol (molecular weight of about 7000, equivalent to 0.13mg) when converted into clinical dosage based on 60kg / person. According to the adult dosage of 2ug / kg, the application range can be 1ug-0.2mg / kg.

[0239]

[0240] 4. Detection indicators

[0241] 4.1 Histopathology

[0242] TTC staining is a reaction between TTC and succinate dehydrogenase in the mitochondria of living cells to generate red formazan, which is used to indicate cell vitality and evaluate the area of ​​ischemic tissue in the myocardium. TTC (2,3,5-triphenyltetrazolium chloride) is a fat-soluble photosensitive complex. It is a proton receptor of the pyridine-nucleoside structural enzyme system in the respiratory chain. It reacts with dehydrogenase in normal tissues and turns red. However, the dehydrogenase activity in ischemic tissues decreases and cannot react, so there is no change and it turns pale. [4] .

[0243] After the experiment, the heart was removed and rinsed with 4°C saline. The wet weight of the whole heart was recorded and quickly placed in a -20°C refrigerator for 5 minutes. The quick-frozen heart was cut into 4 to 5 slices of 2 mm thick myocardial slices from the apex to the base of the heart parallel to the atrioventricular groove. The slices were placed in 2 mL of 2% triphenyltetrazolium chloride (TTC) solution and incubated at 37°C (pH 7.4) for 15 minutes for staining. The infarcted area was white and the range of myocardial ischemia was expressed as the percentage of ischemic myocardium in the total heart weight.

[0244] 4.2 Protein expression

[0245] After the experiment, the rats were anesthetized with pentobarbital, and blood was collected from the abdominal aorta of each group. The rats were killed and the heart tissues of each group were collected and the total protein was extracted. The relative quantitative analysis of the target protein was performed by Western Blot method.

[0246] 4.3 Statistical analysis

[0247] The research data were expressed as mean ± standard deviation (Mean ± SD). The independent sample T-test (T-Test) was used to compare the two groups of samples. P < 0.05 indicated that the statistical data had a significant difference.

[0248] 5 Experimental results

[0249] 5.1 Efficacy verification based on ISO-induced model

[0250] 5.1.1 Myocardial ischemic area

[0251] The efficacy of the drug was verified based on the pre-experimental conditions. ISO was injected subcutaneously at multiple points on the back of the neck of rats. After 7 days of induction, the rats were randomly divided into groups (55 / 65) when the rats were stable. Among them, there were 7 normal groups, 15 model groups, 11 Danshen water extract, miRNA156a and miRNA156a-OH groups. After 7 days of drug treatment, the survival of rats in each group was 7 normal groups, 13 model groups, and 10 Danshen water extract, miRNA156a and miRNA156a-OH groups. After the experiment, heart tissues were taken, and three samples from each group were frozen at -80 degrees for future use (protein quantitative analysis), and the rest were stained with TTC to determine the condition of myocardial ischemia.

[0252] The freshly taken heart samples were rinsed with prepared phosphate buffer (PH=7.4), and the rinsed hearts were immediately frozen at -20°C. The hearts were then cut into 5 parts and incubated in 2% TTC dye solution in a 37°C oven for 15 min. The stained samples were then photographed at the same position for subsequent inter-group comparison analysis. Figure 7 and Figure 8 As shown in Table 4, there was almost no infarction area in the normal group, while in the model group, most of the sliced ​​heart area appeared white due to the large number of infarction sites. The drug-treated groups (Danshen water extract, miRNA156a, miRNA156a-OH) all improved the myocardial infarction area caused by myocardial ischemia injury to varying degrees. According to the statistical results, the Danshen water extract had the best improvement effect on the myocardial ischemia rat model, and the miRNA156a group had a significant improvement effect, and there was no significant difference with the water extract group, which was better than the miRNA156a-OH group. The above results suggest that plant-derived miRNA156a can reduce the myocardial ischemic area of ​​rats with myocardial ischemia (the degree of improvement is close to 60%), which further indicates its potential therapeutic effect.

[0253] 5.1.2 Protein expression

[0254] Hypoxia-inducible transcription factors (HIFs) play a central role in the cellular response to hypoxia by regulating the expression of genes related to angiogenesis, energy metabolism, cell survival, and other cellular functions in an oxygen level-dependent manner. HIF-3A is a protein that regulates gene expression and is involved in many physiological processes, including cell proliferation, metabolism, and angiogenesis. Studies have shown that the expression of HIF-3A is associated with cardiovascular diseases such as coronary heart disease, hypertension, and myocardial infarction, and it may play an important role in the occurrence and development of cardiovascular diseases. In rats, HIF-3a plays a negative role in adapting to hypoxia, and inhibiting the expression of HIF-3a leads to increased physical endurance. Therefore, inhibiting the expression or activity of HIF-3a may be a promising approach for the treatment of ischemic heart disease.

[0255] like Fig. 9 As shown in Table 4, compared with the normal group, the HIF3α protein expression in the model group samples increased, and after treatment with miRNA156a, the protein level showed a downward trend. This suggests that the anti-myocardial ischemia effect of miRNA156a may be related to the target network of HIF3a.

[0256] Table 4 Statistical data of HIF3A expression in myocardial tissue samples of each group

[0257] Groups HIF-3a / GAPDH SD Normal 0.92 0.0390 Model 1.17 0.1133 Extract 1.21 0.2098 miRNA156a 0.96 0.1751

[0258] 6 Conclusion

[0259] Plant-derived miRNA156a can reduce the area of ​​myocardial ischemia in rats with myocardial ischemia (the improvement is close to 60%), indicating its potential therapeutic effect. The study preliminarily proves that its effect may be related to the target network where HIF3a is located.

[0260]

Claims

1. Use of miRNA156a in the preparation of drugs for treating myocardial injury diseases.

2. The use according to claim 1, wherein the miRNA156a is plant miRNA156a.

3. The method according to claim 1, wherein the plant is selected from the group consisting of: salvia miltiorrhiza, liquorice, spinach, cabbage, and broccoli. The use according to claim 1 , wherein the miRNA156a is Salvia miltiorrhiza miRNA156a.

5. The use according to claim 1, wherein the miRNA156a has the following nucleotide sequence: UGACAGAAGAGAGUGAGCAC(5'-3').

6. The use according to claim 1, wherein the miRNA156a can be modified by chemical groups, such as: the 3' end is modified by 2'-O-CH3.

7. The use according to claim 1, wherein the drug is a pharmaceutical composition with miRNA156a as the active ingredient, and the pharmaceutical composition is in the form of a unit dose pharmaceutical preparation that can be taken, such as tablets, capsules, granules, pills, powders, and injections.

8. The use according to claim 1, wherein the dosage of miRNA156a as a pharmaceutical active ingredient when used for humans or animals is 1 ug-0.2 mg / kg.

9. The use according to claim 1, wherein the myocardial injury disease is selected from: myocardial ischemia, myocardial infarction, myocardial ischemia-reperfusion injury, and coronary heart disease.

Images