Cassava mefer4 gene and application thereof

Abstract

The application provides cassava MeFER4 Gene and application thereof in improving sensitivity of plants to stress. By constructing overexpression vector containing MeFER4 Gene and transforming into host plant tissues such as Arabidopsis and cassava through infection method, plants sensitive to drought, abscisic acid, oxidation, salt and osmotic stress and other stress are obtained. Research shows that, MeFER4 It is a negative regulatory factor of plant stress response and plays a negative regulatory role in plant drought resistance and the like, and the transgenic plant is more sensitive to stress. The application is beneficial to elucidating the role of MeFER4 Gene in stress response from the molecular mechanism, and has important significance for directional genetic improvement of plant drought resistance and plant variety selection.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular biology, and particularly relates to cassava MeFER4 Genes and their applications. Background Art

[0002] Cassava ( Manihot esculenta Crantz Cassava (Euphorbiaceae) is a member of the genus Cassava and an important economic plant. Cassava grows primarily in tropical and subtropical regions and is known for its drought and infertility tolerance. Genes in cassava that are resistant to both biotic and abiotic stresses remain to be further explored.

[0003] Ferritin (FER) is a type of iron-storage metalloprotein that is widely found in organisms and plays an important role in maintaining the balance of iron in the body. In recent years, more and more studies have been conducted on ferritin, and people have identified ferritin from animals, plants and microorganisms. FER Gene, FER Gene functions are also becoming increasingly well-understood. Studies have shown that ferritin plays distinct regulatory roles in different organisms. Zang Xinshan et al. investigated the biological function of the TaFER-5B gene and found that TaFER-5B improved the heat tolerance of transgenic wheat and Arabidopsis thaliana. Llanos et al. introduced the soybean ferritin gene into Saccharomyces cerevisiae, effectively improving the cell's iron accumulation capacity and its ability to adapt to iron stress. Zhang Lijing et al. demonstrated that ferritin is a key component of the protective mechanism against low temperature stress in the alpine mustard.

[0004] After searching, cassava MeFER4 The biological function of the gene has not yet been clearly revealed, especially no research has been reported on its role as a positive regulator of the hydrogen peroxide pathway and a negative regulator of plant stress response. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention proposes a cassava MeFER4 Genes and their applications.

[0006] The main contents of the present invention are as follows:

[0007] Cassava MeFER4 The application of the gene in increasing the sensitivity of plants to adverse stress, wherein the adverse stress includes at least one of drought, abscisic acid, oxidation, salt and osmotic stress, wherein the MeFER4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] Furthermore, the plant is a dicotyledonous plant.

[0009] Furthermore, the dicotyledonous plant includes Arabidopsis thaliana or cassava.

[0010] Further, the application is: by increasing the MeFER4 The expression of the gene or MeFER4 protein increases the sensitivity of the plant to adverse stress.

[0011] The present invention also provides a method for improving the sensitivity of plants to adverse stress, comprising the following steps: cloning MeFER4 genes, and MeFER4 The gene is connected into the vector to obtain MeFER4 A gene overexpression vector is introduced into a plant through infection to obtain a plant that is sensitive to adverse stress.

[0012] Furthermore, the method comprises the following steps: cloning MeFER4 genes, and MeFER4 The gene is connected into the vector to obtain MeFER4 A gene overexpression vector is transformed into Arabidopsis thaliana by inflorescence infection or into cassava by callus infection to obtain a plant sensitive to adverse stress; MeFER4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0013] SEQ ID NO.1:

[0014] ATGCAAGCAACAATGTTTCTGAGAGCTGTTTCAGCTTTTCCTGTGTCTACCAGACAGGGAGATGCTGCTTTTAGCCCCATCAATGGCCTTTCTTCTTCTTCGTCTTCTTGTTCTTCTTCCTCCAGTTTTGACTTTATCTCCAAGAAGGGGAAGAAACAGTTTCGCCGTTTCTGCCTCGGCGGAGAGCGGTGTGCTGACG GGTGTGGTGTTCCAGCCATTTGAAGAGGTCAAGAAGGAAGCTTATGGTTCCTATTGCTCCTCAAGTTTCTATCGCTCGTCAGTTCTATGAGGATGAGTGTGAAGCTGCATTAAACGAGCAGATCAATGTGGAGTACAATGCTTCCTACGTATACCACGCCATGTTTGCATATTTTGACAGGGATAACGTTGCCTTGAAA GGCCTAGCCAAATTTTTCAAGGAATCCAGCGAAGAAGAAAGAGAACATGCCGAAAAGCTAATGGAGTATCAGAACATCCGCGGAGGGAGAGTAAAACTACACTCTATACTGATGCCTCTGTCAGAGTTTGATCACGCAGAGAAAGGAGATGCTTTATATGCTATGGAGTTAGCATTGTCTTTGGAGAAGCTGACAAATGAG AAGCTGTTGAACTTGCACAGTGTTGCTTCTCGAAATAATGATCCACAAATGGCAGACTTCGTTGAAAGTGAGTTTTTAGAAGAACAGGTTGAATCCATTAAGAAAATATCAGAATATGTGACTCAATTAAGGATGGTGGGGAAAGGCCACGGAGTCTGGCATTTTGATCAGAAGCTTCTCCATGAGGGTGATGCTGCATGA

[0015] Beneficial effects of the present invention:

[0016] The present invention constructs MeFER4 The gene overexpression vector was transformed into Arabidopsis thaliana by inflorescence infection and into cassava host plant tissue by callus infection to obtain transgenic plants. MeFER4It is a positive regulatory factor of the hydrogen peroxide pathway and a negative regulatory factor of plant stress response. It plays a negative regulatory role in plant drought resistance. The transgenic plant is more sensitive to drought. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : MeFER4 - PCR test results of OE transgenic lines. Water: Water.

[0018] Figure 2 : Results of water loss experiment on Arabidopsis leaves.

[0019] Figure 3 : Wild type and overexpression MEFER4 Phenotypic differences in Arabidopsis thaliana (OE-6, OE-7, and OE-10) treated with CK and ABA. Top: Leaf color and phenotype under CK and ABA treatments. Bottom: DAB staining reveals ROS accumulation in wild-type and transgenic lines. Scale bar = 1 cm

[0020] Figure 4 : Quantification of ROS accumulation in DAB-stained leaves under ABA treatment using mean optical density. Data are mean ± SD (n = 3). Asterisks indicate significant differences compared with wild-type plants (* P <0.05, ** P <0.01). The vertical axis is the average optical density (AOD).

[0021] Figure 5 : Under ABA treatment, wild type and MEFER4 Overexpression in Arabidopsis MPK11, SOD, CAT1, PER5, PER63, PER66, APX1, APX3 and APX5 The expression levels of stress-responsive genes such as β-actin and β-actin were changed. Data are mean ± SD (n = 3). Asterisks indicate significant differences compared with wild-type plants (* P <0.05, ** P <0.01). The vertical axis is "Relative expression", which indicates the relative expression level.

[0022] Figure 6 : MeFER4 Interactions with antioxidant enzymes. A. Yeast two-hybrid assay results show the interaction of MeFER4 with APX1 and APX3. Positive represents the positive control, and negative represents the negative control. B. Luciferase assay results show that MeFER4 interacts with APX1 and APX3. C. Bimolecular fluorescence complementation (BiFC) analysis results show that MeFER4 interacts with APX1 and APX3, respectively. Scale bar = 50 μm. DETAILED DESCRIPTION

[0023] In order to better understand the technical content of the present invention, specific examples are provided below to further illustrate the present invention.

[0024] Example 1 MeFER4 Gene cloning and vector construction

[0025] according to MeFER4 Specific primers were designed based on the full-length CDS sequence of the gene.

[0026] MeFER4 Full-length sequence clone:

[0027] Cloning primer sense (forward primer): ATGCAAGCAACAATGTTTCTGAGAG (SEQ ID NO. 2)

[0028] Cloning primer Antisense (reverse primer): TGCAGCATCACCCTCATGGAG (SEQ ID NO. 3).

[0029] The coding sequence was cloned into the pCAMBIA1300 vector with an eGFP tag, driven by the CaMV35S promoter. The resulting construct was transformed into the Agrobacterium tumefaciens strain LBA4404 and used for Arabidopsis thaliana transformation. The coding sequence was cloned into the pNC-GBKT7 vector (provided by Dr. Yan Pu) with a MYC tag and a GAL4 DNA binding domain, driven by the ADH1 promoter, and transformed into the yeast strain Y2H Gold for yeast two-hybrid screening. The coding sequence was cloned into the pCAMBIA1300-NLUC vector with an NLUC tag, driven by the CaMV35S promoter, and transformed into the Agrobacterium tumefaciens strain LBA4404 for luciferase complementation experiments (split-LUC). The coding sequence was cloned into the pSPYNE-35S vector with a YFP-N tag, driven by the CaMV35S promoter, and the resulting construct was transformed into Agrobacterium tumefaciens strain LBA4404 for bimolecular fluorescence complementation (BiFC) assay.

[0030] Example 2 MeFER4 Primary sequence and secondary structure analysis

[0031] Analyzed by TBtool software MeFER4 The physicochemical properties of proteins, MeFER4The protein is composed of multiple amino acids, including Ser (10.9%), Ala (10.1%), Glu (10.1%), Leu (9.0%), Val (7.5%), Lys (5.6%), and Phe (5.6%). The effective number of codons (Nc) is 52.509. The protein does not contain a transmembrane structure or a signal peptide. The relative molecular mass of the protein is 29831.61 Da. Prediction of the protein's secondary structure reveals that the protein comprises 52.81% α-helical structure, 5.62% β-sheet structure, 13.86% extended chain structure, and 27.72% random coil structure. The hydropathic index ranges from -3.056 to 1.878, and the hydrophobic index is -0.305, indicating that the protein is hydrophilic. The protein has an instability coefficient of 50.16, which indicates it is an unstable protein. Its fat solubility coefficient is 78.58.

[0032] Example 3, cassava MeFER4 Subcellular localization analysis

[0033] The successfully constructed plant expression vector pCAMBIA1300-35S- MeFER4 -GFP and the empty vector pCAMBIA1300-35S-GFP were transformed into GV3101 Agrobacterium competent cells, respectively, and injected into tobacco leaves grown for about 30 days. After 48 hours, the injected tobacco leaves were observed using a laser confocal microscope. MeFER4 - The excitation fluorescence of GFP is only distributed in chloroplasts, while the excitation fluorescence of the empty vector pCAMBIA1300-35S-GFP is mainly distributed in the cytoplasm and nucleus. MeFER4 It is located in chloroplasts and mainly functions within them.

[0034] Example 4: Identification of positive transgenic Arabidopsis lines

[0035] For research MeFER4 Gene function, construct pCAMBIA1300-35S- MeFER4 -GFP overexpression vector was transferred into wild-type Arabidopsis using the Arabidopsis inflorescence infection method to obtain T0 transgenic lines MeFER4- OE. After the harvested seeds are disinfected, they are spread onto 1 / 2 MS medium containing 25 μg / mL hygromycin. The positive seedlings screened by hygromycin are transplanted into nutrient soil (by mass ratio, vermiculite: nutrient soil = 3:1). After collecting the seeds, continue the above screening and select the strains with a positive to negative strain ratio of 3:1. After planting, the seeds are collected and screened to obtain homozygous OE-6, OE-7, and OE-10 for subsequent experiments. DNA was extracted and PCR detection was performed using hygromycin primers. Hygromycin gene expression was detected in the transgenic lines, but not in the wild type ( Figure 1 ).

[0036] The total protein of the three transgenic lines and wild-type Arabidopsis was extracted and the protein concentration was detected. The total protein (10 μg) was denatured and Western Blot was performed using Anti-GFP as the primary antibody and Anti-Actin as the internal reference protein primary antibody. The results showed that the fusion protein was expressed in all three transgenic lines, indicating that the fusion protein was successfully obtained. MeFER4 -OE Arabidopsis thaliana.

[0037] Example 5, drought stress experiment

[0038] Leaf water loss experiments were conducted using leaves from wild-type and transgenic Arabidopsis lines of similar size, weight, and quantity. Two different approaches were used. First, mature leaves from Arabidopsis plants were excised for in vitro leaf water loss experiments, measuring the leaf water loss rate (LWLR) over a 24-hour period. Second, drought stress was directly applied to potted seedlings by withholding water for 23 days and observing leaf wilting.

[0039] The results showed that: at the same time, the transgenic strain lost water faster than the wild type ( Figure 2 ). Leaf water loss rate (LWLR) analysis showed that within 3 hours, the water loss trends of the wild type and transgenic lines were very similar, and the difference in water loss was not obvious; after 4 hours, the wild type and transgenic lines showed different trends, and as time went on, it was obvious that the transgenic lines lost water more rapidly. At 12-24 hours, the weight changes of the leaves of the transgenic lines tended to be stable. In summary, MeFER4 It may affect the water retention capacity of Arabidopsis leaves, causing Arabidopsis leaves to lose water more rapidly.

[0040] Example 6: Abscisic acid (ABA) sensitivity test

[0041] In the abscisic acid (ABA) sensitivity assay, three-week-old Arabidopsis plants were treated with 40 µM ABA for three days. Leaves were harvested and stained with DAB to assess ROS accumulation. The expression levels of stress-responsive and antioxidant-related genes were analyzed by qRT-PCR.

[0042] Table 1

[0043]

[0044] The results showed that leaves of transgenic Arabidopsis lines (OE-6, OE-7, and OE-10) under ABA treatment turned significantly yellower compared to wild-type plants ( Figure 3 In addition, DAB staining showed that ROS accumulation was higher in the transgenic lines under ABA treatment ( Figure 3 Quantitative analysis of the average optical density confirmed that the ROS level in the transgenic line was significantly increased ( Figure 4 The expression levels of ROS-related marker genes in transgenic plants changed ( Figure 5 ). It is worth noting that MPK11 and PER63 The expression of genes such as PER5, PER66 and APX5 down-regulated in OE lines, indicating that ROS homeostasis is disrupted. Collectively, these findings suggest that MeFER4 Overexpression disrupts ROS homeostasis in Arabidopsis and leads to increased sensitivity to ABA.

[0045] Example 7: Hydrogen peroxide stress treatment experiment

[0046] Three-week-old Arabidopsis plants were sprayed with 3% H2O2. 24 hours later, leaves were harvested and stained with DAB to observe ROS accumulation. Gene expression levels were analyzed by qRT-PCR.

[0047] The results showed that after H2O2 treatment, MeFER4 The leaves of transgenic Arabidopsis thaliana (OE-6, OE-7, and OE-10) overexpressing the gene showed more pronounced yellowing than those of wild-type plants, indicating increased susceptibility to oxidative stress. DAB staining analysis further confirmed that ROS levels were significantly elevated in the transgenic lines. WCRKC1, SOD, APX1, APX3, APX5, PER5, PER63 and PER66 Significant changes were observed in the overexpression lines. Specifically, WCRKC1 and APX5 Upward, and SOD and PER63 down-regulated, indicating that ROS balance was disrupted in transgenic plants. Taken together, these findings emphasize that MeFER4We investigated the role of β-actin in regulating ROS homeostasis and showed that its overexpression significantly increased the oxidative stress sensitivity of Arabidopsis thaliana.

[0048] Example 8, Methyl Viologen (MV) stress treatment experiment

[0049] Three-week-old Arabidopsis plants were sprayed with 50 µM MV. Twenty-four hours later, leaves were harvested and stained with DAB to observe ROS accumulation. Gene expression levels were analyzed by qRT-PCR.

[0050] The results showed that under MV treatment, the transgenic lines (OE-6, OE-7, and OE-10) exhibited more severe leaf yellowing and higher ROS levels than wild-type plants. Quantitative analysis of the average optical density of DAB-stained leaves further confirmed this. MeFER4 The ROS level in the overexpression lines was significantly increased. The expression analysis of stress response related genes showed that stress response genes were significantly changed. For example, under stress conditions, SOD and APX Genes are upregulated, and WRKY33 and DREB1B Together, these results highlight the MeFER4 We investigated its role in regulating the oxidative stress response and showed that its overexpression in Arabidopsis enhanced sensitivity to oxidative stress.

[0051] Example 9, Salt and Osmotic Stress Treatment Experiment

[0052] Arabidopsis seedlings were cultured on MS medium supplemented with 110 mM NaCl or 300 mM mannitol for three days. Phenotypic changes, including etiolation and necrosis, were recorded, and leaves were collected for assessment of ROS content by DAB staining. The expression levels of relevant genes were analyzed by qRT-PCR.

[0053] The results showed that overexpression MeFER4 It can increase the sensitivity of Arabidopsis to NaCl stress. Compared with wild-type plants, transgenic lines (OE-6, OE-7, and OE-10) showed more severe leaf yellowing and necrosis under NaCl treatment, and enhanced DAB staining indicated increased ROS levels. Gene expression analysis showed that stress-responsive transcriptional regulators such as MYB73, DREB1B and WRKY33 were significantly downregulated, while antioxidant defense genes such as SOD and APX were upregulated.

[0054] Under mannitol-induced osmotic stress, MeFER4The overexpression lines showed higher sensitivity than wild-type plants, with more obvious leaf discoloration and damage. Stronger DAB staining signals in transgenic lines confirmed the increase in ROS levels. Gene expression analysis showed that transcription factors such as WRKY53 and DREB1B down-regulated, while antioxidant defense genes including APX family members and P5CS were up-regulated, indicating that plants made an adaptive response to oxidative stress. Taken together, these findings suggest that overexpression MeFER4 It will change the stress response of Arabidopsis thaliana under salt stress and osmotic stress conditions.

[0055] Example 10 Interaction between MeFER4 and antioxidant enzymes

[0056] Yeast two-hybrid (Y2H) assay was performed according to the literature. MeFER4 The full-length coding sequence was cloned into the pNC-GBKT7 vector (bait vector) and verified by sequencing. The bait vector and Arabidopsis yeast library plasmid DNA were co-transformed into competent yeast cells, and positive clones were screened using the Matchmaker Gold Yeast Two-Hybrid Library Screening System (Clontech - TaKaRa) on selective synthetic deletion (SD) medium at 30°C. Positive clones were identified on SD / -Trp / -Leu / -His / -Ade medium and sequenced. Candidate interacting proteins were further analyzed. BD-p53 + AD-T and BD-lam + AD-T served as positive and negative controls, respectively.

[0057] The split-luciferase assay was performed according to the literature (Li K, Li Y, Liu C, Li M, Bao R, et al. 2024. Protein kinase MeSnRK2.3 positively regulates starch biosynthesis by interacting with the transcription factor MebHLH68 incassava. J Exp Bot 75:6369-87). MeFER4 The coding sequence was cloned and inserted into the pCAMIA1300-nLUC vector. APX1 and APX3Each construct was cloned and inserted into the pCAMIA1300-cLUC vector. The constructs were transfected into Nicotiana benthamiana leaves via Agrobacterium-mediated infiltration. The leaves were then infiltrated with the vector-carrying Agrobacterium and incubated in a greenhouse at 28°C, 16 hours light / 8 hours dark for three days. After three days, the fluorescence of the evaluated protein-YFP fusion and nuclear marker signals were detected using a confocal microscope (Leica TCS-SP8, Germany). For the split-LUC assay, Nicotiana benthamiana leaves were injected with a luciferin solution (10 mM D-luciferin; Solebo, China), and LUC activity was assessed using a CCD imaging device (Night SHADE LB985 with Indigo software, Germany). The experiment was repeated three times.

[0058] For the BiFC test, the protocol of Guo et al. (Guo X, Yu X, Xu Z, Zhao P, Zou L,et al. 2022. CC-type glutaredoxin, MeGRXC3, associates with catalases and negatively regulates drought tolerance in cassava (Manihot esculenta Crantz). Plant Biotechnol J 20:2389-405) to construct MeFER4-nYFP, APX1-cYFP, and MeAPX3-cYFP.

[0059] Experimental results: Yeast two-hybrid (Y2H) screening identified ascorbate peroxidase 1 (APX1) and ascorbate peroxidase 3 (APX3) as interacting partners of MeFER4 ( Figure 6 , A). To further confirm these interactions, split-luciferase assays were performed. The split-luciferase assays showed strong fluorescence signals in the presence of APX1 and APX3, confirming Y2H's findings and demonstrating the physical interaction between MeFER4 and these proteins ( Figure 6 , B). In addition, BiFC assay was used to verify the in vivo interaction. The results showed that when MeFER4 was co-expressed with APX1 or APX3, the fluorescence signal was clear and distinct, proving that MeFER4 formed a complex with these two proteins in living cells ( Figure 6, C). These in vivo interaction studies provide strong evidence that MeFER4 physically interacts with APX1 and APX3, suggesting a functional partnership in the regulation of reactive oxygen species (ROS) homeostasis.

[0060] Overall, these findings suggest that MeFER4 It may play a key role in regulating plant ROS levels and stress responses through interactions with key antioxidant enzymes APX1 and APX3. The identification and validation of these interactions emphasizes MeFER4 The potential significance in maintaining oxidative balance and enhancing plant stress resistance under adverse conditions.

[0061] In summary, our results demonstrate that MeFER4 is an important regulator of plant oxidative stress responses. By regulating ROS homeostasis and interacting with key antioxidant enzymes, MeFER4 plays a central role in mediating plant responses to drought, oxidative, and osmotic stress. These findings provide a foundation for further investigation of MeFER4's potential applications in improving crop stress tolerance, particularly in regions where drought and oxidative stress severely limit crop productivity. Further understanding of the molecular mechanisms underlying MeFER4-mediated stress tolerance is crucial to fully realizing its potential in agricultural applications.

[0062] The above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.

Claims

1. Cassava MeFER4 Use of a gene for increasing the sensitivity of a plant to adverse stress, characterized in that: The adverse stress includes at least one of drought, abscisic acid, oxidation, salt and osmotic stress, and the MeFER4 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the plant is Arabidopsis thaliana.

2. The use according to claim 1, characterized in that By increasing the MeFER4 The expression of the gene or MeFER4 protein increases the sensitivity of the plant to adverse stress.

3. A method for increasing the sensitivity of a plant to adverse stress, characterized in that: The following steps are involved: cloning MeFER4 genes, and MeFER4 The gene is connected into the vector to obtain MeFER4 Gene overexpression vector, the overexpression vector is transferred into plants by infection method to obtain plants sensitive to adverse stress; MeFER4 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the plant is Arabidopsis thaliana.

4. The method according to claim 3, characterized in that The adverse stress includes at least one of drought, abscisic acid, oxidation, salt and osmotic stress.

5. The method according to claim 3, characterized in that The following steps are involved: cloning MeFER4 genes, and MeFER4 The gene is connected into the vector to obtain MeFER4 A gene overexpression vector is used to transform the overexpression vector into Arabidopsis thaliana through inflorescence infection to obtain a plant that is sensitive to adverse stress; MeFER4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images