Photosynthetic nitrogen fixation engineering bacterium as well as construction method and application thereof

Abstract

The invention discloses a photosynthetic nitrogen fixation engineering bacterium as well as a construction method and application thereof. The photosynthetic nitrogen fixation engineering bacterium disclosed by the invention is a rhodopseudomonas palustris engineering bacterium and is characterized in that A1) the photosynthetic nitrogen fixation engineering bacterium does not contain glnK1 genes; a2) no glnK2 gene is contained; a3) the gene A3 does not contain the amtB1 gene; a4) the gene does not contain an amtB2 gene; and A5) no glnB gene is contained. According to the Rhodopseudomonas palustris engineering bacteria, inhibition of fixed nitrogen in the environment on the nitrogenase is relieved, the expression level of the molybdenum nitrogenase under the ammonium condition is greatly improved, the nitrogen fixation process is not inhibited by ammonium, the activity of the obtained molybdenum nitrogenase is remarkably improved, the cell growth cycle is short, the cell density is high, and the requirement for large-scale production of nitrogen-fixing bacterial fertilizers is met. The Rhodopseudomonas palustris engineering bacterium has the potential of being developed into a nitrogen-fixing microbial fertilizer, can be applied to the production of nitrogen-fixing microbial inoculants, can meet the production requirements of green industry and agriculture, and has a very good application prospect.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and relates to a photosynthetic nitrogen-fixing engineering bacterium and a construction method and application thereof. Background Art

[0002] Nitrogenase can convert nitrogen in the air into ammonia that can be used by plants. The reaction process consumes a large amount of ATP and reducing power. Rhodopseudomonas palustris is a self-generated photosynthetic nitrogen-fixing bacterium that can use light energy to continuously provide energy for the nitrogen fixation process and has the potential to be developed into products such as microbial fertilizers. However, the expression of nitrogenase is inhibited by fixed nitrogen in the environment, which hinders the application of nitrogen-fixing bacteria in environments that generally contain ammonium. Therefore, removing ammonium inhibition and achieving constitutive expression of molybdenum nitrogenase has broad application prospects. Transforming Rhodopseudomonas palustris into a molybdenum nitrogenase constitutive expression strain can be better applied to industrial and agricultural production. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide an engineering bacterium of Rhodopseudomonas palustris that relieves the inhibition of fixed nitrogen and its application in view of the defects of the existing method for preparing microbial nitrogen fertilizer such as the inhibition of ammonium and the long growth cycle.

[0004] In order to solve the above technical problems, the present invention first provides an engineered bacterium of Rhodopseudomonas palustris that has been freed from the inhibition of fixed nitrogen. The engineered bacterium of Rhodopseudomonas palustris has the following characteristics:

[0005] A1) does not contain glnK1(P II protein (P-II family nitrogen regulator) gene;

[0006] A2) does not contain glnK2(P II protein (P-II family nitrogen regulator) gene;

[0007] A3) does not contain the amtB1 (ammonium transporter protein) gene;

[0008] A4) does not contain the amtB2 (ammonium transporter protein) gene;

[0009] A5) does not contain glnB (P II Protein (P-II family nitrogen regulator)) gene.

[0010] The above-mentioned engineered bacteria may also contain a resistance gene expression cassette.

[0011] In one embodiment of the present invention, the resistance gene is a kanamycin resistance gene.

[0012] The present invention also provides a method for preparing an engineered bacterium of Rhodopseudomonas palustris, the method comprising: using Rhodopseudomonas palustris as a receptor bacterium, and performing transformations including steps B1) to B5) on the receptor bacterium to obtain an engineered bacterium of Rhodopseudomonas palustris;

[0013] B1) knocking out the glnK1 gene in the recipient bacteria or reducing the content or activity of the GlnK1 protein in the recipient bacteria;

[0014] B2) knocking out the glnK2 gene in the recipient bacteria or reducing the content or activity of the GlnK2 protein in the recipient bacteria;

[0015] B3) knocking out the amtB1 gene in the recipient bacteria or reducing the content or activity of the AmtB1 protein in the recipient bacteria;

[0016] B4) knocking out the amtB2 gene in the recipient bacteria or reducing the content or activity of the AmtB2 protein in the recipient bacteria;

[0017] B5) knocking out the glnB gene in the recipient bacteria or reducing the content or activity of the GlnB protein in the recipient bacteria.

[0018] The above method may further comprise introducing a resistance gene expression cassette into the recipient bacteria.

[0019] In one embodiment of the present invention, the resistance gene is a kanamycin resistance gene.

[0020] In one embodiment of the present invention, the recipient bacteria is Rhodopseudomonas palustris CGA009.

[0021] The present invention also provides a bacterial agent, the active ingredient of the bacterial agent is the engineered bacterium Rhodopseudomonas palustris.

[0022] The bacterial agent can be used to prepare nitrogen-fixing bacterial fertilizer or microbial bacterial fertilizer.

[0023] In the above-mentioned bacterial agent, the bacterial agent may further include a carrier. The carrier may be a solid carrier or a liquid carrier. The solid carrier may be a mineral material, a plant material or a polymer compound; the mineral material may be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica and diatomaceous earth; the plant material may be at least one of corn flour, soybean flour and starch; the polymer compound may be polyvinyl alcohol and / or polyglycol. The liquid carrier may be an organic solvent, vegetable oil, mineral oil or water; the organic solvent may be decane and / or dodecane. In the bacterial agent, the active ingredient may be present in the form of cultured living cells, fermentation broth of living cells, filtrate of cell culture or a mixture of cells and filtrate. The dosage form of the composition may be a variety of dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water-dispersible granule.

[0024] As required, a surfactant (such as Tween 20, Tween 80, etc.), a binder, a stabilizer (such as an antioxidant), a pH adjuster, etc. may also be added to the bacterial agent.

[0025] The use of the engineered Rhodopseudomonas palustris in the preparation of microbial fertilizers, or in the preparation of nitrogen-fixing fertilizers, also falls within the protection scope of the present invention.

[0026] The application of the method for preparing the engineered bacteria of Rhodopseudomonas palustris in the preparation of microbial fertilizers, or in the preparation of nitrogen-fixing fertilizers, also falls within the protection scope of the present invention.

[0027] The present invention also provides a method for relieving the fixed nitrogen inhibition of Rhodopseudomonas palustris, the method comprising: performing transformations including B1) to B5) on Rhodopseudomonas palustris to obtain engineered bacteria of Rhodopseudomonas palustris;

[0028] B1) knocking out the glnK1 gene in the recipient bacteria or reducing the content or activity of the GlnK1 protein in the recipient bacteria;

[0029] B2) knocking out the glnK2 gene in the recipient bacteria or reducing the content or activity of the GlnK2 protein in the recipient bacteria;

[0030] B3) knocking out the amtB1 gene in the recipient bacteria or reducing the content or activity of the AmtB1 protein in the recipient bacteria;

[0031] B4) knocking out the amtB2 gene in the recipient bacteria or reducing the content or activity of the AmtB2 protein in the recipient bacteria;

[0032] B5) knocking out the glnB gene in the recipient bacteria or reducing the content or activity of the GlnB protein in the recipient bacteria.

[0033] In the above method, the fixed nitrogen may be ammonium nitrogen.

[0034] In an embodiment of the present invention, the glnK1 gene encodes the GlnK1 protein shown in SEQ ID No.2, and its sequence is shown in positions 1-339 of SEQ ID No.1; the amtB1 gene encodes the AmtB1 protein shown in SEQ ID No.3, and its sequence is shown in positions 414-1745 of SEQ ID No.1; the glnK2 gene encodes the GlnK2 protein shown in SEQ ID No.4, and its sequence is shown in positions 2055-2393 of SEQ ID No.1; the amtB2 gene encodes the AmtB2 protein shown in SEQ ID No.5, and its sequence is shown in positions 2431-3873 of SEQ ID No.1; the GlnB gene encodes the GlnB protein shown in SEQ ID No.7, and its sequence is shown in SEQ ID No.6.

[0035] The Rhodopseudomonas palustris engineered bacteria of the present invention relieves the inhibition of fixed nitrogen on nitrogenase in the environment, greatly improves the expression level of molybdenum nitrogenase under ammonium conditions, the nitrogen fixation process is not inhibited by ammonium, the activity of the obtained molybdenum nitrogenase is significantly improved, and the cell growth cycle is short and the density is high, which meets the needs of large-scale production of nitrogen-fixing bacterial fertilizers. The Rhodopseudomonas palustris engineered bacteria of the present invention has the potential to be developed into nitrogen-fixing microbial fertilizers, can be applied to the production of nitrogen-fixing bacterial agents, can meet the production needs of green industry and agriculture, and has a good application prospect.

[0036] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The electrophoresis diagram of nucleic acid for the construction and identification of genetically engineered bacteria CGA3032. A is the upstream homology arm obtained by PCR amplification; B is the downstream homology arm obtained by PCR amplification; C is the electrophoresis diagram of nucleic acid for identification of recombinant plasmid pJQ-glnK1upamtB2down, and the primers used are universal primers M13F / R; Lane 1 in D is the electrophoresis diagram of recombinant plasmid pJQ-glnK1upamtB2down, and Lane 2 is the electrophoresis diagram of nucleic acid for identification of CGA3032, and the primers used are double knockout identification-F (caagagcctgatcgatctgatctc) and double knockout identification-R (acgaaatcgggtaccggatg).

[0038] Figure 2This is the nucleic acid electrophoresis diagram for identifying the genetically engineered bacterium CGA3033. The primers used are Km-F (ACATGAACGGTACCGAGCTC) and GlnB-JD-R (GTTGATCGCCTTGGCGTG).

[0039] Figure 3 The figure is a schematic diagram of the characterization of the molybdenum nitrogenase activity of the genetically engineered bacteria CGA3033. A is a schematic diagram of hydrogen production of the genetically engineered bacteria and the control bacteria under two culture conditions, and B is a schematic diagram of acetylene reduction activity of the genetically engineered bacteria and the control bacteria under two culture conditions. WT represents the wild-type strain Rhodopseudomonas palustris CGA009, ΔGlnK1ΔGlnK2 represents the genetically engineered bacteria CGA3032, and ΔPⅡs represents the genetically engineered bacteria CGA3033. DETAILED DESCRIPTION

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0041] Rhodopseudomonas palustris CGA009 strain is a wild-type strain, which is recorded in the article "Oda, Y. et al. Functional genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium Rhodopseudomonas palustris [J]. JOURNAL OF BACTERIOLOGY, Nov. 2005, p. 7784-7794". The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0042] Escherichia coli S17-1 strain, used for conjugative transfer, is described in "Simon R, Priefer U, Pühler A. 1983. A broad host mobilization system for in vivo genetic engineering: Transposon mutagenesis in Gram-negative bacteria [J]. Bio / Technolgy 1: 784–791." The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0043] Vector pJQ200SK is a suicide plasmid suitable for Gram-negative bacteria, which is recorded in "Jürgen Quandt, F. Hynes M. 1993. Versatile Suicide Vectors Which Allow Direct Selection for Gene Replacement in Gram-Negative Bacteria. Gene 127: 15-21." The public can obtain the biological material from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0044] The culture conditions of Rhodopseudomonas palustris were as follows: 10 mL of culture medium was placed in a 25 mL anaerobic test tube, the upper layer was filled with nitrogen, and the light density was ≥ 30 μmol photons m –2 s –1 , cultured at 30℃.

[0045] Nitrogen fixing medium (NFM): The solvent is water, and the solutes and their concentrations are 12.5 mM disodium hydrogen phosphate (Na2HPO4), 12.5 mM potassium dihydrogen phosphate (KH2PO4), 1 mL / L concentrated alkali, 0.1 mM sodium thiosulfate (Na2S2O3), 2 mg / L p-aminobenzoic acid (PABA), and 20 mM sodium acetate.

[0046] Non-nitrogen fixing medium (PM): a medium in which ammonium sulfate is added to nitrogen fixing medium to obtain a medium in which the mass percentage of ammonium sulfate is 0.1%.

[0047] PM resistance medium: A medium containing 200 μg / mL of kanamycin by adding kanamycin to a non-nitrogen fixing medium.

[0048] Non-nitrogen-fixing solid culture medium: A solid culture medium is obtained by adding 1.5-2% agar powder to a non-nitrogen-fixing culture medium and replacing 20 mM sodium acetate therein with 10 mM sodium succinate.

[0049] PM-resistant solid culture medium: A solid culture medium with a kanamycin concentration of 200 μg / mL obtained by adding kanamycin to a non-nitrogen-fixing solid culture medium.

[0050] PM sucrose medium: A solid medium with a sucrose content of 10% by mass obtained by adding sucrose to a non-nitrogen fixing solid culture medium.

[0051] PM resistance sucrose-added medium: Sucrose and gentamicin are added to a non-nitrogen-fixing solid medium to obtain a solid medium with a sucrose content of 10% and a gentamicin concentration of 100 μg / mL.

[0052] CA solid culture medium: based on the nitrogen-fixing culture medium, remove the sodium acetate and replace it with 10 mM sodium succinate, add yeast powder with a final concentration of 0.2%, 0.5% acid casein, and 1.5-2% agar powder. The nitrogen-fixing culture medium and the additional part are sterilized at 121°C separately, mixed at low temperature, and poured into plates.

[0053] Concentrated Base: The solvent is water, and the solutes and their concentrations are 20 g / L aminotriacetic acid (NTA), 28.9 g / L anhydrous magnesium sulfate (MgSO4), 6.67 g / L CaCl2·2H2O, 0.0185 g / L (NH4)6Mo7O24·4H2O, 0.198 g / L FeSO4·7H2O, and 100 mL / L Metal 44. NTA was dissolved in 600 mL of water and neutralized with KOH (14.6 g KOH), and the other components were added and dissolved in the order given. The pH was adjusted to 6.8 before making a final volume of 1 L. A precipitate formed when the pH was adjusted from acidic to 6.8 with KOH (approximately 100 mL of 1 M KOH was required), but it eventually redissolved under stirring. The color of the solution changed from dark yellow to straw green as the pH approached 6.8. Filter sterilize and store in a glass bottle wrapped in aluminum foil. Store at 4℃ for at least one year.

[0054] Metal 44: The solvent is water, and the solutes and their concentrations are 2.5 g / L EDTA, 10.95 g / L ZnSO4·7H2O, 5 g / L FeSO4·7H2O, 1.54 g / L MnSO4·H2O, 0.392 g / L CuSO4·5H2O, 0.25 g / L Co(NO3)2·6H2O, and 0.177 g / L Na2B4O7·10H2O. Add EDTA to 800 mL of distilled water and stir, and adjust the pH to about 5.0 with 10 M NaOH to dissolve the EDTA. Add the other metal compounds in the order given (do not add components until the previous one is completely dissolved), and make up the volume to 1 L (final pH is about 2.4, clear lemon green solution). Filter sterilize and store in a glass bottle wrapped in aluminum foil. It can be stored indefinitely at 4°C.

[0055] The gas phase analysis method for nitrogen-fixing bacteria phenotype and nitrogenase activity is:

[0056] Gas chromatography conditions: A flame ionization detector (FID) and a Porapak N column (matrix 80 / 100, 6.0ft (1.8m) × 1 / 8in. × 2.1mm) were used to detect acetylene and ethylene. The temperatures of the injector, detector, and column oven were 120°C, 60°C, and 150°C, respectively. Argon was used as a carrier and the flow rate was 25mL / min. A thermal conductivity detector (TCD) and a Molecular Sieve 5A column (matrix 60 / 80, 6.0ft (1.8m) × 1 / 8in. × 2.1mm) were used to detect hydrogen. The temperatures of the injector, detector, and column oven were 85°C, 60°C, and 120°C, respectively. Argon was used as a carrier and the flow rate was 25mL / min. The injection volume was 100μL.

[0057] Example 1: Construction of genetically engineered bacteria

[0058] (1) Construction of knockout strains of the gene cluster glnK1-amtB1-glnK2-amtB2

[0059] The Rhodopseudomonas palustris CGA009 strain was used as the starting strain. II The gene cluster (sequence of the gene cluster is shown in SEQ ID No. 1) co-transcribed by proteins (GlnK1, GlnK2) and ammonium transporters (AmtB1, AmtB2) was seamlessly knocked out from the genome, while retaining the start codon of the glnK1 gene and the stop codon of the amtB2 gene.

[0060] The specific steps are as follows:

[0061] The genomic DNA of Rhodopseudomonas palustris CGA009 strain was used as a template, and PCR amplification was performed using pJQ-K1-F and pJQ-K1-R (primer sequences are shown in Table 1). The resulting PCR product was an upstream homology arm containing 3 bp of the start codon of the glnK1 gene and the first 1032 bp thereof. PCR amplification was performed using pJQ-B2-F and pJQ-B2-R (primer sequences are shown in Table 1). The resulting PCR product was a downstream homology arm containing 3 bp of the stop codon of the amtB2 gene and the subsequent 1074 bp thereof. The obtained PCR product was a downstream homology arm containing 3 bp of the stop codon of the amtB2 gene and the subsequent 1074 bp thereof on the genome of Rhodopseudomonas palustris CGA009 as shown in SEQ ID About 1000 bp upstream and downstream of the DNA molecule shown in No. 1 were used as homology arms. The 20 bp DNA fragments overlapping the homology arms and the plasmid were cut by T5 exonuclease and constructed at the BamHI restriction site of the plasmid pJQ200SK by homologous recombination. The obtained recombinant plasmid containing the start codon of the glnK1 gene, the stop codon of the amtB2 gene, and the upstream homology arms and downstream homology arms with the correct sequence was recorded as pJQ-glnK1upamtB2down; pJQ-glnK1upamtB2down was transferred into Escherichia coli S17-1, and then the obtained recombinant strain carrying the recombinant plasmid was conjugated and transformed into the palustris Rhodopseudomonas CGA009 strain. The clones were screened in CA solid medium, PM resistance medium, PM sucrose medium, and PM resistance plus sucrose medium in turn. Finally, the clones that did not grow on PM resistance plus sucrose medium and grew on PM sucrose medium were the possible correct single clones. Through PCR identification and sequencing, the colonies with the correct sequences were the successfully constructed bacteria. The corresponding colonies were picked and inoculated into PM medium and cultured statically at 30°C under light to obtain CGA009ΔglnK1amtB1glnK2amtB2 knockout bacteria, recorded as CGA3032, and stored in glycerol tubes at -80°C for long-term storage.

[0062] CGA3032 is a strain in which the glnK1, amtB1, glnK2, and amtB2 genes in the genomic DNA of the Rhodopseudomonas palustris strain CGA009 were knocked out, but the start codon of the glnK1 gene and the stop codon of the amtB2 gene were retained. CGA3032 was identified as follows Figure 1 shown.

[0063] In SEQ ID No.1, positions 1-339 represent the glnK1 gene, encoding the GlnK1 protein shown in SEQ ID No.2; positions 414-1745 of SEQ ID No.1 represent the amtB1 gene, encoding the AmtB1 protein shown in SEQ ID No.3; positions 2055-2393 of SEQ ID No.1 represent the glnK2 gene, encoding the GlnK2 protein shown in SEQ ID No.4; positions 2431-3873 of SEQ ID No.1 represent the amtB2 gene, encoding the AmtB2 protein shown in SEQ ID No.5.

[0064] Table 1

[0065] Primer Name Sequence (5′-3′) pJQ-K1-F tcctgcagcccgggggatcccgatctcgaaccgctcgaggt pJQ-K1-R ccgcgcctcgggagaacttaCATgcgttagcccctcattcgc pJQ-B2-F gaatgaggggctaacgcATGTAAgttctcccgaggcgcggcgt pJQ-B2-R gcggccgctctagaactagtGACAGATTGATCAGGCTTTGGCCCGGCT

[0066] (2)P Ⅱ Construction of protein knockout strain

[0067] The CGA3032 genome obtained in step (1) above was transformed by replacing the glnB gene with the kanamycin resistance gene expression cassette km box through electroporation transformation. The specific steps are as follows:

[0068] The genomic DNA of CGA3032 strain was used as a template, and PCR amplification was performed using pJQ-glnB-UF and pJQ-Bup+KR (primer sequences as shown in Table 2). The resulting PCR product was the upstream homology arm of 997 bp before the start codon of the glnB gene. The PCR amplification was performed using pJQ-Bdown+KF and pJQ-glnB-DR (primer sequences as shown in Table 2). The resulting PCR product was the downstream homology arm of 997 bp after the stop codon of the glnB gene. The DNA molecule shown in SEQ ID No.8 was synthesized, and PCR amplification was performed using pJQ-Bup-Kan-F and pJQ-Bdown-Kan-R (primer sequences as shown in Table 2) as a template. The resulting PCR product was a kanamycin resistance gene expression cassette km having complementary fragments to both the upstream and downstream homology arms. box; the three DNA fragments obtained were cut with T5 exonuclease to form a 20 bp DNA fragment that overlapped with the plasmid and were constructed at the BamHI restriction site of the plasmid pJQ200SK by homologous recombination. The recombinant plasmid with the correct sequence containing the km box and the upstream and downstream homologous arms of the glnB gene was recorded as pJQ-glnB-kan; the DNA of the recombinant plasmid pJQ-glnB-kan was used as a template, and PCR amplification was performed using GlnB-F and GlnB-R (primer sequences are shown in Table 2). The resulting PCR product was 2795 bp containing km The DNA fragments of the upstream and downstream homologous arms of the box and glnB genes, 1μl of about 200ng of this DNA fragment, 40μl of CGA3032 frozen competent cells and 80μl of frozen sterile deionized water were mixed in a gap of 2mm in an electroporation cup, and electroporated in a Bio-rad electroporator under the conditions of 2.5kv voltage, 25uFD capacitance, and 200ohms resistance. Immediately after electroporation, 1ml of PM medium was added and transferred to a 1.5ml centrifuge tube and cultured at 30℃ and 200rpm for 20 hours; 50μl was spread on PM resistant solid medium for screening, and the one that grew up was the possible correct monoclone. Through PCR identification and sequencing, the colony with the correct sequence was the successfully constructed bacterium, and the corresponding colony was picked and inoculated in PM resistant medium, and cultured at 30℃ and light to obtain CGA009ΔPⅡs knockout bacteria, recorded as CGA3033, and stored in glycerol tubes at -80℃ for long-term storage.

[0069] The strain CGA3033 was obtained by replacing the glnB gene in the genomic DNA of the strain CGA3032 with the km box. Figure 2 shown.

[0070] The sequence of the glnB gene is shown in SEQ ID No.6, and the glnB gene encodes the GlnB protein shown in SEQ ID No.7; the kanamycin resistance gene in the kanamycin resistance gene expression cassette is shown in SEQ ID No.8, and the protein encoded by the kanamycin resistance gene expression cassette km box is shown in SEQ ID No.9.

[0071] Table 2

[0072] Primer Name Sequence (5′-3′) pJQ-glnB-U-F tcgaattcctgcagcccgggggatccCGAGGCGGACCTGACCGCAAT pJQ-Bup+K-R CAATCCATCTTGTTCAATCATCACTTACACTCTCCCCGGAC pJQ-Bup-Kan-F GTCCGGGGAGAGTGTAAGTGATGATTGAACAAGATGGATTG pJQ-Bdown-Kan-R GTTGATAGGCCGGGTGCTTATCAGAAGAACTCGTCAAGAAG pJQ-Bdown+K-F CTTCTTGACGAGTTCTTCTGATAAGCACCCGGCCTATCAAC pJQ-glnB-D-R gcggccgctctagaactagtggatccATGATGCCGCCGATGTAGTG GlnB-F CGAGGCGGACCTGACCGCAATGC GlnB-R ATGATGCCGCCGATGTAGTGGAGGC

[0073] Example 2: Detection of Molybdenum Nitrogenase Activity Expressed by Genetically Engineered Bacteria

[0074] The activity of nitrogenase can be quantitatively detected by the hydrogen production and acetylene reduction activity of the strain under nitrogen fixation conditions, among which molybdenum nitrogenase can reduce acetylene to ethylene, and it is characterized by gas chromatography detection. The wild-type strain Rhodopseudomonas palustris CGA009 (i.e. WT) and CGA3032 cultured in PM medium and NFM medium were used as controls, and the nitrogenase activity of the genetically engineered strain CGA3033 cultured in PM medium and NFM medium was detected.

[0075] (1) Comparison of hydrogen production under nitrogen fixation conditions between wild bacteria and engineered bacteria

[0076] When the anaerobic culture reached a stable growth period, the upper gas was tested by gas chromatography to analyze the amount of H2 produced. Then, 1 mL of bacterial solution was collected by centrifugation at 12000 rpm for 1 min, resuspended with 200 μl 1M NaOH solution, boiled for 15 min, centrifuged at 12000 rpm for 1 min, and the total protein concentration of the supernatant was determined by Bradford protein concentration determination kit. The gas production per unit protein concentration of each strain was calculated. Each experiment was repeated 3 times.

[0077] Through the above experiments, it was found that strain CGA3033 produced hydrogen under non-nitrogen-fixing conditions (i.e., PM medium culture), relieving the inhibition of ammonium, while CGA009 did not produce hydrogen under non-nitrogen-fixing conditions, and the hydrogen production of CGA3032 was much lower than that of CGA3033 ( Figure 3 (A).

[0078] (2) Comparison of acetylene reduction activity between wild bacteria and engineered bacteria

[0079] When the anaerobic culture strains were cultured to the mid-logarithmic phase, the bacterial solution was transferred to a nitrogen anaerobic tube containing 0.5% acetylene. After standing at 30°C for 0.5 hours, samples were taken every 20 minutes to detect ethylene production. Then, 1 mL of bacterial solution was taken, centrifuged at 12000 rpm for 1 minute to collect the bacteria, resuspended with 200 μl 1M NaOH solution, boiled for 15 minutes, centrifuged at 12000 rpm for 1 minute, and the supernatant was measured for protein concentration using a Bradford protein concentration assay kit. The gas production per unit protein concentration of the strain was calculated. Each experiment was repeated 3 times.

[0080] Gas chromatography revealed that the genetically engineered bacterium CGA3033 could reduce acetylene to ethylene under non-nitrogen-fixing conditions, indicating that the genetically engineered bacterium CGA3033 expressed active molybdenum nitrogenase, while CGA009 did not produce ethylene under non-nitrogen-fixing conditions, and the ethylene production of CGA3032 was much lower than that of CGA3033 ( Figure 3 (middle B).

[0081] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. An engineered bacterium of Rhodopseudomonas palustris, comprising the following characteristics: A1) does not contain the glnK1 gene; A2) does not contain the glnK2 gene; A3) does not contain the amtB1 gene; A4) does not contain the amtB2 gene; A5) does not contain the glnB gene.

2. The engineered bacteria according to claim 1, characterized in that: The engineered bacteria also contain a resistance gene expression box.

3. A method for preparing an engineered bacterium of Rhodopseudomonas palustris, comprising: Using Rhodopseudomonas palustris as a recipient bacterium, and performing transformations including steps B1) to B5) on the recipient bacterium to obtain an engineered Rhodopseudomonas palustris bacterium; B1) knocking out the glnK1 gene in the recipient bacteria or reducing the content or activity of the GlnK1 protein in the recipient bacteria; B2) knocking out the glnK2 gene in the recipient bacteria or reducing the content or activity of the GlnK2 protein in the recipient bacteria; B3) knocking out the amtB1 gene in the recipient bacteria or reducing the content or activity of the AmtB1 protein in the recipient bacteria; B4) knocking out the amtB2 gene in the recipient bacteria or reducing the content or activity of the AmtB2 protein in the recipient bacteria; B5) knocking out the glnB gene in the recipient bacteria or reducing the content or activity of the GlnB protein in the recipient bacteria.

4. The method according to claim 3, characterized in that: The method further comprises introducing a resistance gene expression cassette into the recipient bacteria.

5. The engineered bacteria of Rhodopseudomonas palustris obtained by the method according to claim 3 or 4.

6. A bacterial agent, characterized in that: The active ingredient of the bacterial agent is the engineered bacteria of Rhodopseudomonas palustris as described in claim 1, 2 or 5.

7. Use of the engineered Rhodopseudomonas palustris according to claim 1, 2 or 5 in the preparation of microbial fertilizer, or in the preparation of nitrogen-fixing fertilizer.

8. Use of the method according to claim 3 or 4 in preparing microbial fertilizer, or in preparing nitrogen-fixing fertilizer.

9. A method for relieving the fixed nitrogen inhibition of Rhodopseudomonas palustris, comprising: Performing transformations including B1)-B5) on Rhodopseudomonas palustris to obtain engineered Rhodopseudomonas palustris; B1) knocking out the glnK1 gene in the recipient bacteria or reducing the content or activity of the GlnK1 protein in the recipient bacteria; B2) knocking out the glnK2 gene in the recipient bacteria or reducing the content or activity of the GlnK2 protein in the recipient bacteria; B3) knocking out the amtB1 gene in the recipient bacteria or reducing the content or activity of the AmtB1 protein in the recipient bacteria; B4) knocking out the amtB2 gene in the recipient bacteria or reducing the content or activity of the AmtB2 protein in the recipient bacteria; B5) knocking out the glnB gene in the recipient bacteria or reducing the content or activity of the GlnB protein in the recipient bacteria.

10. The method according to claim 9, characterized in that: The fixed nitrogen is ammonium nitrogen.

Images