Genetic transformation method and application of Chinese orchid

Abstract

The invention relates to the technical field of transgenic breeding, in particular to an efficient genetic transformation method of Chinese orchid based on rhizomes. The method comprises the following steps: infecting a Chinese orchid rhizome by using agrobacterium carrying a target gene, and sequentially carrying out co-culture, recovery culture and screening culture to obtain a positive explant; and culturing the positive explant to obtain a positive seedling. The invention provides an efficient genetic transformation method based on rhizomes for the Chinese orchid for the first time, a Chinese orchid genetic transformation system is determined, and a basis is provided for transgenic breeding of the Chinese orchid.

Description

Technical Field

[0001] The invention relates to the technical field of transgenic breeding, and in particular to a high-efficiency genetic transformation method of Cymbidium sinense based on rhizomes. Background Art

[0002] Cymbidium Cymbidium sp ) is a flower with high ornamental value. It not only inherits the cultural tradition of China for thousands of years, but is also the flower with the most economic value now. The infancy of orchids is very long. It usually takes 4 years from sowing to flowering, which makes the orchid breeding very slow. At present, orchid breeding is very backward, mainly through traditional hybrid breeding and mutation breeding, which are time-consuming and non-directional.

[0003] In view of this, the present invention is proposed. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a highly efficient genetic transformation method of Cymbidium based on rhizomes.

[0005] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a genetic transformation method for Cymbidium grandiflorum, comprising: infecting Cymbidium grandiflorum rhizomes with Agrobacterium carrying a target gene, and then subjecting the rhizomes to co-cultivation, recovery culture and screening culture to obtain positive explants; culturing the positive explants to obtain positive seedlings; the rhizomes of Cymbidium grandiflorum are first subjected to proliferation culture and then to infection treatment; the culture medium used for the proliferation culture comprises the following components in concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, agar 8±2 g / L, and coconut juice 10.0 vol%±1.0 vol%.

[0006] The invention uses a proliferation medium with a specific formula, including 0.008±0.001 mg / L 6-BA, 0.4±0.1 mg / L NAA, 8±2 g / L agar, and 10.0 vol%±1.0 vol% coconut juice. The culture medium can promote the growth and proliferation of rhizomes. A large number of adventitious buds can be germinated after culturing in the culture medium for about 2 weeks, and a large number of new rhizomes can be generated for subculture in about 1.5 months.

[0007] Preferably, the variety of the Chinese orchid is "Korean Peach Blossom", purchased from Guangdong (Wengyuan) Orchid Research Institute.

[0008] Preferably, the Cymbidium rhizomes are first subjected to proliferation culture and then to infection treatment; the culture medium used for the proliferation culture includes components of the following concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5g / L, sucrose 30±5 g / L, agar 8±2 g / L, and coconut juice 10.0 vol%±1.0 vol%.

[0009] In the present invention, the infection comprises the following steps: placing the rhizome of Cymbidium chinense in a sterile container, adding sterile fine sand and Agrobacterium infection solution, and culturing in a shaking table in a dark state; the particle size of the sterile fine sand is 40-80 mesh; the OD of the Agrobacterium infection solution is 600 The value is 0.4~0.8; the usage ratio of the sterile fine sand and the Agrobacterium infection solution is 10±2 g:100±20 mL.

[0010] In the infection method provided by the present invention, the fine sand treatment causes wounds on the rhizomes, which is conducive to the infection of Agrobacterium into the plant body through the wounds. 600 When the value is less than 0.4, the infection effect is poor, and when it is greater than 0.8, the infection is too strong, making it difficult to inhibit the growth of Agrobacterium in the later stage.

[0011] In the present invention, in addition to Agrobacterium, the Agrobacterium infection solution preferably also includes the following components in concentration: Huaduoduo No. 1 2±0.5 g / L, acetosyringone 100±5 mM, glycerol 1.0 vol%±0.2 vol%; 1 / 2 MS.

[0012] In the present invention, the culture medium used for the co-cultivation preferably includes the following components at the following concentrations: Huaduoduo No. 1 2±0.5 g / L, agar 8±2 g / L; 1 / 2 MS. Under this formula, the growth state of the rhizomes is better and is conducive to the infection of Agrobacterium.

[0013] In the present invention, the culture medium used for the recovery culture preferably includes the following components at the following concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, and activated carbon 0.5±0.1 g / L. After the rhizomes are infected by Agrobacterium, culturing them in the recovery culture medium for a period of time is conducive to the germination of positive adventitious buds.

[0014] In the present invention, the target gene is preferably connected to the overexpression vector pCAMBIA3301. The pCAMBIA3301 vector can be purchased from conventional commercial sources, and the hygromycin resistance gene ( hygromycinGene) can be used for screening of positive transformation. In the present embodiment, the pCAMBIA3301 vector used is stored in the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0015] In the present invention, the screening culture preferably includes one screening and two screenings.

[0016] The culture medium used in the first screening preferably includes components of the following concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, 10.0 vol%±1.0 vol% coconut juice, and hygrozyme 5±0.5 mg / L; the basic formula of the culture medium is a proliferation medium, and hygrozyme will inhibit the germination and growth of wild-type adventitious buds at this concentration, but has little effect on the germination and growth of positive adventitious buds.

[0017] The culture medium used in the second screening preferably includes the following components at the following concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, 10.0 vol%±1.0 vol% coconut juice, and hygrozyme 12±1 mg / L. The concentration of hygrozyme in the second screening culture medium will strongly inhibit the growth of wild-type adventitious buds and even cause death, while having little effect on the growth of positive adventitious buds.

[0018] In the present invention, co-cultivation is mainly used to ensure that the rhizomes grow well while Agrobacterium can infect; recovery culture is mainly used to allow the rhizomes to recover quickly after Agrobacterium infection, which is beneficial to later screening and cultivation; the first screening of low-amount antibiotics can inhibit the germination of non-positive adventitious buds and cause little damage to positive adventitious buds; the second screening of high-concentration antibiotics is used to screen out non-positive buds.

[0019] In the present invention, culturing the positive explants includes a rooting culture step, and the culture medium used for the rooting culture preferably includes the following components in concentrations: Huabao No. 1 3.0±0.5 g / L, peptone 2±0.5 g / L, agar 8g±2 / L; 1 / 2 MS.

[0020] In a second aspect, the present invention provides the application of the aforementioned Cymbidium orchid genetic transformation method in Cymbidium orchid breeding.

[0021] Beneficial effects: The present invention provides a highly efficient genetic transformation method for Cymbidium chinense. The method uses Agrobacterium carrying a target gene to infect Cymbidium chinense rhizomes, and then sequentially performs co-cultivation, recovery culture and screening culture to obtain positive explants; the positive explants are cultured to obtain positive seedlings. The present invention proposes a highly efficient genetic transformation method based on rhizomes for Cymbidium chinense for the first time, establishes a genetic transformation system for Cymbidium chinense, and provides a basis for transgenic breeding of Cymbidium chinense. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0023] Figure 1 The identification results of the positive plants in Example 2 of the present invention, wherein A is a positive bud overexpressing the purple RUBY gene; B is the outer leaves of the positive bud cut and placed under a stereomicroscope for observation; C is a new bud germinated under normal conditions without Agrobacterium infection; D is the outer leaves of the bud cultured under normal conditions cut and placed under a stereomicroscope for observation; E is the transgenic positive buds and negative buds observed under a stereomicroscope under bright field; F is the transgenic positive buds and negative buds observed under a stereomicroscope under blue light excitation; G is the sequencing result analysis, the double-stranded sequence in the top row is the hygromycin gene sequence; the first row is the sequencing results of the RUBY-positive plants; the second row is the sequencing results of the eGFP-positive plants. DETAILED DESCRIPTION

[0024] In order to accelerate the development of orchid breeding and cultivate high ornamental value, excellent quality and meet market demand, our team is committed to studying the genetic transformation system of orchids and establishing a transgenic breeding system for orchids. Our team has established a regeneration system for multiple Chinese orchid strains. In comparison, it was found that the "Korean Peach Blossom" genotype has the advantages of strong regeneration ability, fast proliferation rate, and strong stress resistance, which is suitable for the development of transgenic systems. Therefore, based on the mature rhizome regeneration system, our team further established an efficient transgenic system.

[0025] The present invention mainly comprises the following steps: (1) proliferation of rhizomes of Cymbidium chinense; (2) cultivation and activation of Agrobacterium; (3) infection of rhizomes of Cymbidium chinense by Agrobacterium; (4) infection of rhizomes of Cymbidium chinense by Agrobacterium and co-cultivation; (5) recovery culture and screening culture of positive adventitious buds of Cymbidium chinense; (6) rooting culture of explants of Cymbidium chinense; and (7) training and transplantation of positive seedlings of Cymbidium chinense.

[0026] In a more specific embodiment, the present invention provides a method for genetic transformation of Cymbidium orchids using rhizomes as explants, comprising the following steps: (1) Propagation of rhizomes of Cymbidium orchid: Select sterile seedlings in good growth condition, remove the leaves and roots, retain the rhizomes and culture them in the rhizomes proliferation medium of Cymbidium orchid.

[0027] (2) Cultivation and activation of Agrobacterium: Select Agrobacterium with the target gene and place it in a solid culture medium for streak culture. After about two days, pick a single clone with a perfect circle and good growth for colony PCR identification. Place the Agrobacterium identified as positive in about 150 ml of liquid culture medium for cultivation in the dark, at a speed of 180 rpm and at 28°C. After culturing for about two days, collect the Agrobacterium cells by centrifugation and resuspend them in the infection solution to prepare an OD value of 0. 600 Agrobacterium infection solution with a value between 0.4 and 0.8.

[0028] (3) Agrobacterium infection of Cymbidium rhizomes: Place the Cymbidium rhizomes in a 250 ml sterile conical flask, add about 10 g of white sterile fine sand, pour in about 100 ml of Agrobacterium infection solution, place on a shaker, and incubate in the dark at 180 rpm and 28°C for 45 minutes.

[0029] (4) Agrobacterium infection of Cymbidium rhizomes and co-cultivation: Take out the Cymbidium rhizomes, absorb the surface solution with sterile filter paper and blow dry them under a clean bench for about 15 minutes. Then place them on the co-culture medium and culture them in the dark at 28°C for two days.

[0030] (5) Recovery culture and screening culture of positive adventitious buds of Cymbidium: After two days of culture on the co-culture medium, the rhizomes are placed in a sterilization solution for cleaning, then thoroughly washed with sterile water, blown dry and placed in a recovery culture medium for culture for 14 days, then placed in a first-screen culture medium for screening for about 45 days, and then the explants are placed in a second-screen culture medium for screening for 45 days.

[0031] (6) Rooting induction of Cymbidium explants: The selected explants are transferred to the rooting medium and cultured for about one month.

[0032] (7) Training, transplanting and identification of positive seedlings of Cymbidium: After the Cymbidium takes root, open the bottle cap and train the seedlings for 7 days. Then transplant them into nutrient soil and extract DNA from leaves using the CTAB method. hygromycin The gene was amplified by PCR and sequenced.

[0033] Preferably, the orchid described in step (1) is a strain of "Korean Peach Blossom".

[0034] Preferably, the rhizome proliferation medium for Cymbidium sinense in step (1) has the following formula (1 L): 6-BA 0.008 mg / L + NAA 0.4 mg / L + peptone 2 g / L + sucrose 30 g / L + agar 8 g / L + 10.0% coconut juice.

[0035] Preferably, the Agrobacterium infection solution in step (2) has the following formula (1 L): Huaduoduo No. 1 2 g / L + acetosyringone 100 mM + glycerol 1% (volume ratio) + 1 / 2 MS.

[0036] Preferably, in step (3), about 10 g of natural beach fine sand with a particle size of about 40-80 mesh is added.

[0037] Preferably, the co-culture medium formula in step (4) is: Huaduoduo No. 1 2 g / L + 1 / 2 MS + agar 8 g / L; Preferably, the recovery medium formula in step (5) is: 6-BA (6-benzylaminoadenine) 0.008 mg / L + NAA 0.4 mg / L + peptone 2 g / L + sucrose 30 g / L + agar 8 g / L + activated carbon 0.5 g / L.

[0038] Preferably, the first screening culture medium formula in step (5) is: 6-BA 0.008 mg / L + NAA 0.4 mg / L + peptone 2 g / L + sucrose 30 g / L + agar 8 g / L + 10.0% coconut juice + hygrozyme 5 mg / L.

[0039] Preferably, the second screening culture medium formula of step (5) is: 6-BA 0.008 mg / L + NAA 0.4 mg / L + peptone 2 g / L + sucrose 30 g / L + agar 8 g / L + 10.0% coconut juice + hygrozyme 12 mg / L.

[0040] Preferably, the formula of the rooting medium in step (6) is: Hyponex (Huabao No. 1) 3.0 g / L + peptone 2 g / L + 1 / 2 MS + agar 8 g / L.

[0041] Preferably, the primers used for the PCR amplification in step (7) are: HPT_F: CTCTCGGAGGGCGAAGAATC (SEQ ID NO.01); HPT_R: TGCTGCTCCATACAAGCCAA (SEQ ID NO.02).

[0042] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0043] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0044] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "specific implementations", or "some specific implementations" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0045] In the examples provided in this specification, if no specific techniques or conditions are specified, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0046] Example 1 This embodiment provides a method for efficient genetic transformation of Cymbidium sinense based on rhizomes, the steps are as follows: (1) Propagation of rhizomes of Cymbidium orchid: Select sterile seedlings in good growth condition, remove the leaves and roots, retain the tubers and place them in the rhizome proliferation medium of Cymbidium orchid for cultivation.

[0047] (2) Cultivation and activation of Agrobacterium: Select Agrobacterium with the target gene introduced, place it in a solid culture medium for line culture, and after about two days, pick a single clone with a perfect circle and good growth for colony PCR identification. Place the Agrobacterium identified as positive in about 150 ml of liquid culture medium for cultivation in the dark, at a speed of 180 rpm and 28°C. Cultivate for about two days, then centrifuge the Agrobacterium, discard the supernatant, and resuspend it in the infection solution to prepare an OD value. 600 Liquids with values ​​between 0.4 and 0.8.

[0048] (3) Agrobacterium infection of Cymbidium rhizomes: Place the Cymbidium tubers in a 250 ml sterile conical flask, add about 10 g of white fine sand, pour in about 100 ml of Agrobacterium infection solution, place on a shaker, and incubate in the dark at 180 rpm and 28°C for 45 minutes.

[0049] (4) Agrobacterium infection of Cymbidium rhizomes and co-cultivation: Take out the Cymbidium tubers, absorb the surface solution with sterile filter paper and blow dry under a clean bench for about 15 minutes. Then, culture on the co-culture medium in the dark at 28°C for two days.

[0050] (5) Recovery culture and screening culture of positive adventitious buds of Cymbidium: After two days of culture, the rhizomes were placed in a sterilization solution for cleaning, then washed with sterile water, blown dry and placed in a recovery medium for culture for 14 days, then placed in a first-screen medium for screening for about 45 days, and then the explants were placed in a second-screen medium for screening for 45 days.

[0051] (6) Rooting induction of Cymbidium explants: The selected explants are transferred to the rooting medium and cultured for about one month.

[0052] (7) Training, transplanting and identification of positive seedlings of Cymbidium: After the Cymbidium takes root, open the bottle cap and train the seedlings for 7 days. Then transplant them into nutrient soil and extract DNA from leaves using the CTAB method. hygromycin The gene was amplified by PCR and sequenced.

[0053] Example 2 This example provides a method for overexpressing the purple gene "RUBY" in a Chinese orchid of the genotype "Korean Peach Blossom", as follows: (1) Obtaining “Korean Peach Blossom” Explants The seeds of "Korean Peach Blossom" are sterilized and then placed in the orchid seeding medium for cultivation. After about 8-12 months, a large number of sterile seedlings of "Korean Peach Blossom" are obtained; the leaves and roots of the seedlings are removed under sterile conditions, and the rhizomes are retained.

[0054] (2) Agrobacterium preparation and explant infection The purple gene "RUBY" was connected to the overexpression vector pCAMBIA3301, and the target gene vector was transferred into the competent Agrobacterium by liquid nitrogen method, and the positive Agrobacterium single clone was selected by PCR. Then, after the positive Agrobacterium was propagated, the Agrobacterium infection solution was prepared, and the Korean peach rhizomes were placed in the Agrobacterium infection solution, placed in a shaking table, and cultured in the dark, 180 rpm and 28℃ for 45 minutes. The rhizomes were taken out and the bacterial solution on the surface was absorbed with sterile filter paper, and then placed in the co-culture medium for dark culture.

[0055] (3) Explant cultivation, screening and seedling hardening After two days of co-cultivation, the explants are placed in a sterilization solution for sterilization, and then placed in a recovery medium for culture for 14 days, and then placed in a first-screen medium for about 45 days; explants with good growth conditions are placed in a second-screen medium, and after about 45 days, explants with good growth conditions are selected, and rhizomes with good growth and new buds are placed in a rooting medium, and after the root system is well developed, they are hardened and transplanted.

[0056] (4) Identification of positive plants Due to the introduction of the purple gene "RUBY", positive plants will differentiate and sprout purple buds ( Figure 1 (A in the middle), put the leaf under a stereomicroscope and observe that the purple cells are evenly distributed ( Figure 1 Middle B). Normal buds are green ( Figure 1 C in the middle) and the cells in the leaves are all green ( Figure 1 When the plant grows leaves, new leaves are taken for PCR and sequencing. The sequencing results are as follows Figure 1 As shown in Figure G, it is completely consistent with the exogenously introduced hygromycin resistance gene sequence.

[0057] Example 3 This example provides a method for overexpressing the green fluorescent gene "eGFP" in a Chinese orchid of the genotype "Korean Peach Blossom", as follows: (1) Obtaining “Korean peach blossom” explants.

[0058] The seeds of "Korean Peach Blossom" are sterilized and then placed in the orchid seeding medium for cultivation. After about 8-12 months, a large number of sterile seedlings of "Korean Peach Blossom" are obtained; the leaves and roots of the seedlings are removed under sterile conditions, and the rhizomes are retained.

[0059] (2) Agrobacterium preparation and explant infection The green fluorescent gene "eGFP" was connected to the overexpression vector pCAMBIA3301, and the target gene vector was transferred into the competent Agrobacterium by liquid nitrogen method, and the positive Agrobacterium single clone was selected by PCR. Then, after the positive Agrobacterium was propagated, the Agrobacterium infection solution was prepared, and the Korean peach rhizomes were placed in the Agrobacterium infection solution, placed in a shaking table, and cultured in the dark, 180 rpm and 28℃ for 45 minutes. The rhizomes were taken out and the bacterial solution on the surface was absorbed with sterile filter paper, and then placed in the co-culture medium for dark culture.

[0060] (3) Explant cultivation, screening and seedling hardening After two days of co-cultivation, the explants are placed in a sterilization solution for sterilization, and then placed in a recovery medium for culture for 14 days, and then placed in a first-screen medium for about 45 days; explants with good growth conditions are placed in a second-screen medium, and after about 45 days, explants with good growth conditions are selected, and rhizomes with good growth and new buds are placed in a rooting medium, and after the root system is well developed, they are hardened and transplanted.

[0061] (4) Identification of positive plants eGFP will release green fluorescence under blue excitation light, and the fluorescent new shoots are screened using a stereomicroscope. Figure E shows the positive new shoots with green fluorescence and the negative new shoots. When the plants grow into seedlings, the leaves are taken for PCR and sequencing. The sequencing result G shows that it is completely consistent with the exogenously introduced hygromycin resistance gene sequence.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for genetic transformation of Cymbidium orchid, characterized in that: After infecting the rhizomes of Cymbidium chinense with Agrobacterium carrying the target gene, the positive explants are obtained by co-cultivation, recovery culture and screening culture in sequence; the positive explants are cultured to obtain positive seedlings; the rhizomes of Cymbidium chinense are first subjected to proliferation culture and then to infection treatment; the culture medium used for the proliferation culture includes the following components in concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, agar 8±2 g / L, coconut juice 10.0 vol%±1.0 vol%.

2. The genetic transformation method according to claim 1, characterized in that The variety of the national orchid is "Korean Peach Blossom".

3. The genetic transformation method according to claim 1, characterized in that The rhizomes of Cymbidium sinense are first subjected to proliferation culture and then to infection treatment; the culture medium used for the proliferation culture includes the following components in concentration: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, and coconut juice 10.0 vol%±1.0 vol%.

4. The genetic transformation method according to claim 1, characterized in that The infection comprises the following steps: placing the rhizome of Cymbidium chinense in a sterile container, adding sterile fine sand and Agrobacterium infection solution, and culturing in a shaking table in a dark state; the particle size of the sterile fine sand is 40-80 meshes; the OD of the Agrobacterium infection solution is 600 The value is 0.4~0.8; the usage ratio of the sterile fine sand and the Agrobacterium infection solution is 10±2 g:100±20 mL.

5. The genetic transformation method according to claim 4, characterized in that In addition to Agrobacterium, the Agrobacterium infection solution also includes components with the following concentrations: Huaduoduo No. 1 2±0.5 g / L, acetosyringone 100±5 mM, glycerol 1.0 vol%±0.2 vol%; 1 / 2 MS.

6. The genetic transformation method according to claim 1, characterized in that The culture medium used for the co-cultivation includes the following components in concentrations: Huaduoduo No. 1 2±0.5 g / L, agar 8±2 g / L; 1 / 2 MS.

7. The genetic transformation method according to claim 1, characterized in that The culture medium used for the recovery culture includes components with the following concentrations: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, and activated carbon 0.5±0.1 g / L.

8. The genetic transformation method according to claim 1, characterized in that The target gene is connected to the overexpression vector pCAMBIA3301; the screening culture includes one screen and two screens; the culture medium used in the first screen includes the following components in concentration: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, 10.0 vol%±1.0 vol% coconut juice, and hygrozyme 5±0.5 mg / L; the culture medium used in the second screen includes the following components in concentration: 6-BA 0.008±0.001 mg / L, NAA 0.4±0.1 mg / L, peptone 2±0.5 g / L, sucrose 30±5 g / L, agar 8±2 g / L, 10.0 vol%±1.0 vol% coconut juice, and hygrozyme 12±1 mg / L.

9. The genetic transformation method according to claim 1, characterized in that Cultivating the positive explants includes a rooting culture step, and the culture medium used for the rooting culture includes the following components in concentration: Huabao No. 1 3.0±0.5 g / L, peptone 2±0.5 g / L, agar 8g±2 / L; 1 / 2 MS.

10. Application of the genetic transformation method according to any one of claims 1 to 9 in Cymbidium orchid breeding.

Images