Kit for rapidly purifying viral nucleic acid from different types of liquid biological samples and extraction method

Abstract

The invention discloses a kit for rapidly purifying viral nucleic acid from different types of liquid biological samples and an extraction method. The kit comprises the following reagents: a lysis binding solution, a protease k solution, magnetic beads, a washing solution I, a washing solution II and an eluent. When the kit is used for extracting the viral nucleic acid, the three steps of protease K digestion, lysate lysis and nucleic acid combination are simultaneously carried out, the operation steps are greatly simplified, the extraction time of the viral nucleic acid is shortened, and the obtained high-quality viral nucleic acid can be directly applied to downstream experiments such as PCR (Polymerase Chain Reaction), RT-PCR (Reverse Transcription-Polymerase Chain Reaction), qPCR (Quantitative Polymerase Chain Reaction) and the like.

Description

Technical Field

[0001] The present invention relates to the fields of biochemistry and molecular biology, and in particular to a kit and an extraction method for rapidly purifying viral nucleic acids from different types of liquid biological samples. Background Art

[0002] With the development of molecular biology and the deepening of understanding of infectious diseases, viral nucleic acid detection plays an increasingly important role in disease prevention and control, clinical diagnosis and scientific research. The types of viral nucleic acids mainly include DNA and RNA, and the efficient and rapid extraction of viral nucleic acids from liquid biological samples (such as serum, plasma, saliva, urine, cell supernatant, tissue homogenate, etc.) is crucial for related research and clinical applications. Different fluids containing viruses have significant differences in component composition, chemical properties, etc., and may contain different inhibitors or other components, which poses a challenge to the separation of viral nucleic acids. For example, serum / plasma is rich in proteins (such as albumin and immunoglobulin); saliva has high levels of mucin and digestive enzymes; the virus concentration in urine is usually low, and some metabolic wastes may inhibit downstream reactions; cell culture medium mainly contains culture medium, serum and antibiotics required to maintain cell survival and promote viral replication; tissue homogenate has complex components, including cell membranes, organelles and other structures, requiring efficient cell lysis and protease treatment to release viral nucleic acids, while avoiding nucleic acid damage caused by excessive treatment.

[0003] Magnetic bead-based nucleic acid extraction is an efficient and rapid nucleic acid separation and purification technology based on nanomagnetic beads. This method uses specific chemical groups modified on the surface of magnetic beads to specifically bind to nucleic acid molecules (such as DNA or RNA) and achieve the capture, washing and release of nucleic acids under the action of an external magnetic field. As an emerging nucleic acid extraction technology, the magnetic bead method has the characteristics of rapidity and efficiency, good repeatability and stability, easy automation, and high-throughput operation, which greatly meets the needs of large-scale nucleic acid testing.

[0004] However, the existing magnetic bead-based viral nucleic acid extraction methods have a low nucleic acid yield for samples containing complex matrices or low concentrations of viral nucleic acids. This may be due to insufficient lysis, insufficient binding capacity (e.g., small specific surface area of ​​magnetic beads, few functional groups), or insufficient elution. In addition, most methods require the addition of binding solution separately, and sample lysis and nucleic acid binding are two separate steps, resulting in a long sample pre-treatment time, which significantly reduces the extraction efficiency. Summary of the invention

[0005] The object of the present invention is to provide a kit for rapidly purifying viral nucleic acids from different types of liquid biological samples.

[0006] To achieve the above-mentioned purpose, the present invention provides the following technical scheme: a kit for rapidly purifying viral nucleic acid from different types of liquid biological samples, the kit comprising the following reagents: a lysis binding solution, a proteinase K solution, magnetic beads, a washing solution I, a washing solution II, and an eluting solution, the lysis binding solution comprising guanidine hydrochloride with a final concentration of 1 to 3 M, sodium citrate with a final concentration of 5 to 25 mM, Tween with a volume percentage of 0.5 to 2.5%, polyvinyl pyrrolidone with a mass percentage of 0.5 to 5%, diethylene glycol ethyl ether with a volume percentage of 5 to 10%, glycogen with a final concentration of 0.5 mg / ml, ethylenediaminetetraacetic acid with a final concentration of 5 to 50 mM, and isopropanol with a volume percentage of 50%, and the pH value of the lysis solution is 5 to 8.

[0007] As a specific implementation, the concentration of the proteinase K solution is 10-50 mg / ml.

[0008] As a specific implementation, the magnetic beads are silanol magnetic beads with a particle size of 200 nm to 1 μm.

[0009] As a specific embodiment, the washing solution I comprises: Tris-HCl with a final concentration of 20 to 50 mM, EDTA with a final concentration of 5 to 10 mM, 1% by volume of Tween and 20 to 80% by volume of ethanol, and the pH value of Tris-HCl is 7.0.

[0010] As a specific implementation, the washing solution II comprises: Tris-HCl with a final concentration of 20 to 50 mM, EDTA with a final concentration of 5 to 10 mM, and 70% by volume of ethanol, and the pH value of Tris-HCl is 7.0.

[0011] As a specific implementation manner, the eluent is water treated with diethyl pyrocarbonate.

[0012] Another object of the present invention is to provide an extraction method for rapidly purifying viral nucleic acid from different types of liquid biological samples, using the above-mentioned kit, and using a nucleic acid extractor model EZB-NE96 produced by Suzhou Yingze Biomedical Technology Co., Ltd. in the extraction process, and the extraction steps are as follows:

[0013] (1) Add magnetic beads, lysis and binding solution, washing solution I, washing solution II and elution solution to the deep well plate respectively;

[0014] (2) adding proteinase K solution and the virus sample to be tested to the deep-well plate containing the lysis and binding solution;

[0015] (3) Place all deep-well plates in the corresponding plate positions of the nucleic acid extraction instrument, and place the magnetic rod sleeve in the corresponding deep-well plate;

[0016] (4) Set up the running program and start it;

[0017] (5) After the procedure is completed, the eluted product is transferred to a 1.5 ml centrifuge tube or a 96-well PCR plate, and the resulting RNA is subjected to quantitative PCR detection.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1) The present invention uses a lysis solution and proteinase K together. The lysis solution provides a chemical environment that is conducive to the release of viral nucleic acids, and proteinase K further digests proteins. The present invention also ensures that the lysis solution does not inhibit the activity of proteinase K. The two complement each other and can more fully lyse complex liquid samples;

[0020] 2) The present invention optimizes the ratio of protein denaturants, surfactants, salt ions and other components in the lysate. Guanidine isothiocyanate (GITC) or guanidine hydrochloride (GuHCl) can not only effectively denature proteins, but also inhibit the activity of RNase and DNase, protecting nucleic acids from degradation; surfactants such as NP-40, Tween, Triton X-100, PVP, etc. can help dissolve lipids and destroy viral envelopes, thereby promoting the release of nucleic acids; EDTA can inhibit the activity of nucleases by binding divalent cations; glycogen as a precipitation aid can promote the precipitation of trace nucleic acids; Tris, Hepes, citrate and other buffers provide a suitable environment for lysis;

[0021] 3) The present invention realizes the simultaneous implementation of three steps of proteinase K digestion, lysis by lysis solution and nucleic acid binding. Only proteinase K and samples need to be added manually, and the remaining operations are completed on a nucleic acid extractor, which greatly simplifies the manual operation steps and can efficiently, quickly and high-throughput separate and purify viral nucleic acids. The obtained viral nucleic acids can be directly applied to downstream experiments such as PCR, RT-PCR and qPCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is an amplification curve diagram of different concentrations of 2019-nCOV pseudovirus RNA extracted from plasma in Example 1 of the present invention;

[0023] Figure 2 This is an amplification curve diagram of different concentrations of 2019-nCOV pseudovirus RNA extracted from saliva in Example 2 of the present invention;

[0024] Figure 3 This is an amplification curve diagram of different concentrations of 2019-nCOV pseudovirus RNA extracted from the cell culture supernatant in Example 3 of the present invention;

[0025] Figure 4This is an amplification curve diagram of different concentrations of 2019-nCOV pseudovirus RNA extracted from tissue homogenate in Example 4 of the present invention;

[0026] Figure 5 For implementation 5, a comparison chart of the Ct values ​​of 2019-nCOV pseudovirus RNA extracted from different liquids using the present invention and a comparison kit (Thermo Fisher magnetic bead virus nucleic acid extraction kit). DETAILED DESCRIPTION

[0027] The following will be combined with the accompanying drawings to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Example 1

[0029] Extraction of different concentrations of 2019-nCOV pseudovirus RNA from plasma:

[0030] Sample preparation: 2019-nCOV pseudovirus was purchased from Fubaiao (Suzhou) Biotechnology Co., Ltd., and the stock solution concentration was 1×10 8 copies / ml, and diluted to 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 Each concentration was repeated 2 times.

[0031] Extraction of viral RNA: The specific extraction steps using an automated instrument (our company's own nucleic acid extractor EZB-NE96) are as follows:

[0032] (1) Take out six 96-well deep-well plates, label them as Plate 1 to Plate 6, add the corresponding reagents according to Table 1, and add the required number of wells according to the number of samples.

[0033] Table 1

[0034] Deep well plate number Components volume Plate 1 Magnetic beads 400 μl / well Plate 2 Lysis and Binding Solution 400 μl / well Plate 3 Washing liquid I 500 μl / well Plate 4 Washing liquid II 500 μl / well Plate 5 Washing liquid II 500 μl / well Plate 6 DEPC water 100 μl / well

[0035] Here, the magnetic beads are silanol magnetic beads with a particle size of 200 nm to 1 μm, and 1 mg of magnetic beads is required for a single sample.

[0036] The lysis binding solution includes guanidine hydrochloride with a final concentration of 3M, sodium citrate with a final concentration of 15mM, Tween with a volume percentage of 2.5%, polyvinyl pyrrolidone with a mass percentage of 3%, diethylene glycol ethyl ether with a volume percentage of 10%, glycogen with a final concentration of 0.5mg / ml, ethylenediaminetetraacetic acid with a final concentration of 30mM and isopropanol with a volume percentage of 50%. The pH value of the lysis solution is 7.

[0037] The washing solution I comprises: Tris-HCl with a final concentration of 50 mM, EDTA with a final concentration of 10 mM, Tween with a volume percentage of 1%, and ethanol with a volume percentage of 80%. The pH value of Tris-HCl is 7.0.

[0038] The washing solution II includes: Tris-HCl with a final concentration of 50 mM, EDTA with a final concentration of 10 mM, and 70% by volume of ethanol. The pH value of Tris-HCl is 7.0.

[0039] DEPC water is water treated with diethyl pyrocarbonate.

[0040] (2) Add 20 μl of Proteinase K and 200 μl of the virus sample to be tested to deep well plate No. 2, with the concentration of Proteinase K being 30 mg / ml.

[0041] (3) Place 6 deep-well plates in the corresponding positions of the nucleic acid extraction instrument and place the magnetic rod sleeve in plate No. 1.

[0042] (4) Set up the running program according to Table 2 and start it (the program takes about 25 minutes to run).

[0043] Table 2

[0044]

[0045] (5) After the program is completed, the eluted product from the No. 6 deep-well plate is transferred to a 1.5 ml centrifuge tube or a 96-well PCR plate, and the resulting RNA is subjected to quantitative PCR detection.

[0046] Quantitative PCR detection: The extracted viral RNA was detected using the dye-based one-step RT-qPCR kit (Cat. No.: EZB-qRT).

[0047] The reaction system (Table 3) was prepared according to the instructions, and the Ct value of the SARS-CoV-2 N (Nucleocapsid) gene was detected using an ABI ViiA 7 real-time fluorescence quantitative PCR instrument. The running program is shown in Table 4. The primer sequences of the N gene are: forward primer (NF): GGGGAACTTCTCCTGCTAGAAT, reverse primer (NR): CAGACATTTTGCTCTCAAGCTG.

[0048] Table 3

[0049] Element Volume (10μl system) RNA 1μl 2×One Step qRT Buffer 5μl 10×One Step qRT Enzyme Mix 1μl NF 0.2μl NR 0.2μl ddH2O 2.6μl

[0050] Table 4

[0051]

[0052] The results show that: Figure 1 We can see that the lower limit of 2019-nCOV pseudovirus RNA extracted from plasma using the kit and extraction method of the present invention can reach 5×10 2 copies / ml; it has good linearity for the extraction of virus samples with different concentrations in plasma.

[0053] Example 2

[0054] Extraction of different concentrations of 2019-nCOV pseudovirus RNA from saliva:

[0055] Sample preparation: 2019-nCOV pseudovirus was purchased from Fubaiao (Suzhou) Biotechnology Co., Ltd., and the stock solution concentration was 1×10 8 copies / ml, and then diluted with saliva to 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 Each concentration was repeated 2 times.

[0056] Viral RNA extraction and quantitative detection are the same as in Example 1.

[0057] The results show that: Figure 2 As shown, the lower limit of 2019-nCOV pseudovirus RNA extracted from saliva using the present invention can reach 5×10 2 copies / ml; it has good linearity for the extraction of virus samples with different concentrations in saliva.

[0058] Example 3

[0059] Extraction of different concentrations of 2019-nCOV pseudovirus RNA from cell culture supernatant:

[0060] Sample preparation: 2019-nCOV pseudovirus was purchased from Fubaiao (Suzhou) Biotechnology Co., Ltd., and the stock solution concentration was 1×10 8 copies / ml, and then diluted to 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 Each concentration was repeated 2 times.

[0061] Viral RNA extraction and quantitative detection are the same as in Example 1.

[0062] The results show that: Figure 3 As shown, the lower limit of 2019-nCOV pseudovirus RNA extracted from cell culture supernatant by the present invention can reach 5×10 2 copies / ml; it has good linearity for the extraction of virus samples of different concentrations in cell culture supernatant.

[0063] Example 4

[0064] Extraction of different concentrations of 2019-nCOV pseudovirus RNA from tissue homogenate:

[0065] Sample preparation: 2019-nCOV pseudovirus was purchased from Fubaiao (Suzhou) Biotechnology Co., Ltd., and the stock solution concentration was 1×10 8 copies / ml, and mouse liver tissue homogenate was used (PBS was added during homogenization) to dilute to 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 Each concentration was repeated 2 times.

[0066] Viral RNA extraction and quantitative detection are the same as in Example 1.

[0067] The results show that: Figure 4 As shown, the lower limit of 2019-nCOV pseudovirus RNA extracted from tissue homogenate by the present invention can reach 5×10 2 copies / ml; it has good linearity for the extraction of virus samples of different concentrations in tissue homogenate.

[0068] Example 5

[0069] The kit of the present invention and the Thermo Fisher magnetic bead method virus nucleic acid extraction kit (Cat. No. A42352) were used to extract 5×10 5 copies / ml of 2019-nCOV pseudoviral RNA.

[0070] Sample preparation: 2019-nCOV pseudovirus was purchased from Fubaiao (Suzhou) Biotechnology Co., Ltd., and the stock solution concentration was 1×10 8 copies / ml, and mouse plasma, saliva, cell culture medium and tissue homogenate were used to dilute to 5×10 5 copies / ml.

[0071] Extraction of viral RNA: The specific extraction steps using an automated instrument (our company's own nucleic acid extractor EZB-NE96) are as follows:

[0072] (1) Take out 6 deep-well plates, and add the reagents to the corresponding wells according to the operating instructions of the kit of the present invention (Table 1) and the operating instructions of the Thermo Fisher magnetic bead-based viral nucleic acid extraction kit (Table 5), and add the required number of wells according to the number of samples.

[0073] Table 5

[0074]

[0075]

[0076] (2) The kit of the present invention: 20 μl of Proteinase K and 200 μl of the RNA virus sample to be tested are added to the No. 2 deep well plate.

[0077] Thermo Fisher Magnetic Bead Viral Nucleic Acid Extraction Kit: Add 10 μl of Proteinase K in the kit and 200 μl of the RNA virus sample to be tested into deep well plate No. 2.

[0078] (3) Place 6 deep-well plates in the corresponding positions of the nucleic acid extraction instrument and place the magnetic rod sleeve in plate No. 1.

[0079] (4) Set up the running program according to Table 2 and start it (the program takes about 25 minutes to run).

[0080] (5) After the program is completed, the eluted product from the No. 6 deep-well plate is transferred to a 1.5 ml centrifuge tube or a 96-well PCR plate, and the resulting RNA is subjected to quantitative PCR detection.

[0081] Quantitative PCR detection: Same as Example 1.

[0082] The results show that: Figure 5 As shown, the present invention can efficiently extract 2019-nCOV pseudovirus RNA from plasma, saliva, cell culture supernatant and tissue homogenate, and the Ct value is no significantly different from or lower than that of the Thermo Fisher magnetic bead virus nucleic acid extraction kit.

[0083] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A kit for rapidly purifying viral nucleic acids from different types of liquid biological samples, characterized in that: The kit includes the following reagents: a lysis binding solution, a proteinase K solution, magnetic beads, a washing solution I, a washing solution II, and an eluting solution. The lysis binding solution includes guanidine hydrochloride with a final concentration of 1 to 3 M, sodium citrate with a final concentration of 5 to 25 mM, Tween with a volume percentage of 0.5 to 2.5%, polyvinyl pyrrolidone with a mass percentage of 0.5 to 5%, diethylene glycol ethyl ether with a volume percentage of 5 to 10%, glycogen with a final concentration of 0.5 mg / ml, ethylenediaminetetraacetic acid with a final concentration of 5 to 50 mM, and isopropanol with a volume percentage of 50%. The pH value of the lysis solution is 5 to 8.

2. A kit for rapidly purifying viral nucleic acid from different types of liquid biological samples according to claim 1, characterized in that: The concentration of the proteinase K solution is 10-50 mg / ml.

3. A kit for rapidly purifying viral nucleic acid from different types of liquid biological samples according to claim 1, characterized in that: The magnetic beads are silicon hydroxy magnetic beads with a particle size of 200nm to 1μm.

4. A kit for rapidly purifying viral nucleic acid from different types of liquid biological samples according to claim 1, characterized in that: The washing solution I comprises: Tris-HCl with a final concentration of 20-50 mM, EDTA with a final concentration of 5-10 mM, 1% by volume of Tween and 20-80% by volume of ethanol, and the pH value of Tris-HCl is 7.

0.

5. A kit for rapidly purifying viral nucleic acid from different types of liquid biological samples according to claim 1, characterized in that: The washing solution II comprises: Tris-HCl with a final concentration of 20-50 mM, EDTA with a final concentration of 5-10 mM, and 70% by volume of ethanol. The pH value of Tris-HCl is 7.

0.

6. A kit for rapidly purifying viral nucleic acid from different types of liquid biological samples according to claim 1, characterized in that: The eluent is water treated with diethyl pyrocarbonate.

7. A method for rapidly purifying viral nucleic acids from different types of liquid biological samples, using a kit for rapidly purifying viral nucleic acids from different types of liquid biological samples as claimed in any one of claims 1 to 6, characterized in that: The extraction process used a nucleic acid extractor model EZB-NE96 produced by Suzhou Yingze Biopharmaceutical Technology Co., Ltd., and the extraction steps were as follows: (1) Add magnetic beads, lysis and binding solution, washing solution I, washing solution II and elution solution to the deep well plate respectively; (2) Add proteinase K solution and the virus sample to be tested to the deep-well plate containing the lysis and binding solution; (3) Place all deep-well plates in the corresponding plate positions of the nucleic acid extraction instrument and place the magnetic rod sleeve in the corresponding deep-well plate; (4) Set up the running program and start it; (5) After the procedure is completed, the eluted product is transferred to a 1.5 ml centrifuge tube or a 96-well PCR plate, and the resulting RNA is subjected to quantitative PCR detection.

Images