Application of efcaab2 gene in construction of hydrocephalus animal model and construction method of model

Abstract

The invention discloses an application of an efcaab2 gene in construction of a hydrocephalus animal model and a construction method of the model, belongs to the technical field of animal model preparation in biology and basic medical research, and provides the application of the efcaab2 gene in construction of the hydrocephalus animal model, and the nucleotide sequence of the efcaab2 gene is as shown in SEQ ID NO.1. The invention also provides a method for constructing the hydrocephalus zebrafish animal model, which comprises the following steps: synthesizing gRNA and Cas9mRNA on the basis of an efcaab2 gene, and mixing to obtain a mixed solution; co-injecting the zebra fish embryos and a phenol red reagent to a zebra fish embryo I cell stage, and culturing to the 3th day after fertilization to obtain zebra fish embryos; and measuring the mRNA expression quantity of the efcaab2 gene, and observing the fourth ventricle, the spine and the pericardium. A CRISPR (clustered regularly interspaced short palindromic repeats) gene knockout technology is utilized to establish an efcaab2 gene defect hydrocephalus animal model, and an efcaab2 gene defect hydrocephalus pathogenesis and a potential treatment target are clarified.

Description

Technical Field

[0001] The invention belongs to the technical field of animal model preparation in biology and basic medical research, and in particular relates to the application of efcab2 gene in constructing a hydrocephalus animal model and a method for constructing the model. Background Art

[0002] Hydrocephalus refers to a neurological disease in which excessive cerebrospinal fluid (CSF) accumulates in the brain, leading to abnormal expansion of the ventricles, increased intracranial pressure, and brain tissue damage. The incidence of hydrocephalus is extremely high, and the prevalence of hydrocephalus in children (≤18 years old), adults (19-64 years old), and the elderly (≥65 years old) has increased in recent years. Common patients are children and the elderly. Hydrocephalus in adults is usually secondary to various craniocerebral diseases, and the overall incidence is lower than that in children. Congenital hydrocephalus (CH), also known as infantile hydrocephalus, has an incidence of more than 2 / 1000. Fetal intracranial hemorrhage, infection, congenital malformations, and genetic factors may all cause CH. Global epidemiological surveys have shown that up to 40% of CH cases are caused by genetic factors, and most cases are sporadic, with different phenotypes, making it difficult to determine the causative gene. The identified gene mutations account for less than 5% of CH cases, and more gene targets and the pathogenic mechanisms of their mutations causing hydrocephalus need to be studied.

[0003] After preliminary research, it was found that the efcab2 gene encodes a calcium protein binding domain protein. Studies have shown that it can be expressed on the dynamic regulatory complex of ciliary microtubules and has calcium ion binding activity. Motile cilia play an important role in the circulation of cerebrospinal fluid. Based on the above two points, it is speculated that efcab2 may be a pathogenic gene for hydrocephalus. However, its gene function and pathogenic mechanism in the occurrence of hydrocephalus remain to be studied. Gene-edited animals are an important research method for studying molecular mechanisms and pathogenic mechanisms in the biomedical field.

[0004] Zebrafish and humans are highly genetically homologous, with their genome being over 87% similar to humans, making them an ideal model for studying human neurological diseases. The transparency of their embryos facilitates intuitive observation of the development and pathological processes of the nervous system, and is helpful for large-scale genetic and phenotypic studies. In addition, zebrafish have a rich set of behavioral patterns, including spatial memory, associative memory, anxiety, etc. These behavioral patterns provide an effective means for evaluating various aspects of neurological diseases and are conducive to studying the pathogenesis of the disease. Its optical transparency allows for real-time neuroimaging examinations, which facilitates the non-invasive assessment of cell activity and status in vivo, provides a powerful imaging tool for drug screening, and helps to gain a deeper understanding of brain structure and function. Summary of the invention

[0005] In order to solve the above technical problems, the present invention proposes the application of efcab2 gene in constructing an animal model of hydrocephalus and a method for constructing the model, and uses CRISPR gene knockout technology to establish an animal model of hydrocephalus caused by efcab2 gene deficiency, in order to clarify the pathogenesis and potential therapeutic targets of hydrocephalus caused by efcab2 gene deficiency, and to develop therapeutic drugs for patients with hydrocephalus caused by efcab2 gene deficiency.

[0006] To achieve the above object, the present invention provides the use of efcab2 gene in constructing a hydrocephalus animal model, wherein the nucleotide sequence of the efcab2 gene is shown in SEQ ID NO.1.

[0007] Preferably, the hydrocephalus animal model is a hydrocephalus zebrafish animal model.

[0008] Preferably, a zebrafish animal model of hydrocephalus is constructed by knocking out the efcab2 gene.

[0009] The present invention also provides the use of the preparation for regulating the expression of the efcab2 gene in the preparation of a drug for treating hydrocephalus.

[0010] The present invention also provides a method for constructing a zebrafish animal model of hydrocephalus, comprising the following steps:

[0011] (1) synthesizing gRNA based on the efcab2 gene;

[0012] (2) Synthesize Cas9 mRNA in vitro;

[0013] (3) mixing the gRNA obtained in step (1) and the Cas9 mRNA obtained in step (2) to obtain a mixed solution;

[0014] (4) injecting the mixed solution obtained in step (3) and phenol red reagent into zebrafish embryos at the I-cell stage, culturing at 27.5-28.5° C. until the third day after zebrafish fertilization, to obtain zebrafish embryos;

[0015] (5) Determine the mRNA expression level of the efcab2 gene in the zebrafish embryo obtained in step (4), and observe the fourth ventricle, spine and pericardium of the zebrafish embryo obtained in step (4).

[0016] Preferably, the nucleotide sequence of the gRNA in step (1) is shown in one or more of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0017] Preferably, the nucleotide sequence of the Cas9 mRNA in step (2) is as shown in SEQ ID NO.6.

[0018] Preferably, the content of gRNA in the mixed solution in step (3) is 25 ng, and the final concentration of Cas9 mRNA in the mixed solution is 300 ng / μL.

[0019] Preferably, the zebrafish embryos in step (5) have lower efcab2 gene mRNA expression levels, an enlarged fourth ventricle, scoliosis, and pericardial edema compared to wild zebrafish embryos.

[0020] The present invention also provides application of the method for constructing a hydrocephalus zebrafish animal model in preparing a hydrocephalus animal model.

[0021] Compared with the prior art, the present invention has the following advantages and technical effects:

[0022] The present invention utilizes the CRISPR / Cas9 system to knock out the efcab2 gene and obtain the corresponding targeted gene-edited zebrafish-specific hydrocephalus model, which can not only deepen the understanding of gene regulation in the pathogenesis of efcab2 gene-deficient hydrocephalus, but also suggests that efcab2 can be used as a therapeutic target for hydrocephalus and provide a high-level animal model for translational medicine and new drug development.

[0023] It has important value in many aspects. On the one hand, it can deeply explore the pathogenesis of hydrocephalus, from cellular microstructure to molecular signaling network, systematically reveal the occurrence and development of the disease, and accurately explore potential therapeutic targets, providing key entry points for subsequent intervention strategies; on the other hand, it can serve as an ideal animal model for patients with efcab2 gene-deficient hydrocephalus, and build an efficient animal model platform for drug screening and development for such diseases. Its application will help to comprehensively promote the field of hydrocephalus disease research in key aspects such as pathogenesis interpretation, drug research and development innovation, and treatment strategy exploration to make substantial progress, thereby laying a solid tool foundation and providing strong theoretical support for the ultimate conquest of hydrocephalus. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The Sanger sequencing and amino acid sequence diagram of the sample tested in Example 1;

[0026] Figure 2This is a qPCR amplification statistical graph of the samples tested in Example 1, and * represents p<0.1 compared with the control group;

[0027] Figure 3 The fourth ventricle imaging and area statistics of the sample tested in Example 1, wherein A is the fourth ventricle imaging, the scale is 200 μm, B is the imaging area statistics, and * represents p<0.1 compared with the control group;

[0028] Figure 4 These are graphs showing scoliosis and pericardial edema phenomena exhibited by the samples tested in Example 1, wherein A is a graph of control group samples, B is an enlarged graph of control group samples, C is a graph of mutation group samples, and D is an enlarged graph of mutation group samples. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1

[0035] 1. gRNA synthesis in vitro

[0036] (1) Determination of CRISPR target sites

[0037] Based on the zebrafish efcab2 gene (SEQ ID NO.1), gRNA target design was performed using the Benchling (https: / / www.benchling.com / crispr) cloud-based CRISPR design software, as shown in Table 1.

[0038] Table 1 gRNA targets

[0039] Location Sequence (5'-3') PAM exon1 ttcatggtcaaatacatcaa(SEQ ID NO.16) agg exon2 acagccaagtgaacgaatga(SEQ ID NO.17) tgg exon3 tcatgcaattcagcttctga(SEQ ID NO.18) agg exon4 tcatagcgcacaaatccagt(SEQ ID NO.19) ggg

[0040]

[0041] (2) Design primers for in vitro synthesis of gRNA, as shown in Table 2 below.

[0042] Table 2 Primers for synthesizing gRNA

[0043]

[0044]

[0045] (3) Synthesize gRNA template in vitro. The reaction system is shown in Table 3 below, and the reaction procedure is shown in Table 4 below.

[0046] Table 3 Reaction system

[0047] Total reaction volume 50μL 5XPhusionReactionMixbuffer 10μL 10mM dNTP (2.5mM each) 1μL Top-strandoligo (10 μM) 1μL Bottom80bpUltramar(10μM) 1μL Phusion DNA polymerase 1μL <![CDATA[ddH2O]]> 36μL

[0048] Table 4 Reaction procedure

[0049] step Temperature(℃) Time (min) 1 98 2 2 50 10 3 72 10 4 Keep

[0050] The ultrathin DNA product purification kit DP203 (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used for purification to obtain four products with a sequence size of 119 bp.

[0051] The nucleotide sequence of gRNA1 is SEQ ID NO.2: TAATACGACTCACTATAGGTTCATGGTCAAATA CATCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0052] The nucleotide sequence of gRNA2 is SEQ ID NO.3: TAATACGACTCACTATAGGACAGCCAAGTGAA CGAATGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0053] The nucleotide sequence of gRNA3 is SEQ ID NO.4: TAATACGACTCACTATAGGTCATGCAATTCAGC TTCTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0054] The nucleotide sequence of gRNA4 is SEQ ID NO.5: TAATACGACTCACTATAGGTCATAGCGCACAAA TCCAGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT.

[0055] (4) In vitro transcription of gRNA, the reaction system is as shown in Table 5.

[0056] Table 5 Reaction system

[0057] Total reaction volume 20μL 10XReactionBuffer 1.5μL ATP(100mM) 1.5μL UTP(100mM) 1.5μL CTP (100 mM) 1.5μL GTP (100 mM) 1.5μL TemplateDNA 300ng(~8μL) T7RNAPolymeraseMix 1.5μL <![CDATA[RNAase-freeH2O]]> 3μL

[0058] Reaction procedure (metal bath): After mixing, place at 37°C for overnight reaction; then add 1 μL 2U / μL DNase I (RNAase-free) and react at 37°C for 20 min.

[0059] Purify RNA (LiCl method): Inject 30μL RNase Free H2O and 30μL 7.5M LiCl precipitation solution, react at -20℃ for more than 2h, and centrifuge at 14000rpm and 4℃ for 30min. Remove the supernatant, inject 500μL 75% ethanol solution (diluted with RNAase-free H2O), repeatedly pour and wash the precipitate, and then centrifuge under the same conditions for 15min. Aspirate the supernatant, wait for the ethanol to evaporate completely, dissolve in 10-20μL RNase Free H2O and detect the concentration.

[0060] 2. In vitro synthesis of Cas9 mRNA

[0061] (1) Plasmid construction and amplification.

[0062] The nucleotide sequence of the plasmid is shown in SEQ ID NO.20.

[0063]

[0064] (2) Plasmid linearization, the reaction system is shown in Table 6 below.

[0065] Table 6 Reaction system

[0066] Total reaction volume 100μL 10XCutSmartBuffer 10μL XbaI (20000U / mL) 20 units (~1.5 μL) pT3TS-nCas9n (~300 ng / μL) 5.5 μg (~18.5 μL) <![CDATA[ddH2O]]> 70μL

[0067] Reaction procedure: 37°C overnight.

[0068] The DNA was purified using the ultrathin DNA product purification kit DP203 (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0069] (3) In vitro transcription of Cas9 mRNA and mMESSAGE T3 Kit (purchased from ThermoFisher Scientific), the reaction system is shown in Table 7 below.

[0070] Table 7 Reaction system

[0071] Total reaction volume 20μL 10XReactionBuffer 2μL 2XNTP / CAP 10μL lineartemplateDNA 0.1~1μg(<6μL) EnzymeMix 2μL

[0072] Reaction procedure: Mix gently, centrifuge, and react at 37℃ for 3h. Add 1μL TURBO DNaseI, mix gently, centrifuge, and react at 37℃ for 15min to remove DNA sample.

[0073] Purify RNA (LiCl method): Inject 30μL RNase Free H2O and 30μL 7.5M LiCl precipitation solution, react at -20℃ for more than 2h, centrifuge at 14000rpm, 4℃ for 30min. Remove the supernatant, inject 500μL 75% ethanol solution (diluted with RNAase-free H2O), repeatedly pour and wash the precipitate, and centrifuge under the same conditions for 15min. Aspirate the supernatant, wait for the ethanol to evaporate completely, dissolve in 70μL RNase Free H2O and detect the concentration.

[0074]

[0075] 3. Microinjection

[0076] A mixture of four gRNAs (25 ng) and Cas9 mRNA (final concentration 300 ng / μL) was co-injected with phenol red reagent (0.5 uL) into zebrafish embryos at the I-cell stage, and cultured in E3 culture medium (prepared with 5 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, 0.33 mM MgSO4 and pure water) in an incubator with a constant temperature (28°C) and a photoperiod (light / dark cycle) of 14h:10h.

[0077] 4. Sanger sequencing

[0078] (1) Genome lysis

[0079] Place a zebrafish embryo in an EP tube and remove the E3 culture medium; add 20μL lysis solution (Tris-HCL 10mM, KCL 50mM, Tween-20 0.3%, NP-40 0.3%). React at 98℃ for 10min. Cool to 55℃, add 1μL Proteinase K and react overnight. React at 98℃ for 10min. The solution after reaction can be used directly as a PCR template or stored at 4℃.

[0080] (2) Design amplification primers as shown in Table 8 below.

[0081] Table 8 Amplification primers

[0082]

[0083] (3) PCR amplification, a product sequence of about 1.4 kb was obtained, and the product sequence was a partial sequence of the efcab2 gene (SEQ ID NO. 1).

[0084] (4) Perform Sanger sequencing.

[0085] (5) Sequencing results

[0086] The comparison results are as follows Figure 1 As shown, the gene sequences of all mutants were changed, and the amino acid arrangement obtained by translation of the target sequence was also changed, indicating that the mutation type of the mutants was a missense mutation.

[0087] 5. qPCR amplification

[0088] (1) Total RNA extraction from zebrafish embryos

[0089] a. Add 200 μL Trizol (RNAFREE EP tube) to more than 30 zebrafish embryos, grind them with an electric grinder, and then rinse the grinder with the remaining 800 μL.

[0090] b. Leave at room temperature for 5 minutes until the liquid is completely transparent.

[0091] c. Add 200 μL of chloroform, shake vigorously for 15 seconds to break the genomic DNA, and leave at room temperature for 3 minutes.

[0092] d. Centrifuge at 4°C, 13,000 rpm, 15 min.

[0093] e. Transfer the upper aqueous phase to another EP tube, add an equal volume of isopropanol and mix well (about 500 μL), and leave at room temperature for 10 min.

[0094] f. Centrifuge at 4℃, 13000rpm, 10min, carefully aspirate the liquid with a pipette tip, and the RNA will sink to the bottom of the tube.

[0095] g. Wash the RNA pellet with 1 mL of 75% ethanol and gently shake the centrifuge tube to resuspend the pellet.

[0096] h. Centrifuge at 4°C, 13,000 rpm, for 5 min. After discarding the ethanol, dry the RNA precipitate at room temperature for 5 to 10 min.

[0097] i. Dissolve the RNA sample in 50 μL H2O (adjusted according to the amount of RNA), dissolve at 60°C for 10 min, and store at -80°C).

[0098] (2) Reverse transcription into cDNA.

[0099] Removal of residual genomic DNA: Prepare the reaction solution in an RNase free centrifuge tube as shown in Table 9.

[0100] Table 9 Components and usage of reaction solution

[0101] Reaction solution components Usage 5×gDNAdigesterMix 6μL Total RNA 2μg (volume calculated based on RNA sample concentration) <![CDATA[RNasefreeddH2O]]> Add to a total volume of 30 μL

[0102] After the preparation, gently blow and mix with an RNase free pipette tip and incubate at 42°C for 2 minutes.

[0103] The reverse transcription system was prepared as shown in Table 10.

[0104] Table 10 Reverse transcription reaction system preparation

[0105] Reaction solution components Usage Step 1 Reaction Solution 30μL 4×HifairⅢSuperMixplus 5μL

[0106] The reverse transcription reaction program settings are shown in Table 11.

[0107] Table 11 Reverse transcription program settings

[0108] Reaction temperature (℃) Duration (min) 25 5 55 15 85 5

[0109] (3) Design qPCR amplification primers.

[0110] Table 12 qPCR amplification primers

[0111]

[0112]

[0113] The cDNA synthesized in step (2) was used as template DNA and diluted 5 to 10 times (so that the Ct value after amplification was between 20 and 30). The total reaction system was 20 μL (prepared on ice), and the reaction system was shown in Table 13 below.

[0114] Table 13 qPCR reaction system

[0115] Reaction solution components Usage amount (μL) HieffqPCRSYBRGreenMasterMix 10 Upstream primer (10 μM) 0.4 Downstream primer (10 μM) 0.4 Template DNA 2 <![CDATA[ddH2O]]> 7.2

[0116] After the preparation is completed, mix the reaction solution.

[0117] (4) Perform qPCR amplification.

[0118] A three-step amplification procedure was used, with pre-denaturation at 95°C for 5 min, deformation at 95°C for 10 s, annealing at 50-60°C for 20 s, and extension at 72°C for 20 s, for 40 cycles.

[0119] (5) Amplification results

[0120] The amplification results are as follows Figure 2 As shown, compared with the control group (Control), the mRNA expression level of efcab2 gene in the mutant group (KO) was significantly reduced.

[0121] 6. Observe whether the fourth ventricle is enlarged

[0122] (1) Intraventricular dye injection

[0123] When zebrafish developed to the 3rd day after fertilization, they were fixed with 0.4% agarose and injected with FITC-dextran fluorescent dye into the cerebral ventricle.

[0124] (2) Fluorescence microscopy imaging.

[0125] (3) Count the fluorescent area of ​​the ventricles.

[0126] The fourth ventricle fluorescence imaging and area statistics results are as follows Figure 3 Middle A and Figure 3 As shown in B, compared with the control group (Control), the fourth ventricle area of ​​zebrafish in the mutant group (KO) was significantly enlarged.

[0127] 7. Observe whether scoliosis and pericardial edema occur

[0128] (1) Microscope imaging.

[0129] (2) Observe scoliosis and pericardial edema.

[0130] like Figure 4 Middle A, Figure 4 Middle B, Figure 4 Middle C and Figure 4 As shown in D, compared with the control group (Control), the mutant group (KO) zebrafish showed scoliosis and pericardial edema.

[0131] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The use of efcab2 gene in constructing an animal model of hydrocephalus, characterized in that: The nucleotide sequence of the efcab2 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that: The hydrocephalus animal model is a hydrocephalus zebrafish animal model.

3. The use according to claim 1 or 2, characterized in that: A zebrafish animal model of hydrocephalus was constructed by knocking out the efcab2 gene.

4. Use of a preparation for regulating the expression of the efcab2 gene according to claim 1 in the preparation of a drug for treating hydrocephalus.

5. A method for constructing a zebrafish animal model of hydrocephalus, characterized in that: The following steps are involved: (1) synthesizing gRNA based on the efcab2 gene described in claim 1; (2) Synthesize Cas9 mRNA in vitro; (3) mixing the gRNA obtained in step (1) and the Cas9 mRNA obtained in step (2) to obtain a mixed solution; (4) injecting the mixed solution obtained in step (3) and phenol red reagent into zebrafish embryos at the I-cell stage, culturing at 27.5-28.5° C. until the third day after zebrafish fertilization, to obtain zebrafish embryos; (5) Determine the mRNA expression level of the efcab2 gene in the zebrafish embryo obtained in step (4), and observe the fourth ventricle, spine and pericardium of the zebrafish embryo obtained in step (4).

6. The method for constructing a zebrafish animal model of hydrocephalus according to claim 5, characterized in that: The nucleotide sequence of the gRNA in step (1) is shown in one or more of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.

5.

7. The method for constructing a zebrafish animal model of hydrocephalus according to claim 5, characterized in that: The nucleotide sequence of the Cas9 mRNA in step (2) is shown in SEQ ID NO.

6.

8. The method for constructing a zebrafish animal model of hydrocephalus according to claim 5, characterized in that: The content of gRNA in the mixed solution in step (3) is 25 ng, and the final concentration of Cas9 mRNA in the mixed solution is 300 ng / μL.

9. The method for constructing a zebrafish animal model of hydrocephalus according to claim 5, characterized in that: Compared with wild zebrafish embryos, the zebrafish embryos in step (5) have lower efcab2 gene mRNA expression, an enlarged fourth ventricle, scoliosis, and pericardial edema.

10. Use of the method for constructing a zebrafish animal model of hydrocephalus according to any one of claims 5 to 9 in preparing an animal model of hydrocephalus.

Images