SNP molecular marker related to WSSV tolerance in procambarus clarkia Nrf2 gene and application of SNP molecular marker

Abstract

The invention relates to an SNP molecular marker related to WSSV tolerance in a procambarus clarkia Nrf2 gene and application of the SNP molecular marker. According to the invention, 10 SNP mutation sites are found in a 5'terminal regulation region of the Nrf2 gene of the procambarus clarkia by combining whole genome re-sequencing data of a laboratory, and two SNP molecular markers related to WSSV tolerance characters are screened out through transcriptional activity detection of a point mutation luciferase reporter vector of the PcNrf2 gene, so that the breeding process of the procambarus clarkia tolerant WSSV variety is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection, and specifically relates to a WSSV tolerance-related SNP molecular marker in the Nrf2 gene of Procambarus clarkii and an application thereof. Background Art

[0002] Procambarus clarkii, commonly known as crayfish, is an important freshwater economic shrimp. Epidemiological surveys show that Procambarus clarkii is a common carrier of WSSV, and WSSV-carrying individuals can be detected throughout the year, threatening its healthy breeding. Invertebrates cannot resist pathogen invasion through highly specific adaptive immunity. The redox system plays an important role in protecting Procambarus clarkii from pathogens and improving virus tolerance.

[0003] Studies have shown that nuclear factor erythroid-2related factor 2 / antioxidant response element (Nrf2 / ARE) is a defensive pathway for the body to resist internal and external oxidative and chemical stimuli. As an anti-oxidative stress signaling pathway factor, Nrf2 maintains the body's normal physiological functions by regulating the cell's antioxidant system. Under physiological conditions, Nrf2 is expressed at a low level and constitutively in cells, and Nrf2 protein binds to Keap1 in the cytoplasm. When cells are stimulated by ROS, Nrf2 dissociates from Keap1, Nrf2 transfers into the cell nucleus, recognizes and binds to ARE, and promotes the transcription of its downstream antioxidant enzymes such as HO-1, SOD and CAT genes, thereby enhancing the cell's ability to scavenge ROS and exerting an antioxidant effect to resist the body's oxidative stress damage.

[0004] The dual-luciferase reporter gene system refers to a method of indirectly screening potential regulatory factors that affect the expression of target genes and quantifying their regulatory activity by quantifying the bioluminescence emitted by luciferase-catalyzed oxidation of luciferin to oxyluciferin. A reporter gene plasmid, such as pGL3-basic, is constructed by inserting a specific fragment of the target gene promoter in front of the luciferase expression sequence. The expression of luciferase is proportional to the intensity of the transcription factor. The traditional luciferase reporter vector does not insert the untranslated region of the complete target gene, but only intercepts a small sequence to construct it upstream of the luciferase gene. This structural composition is quite different from the actual situation in the body, so the screened regulatory factors often cannot play a role under physiological conditions in the body.

[0005] Single nucleotide polymorphism (SNPs) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. A genetic marker that makes the DNA sequence polymorphic has been widely used in breeding, association analysis, disease resistance gene markers and related gene identification. It is currently the third generation of molecular markers widely used. However, there are few studies on molecular markers of Procambarus clarkii. The development of new molecular markers related to WSSV tolerance can provide favorable support for the breeding of Procambarus clarkii. Summary of the invention

[0006] The problem solved by the present invention is to verify the results of association analysis between the point mutation luciferase reporter vectors of the Nrf2 gene of Procambarus clarkii and the WSSV tolerance of Procambarus clarkii through the activity differences shown by them, and further verify whether they can be used as molecular markers for auxiliary selection in molecular breeding of Procambarus clarkii, thereby accelerating the breeding process of Procambarus clarkii WSSV-tolerant varieties.

[0007] The present invention combines the whole genome resequencing data of the laboratory to develop the SNP site of the Nrf2 gene, constructs the pGL3-Nrf2pro vector inserted into the untranslated region of the complete target gene, and finds 10 SNP mutation sites in the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii according to the BSA sequencing results, of which 2 SNP sites are significantly associated with WSSV tolerance in the Procambarus clarkii population. Through the transcriptional activity detection of the point mutation luciferase reporter vector of the PcNrf2 gene, 2 favorable SNP molecular markers associated with the WSSV tolerance trait were finally screened out.

[0008] The present invention is achieved through the following technical solutions:

[0009] According to the whole genome resequencing data of the laboratory, there are ten SNP sites in the 5' regulatory region of the Nrf2 gene of Procambarus clarkii: g.-50A>G; -232C>G; -724C>A; -774A>G; -850G>C; -1085C>T; -1194C>A; -1277G>T; -1400C>A; -1598A>G (corresponding to Chr83.4145550A>G; Chr83.4145368C>G; C Chr83.4144876C>A;Chr83.4144826A>G;Chr83.4144750G>C;Chr83.4144515C>T;Chr83.4144406C>A;Chr83.4144323G>T;Chr83.4144200C>A;Chr83.4144002A>G, reference genome version: GCF_040958095.1), among which 2 SNP sites were significantly associated with WSSV tolerance in the Procambarus clarkii population.

[0010] The transcriptional activity is further detected by using a point mutation luciferase reporter vector of the Nrf2 gene of Procambarus clarkii, comprising the following steps:

[0011] (1) Using the whole genome DNA of Procambarus clarkii containing the Nrf2 gene as a template, primer pair P was used to amplify the 5' regulatory region of the Nrf2 gene of Procambarus clarkii;

[0012] (2) performing gel excision, recovery and purification of the amplified product of step (1);

[0013] (3) digesting the purified product of step (2) and the luciferase reporter gene vector pGL3-Basic plasmid with restriction endonucleases Kpn1 and XhoI, respectively;

[0014] (4) recovering and purifying the digestion product in step (3) by gel cutting;

[0015] (5) using T4 DNA ligase to connect the purified products in step (4);

[0016] (6) The ligation product in step (5) was transformed into DH5α Escherichia coli competent cells, and the selected single clone was triple-verified by bacterial liquid PCR, double enzyme digestion identification, and sequencing;

[0017] (7) Design mutation primers based on the sequencing results, use fast high-fidelity DNA polymerase, and use the plasmid in (6) as a template to transform the non-mutant strain into the mutant strain.

[0018] (8) The plasmid in step (7) was transferred into 293T cells, 1000ng of point mutation luciferase reporter vector, 100ng of internal reference plasmid vector pRL-TK, 1uL PEI, 100uL of serum-free DMEM medium, and the unmutated pGL3-Nrf2pro vector was used as a control. After 12 hours of plasmid transfection, the cells were treated with H2O2, poly(I:C), and SFN for 12 hours respectively. The normal group was not treated for 24 hours after transfection. The cells were rinsed twice with PBS, and then the dual luciferase activity was detected according to the dual luciferase detection kit.

[0019] (9) comparing the transcriptional activity of the point mutation luciferase reporter vector in step (8) with the results of the association analysis of WSSV tolerance, and interpreting the results of the association analysis from the level of transcriptional activity;

[0020] Wherein, the primer described in step (1) is:

[0021] Upstream primer: GG GGTACC CCGGCCTCTGCAAGTCTAAATCATCCA 35bp;

[0022] Downstream primer: CC CTCGAG GGCAGCTGCAACACGCGCTCAT 30bp;

[0023] The PCR amplification reaction procedure is:

[0024] Pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 60 s; and extension at 72°C for 10 min.

[0025] Plasmid pGL3-Nrf2pro represents a recombinant plasmid in which the promoter region is correctly inserted into the reporter gene plasmid (pGL3-Basic) (capital letters represent the promoter region, lowercase letters represent the partial sequence of the pGL3-Basic plasmid, underlined ATG represents the promoter, and underlined letters represent the mutation site from the first letter of the promoter to the regulatory region). Its information is as follows:

[0026] agtgcaagtgcaggtgccagGGCCTCTGCAAGTCTAATCATCCACAACAGTGAAGTTT

[0027] TCATATAGCATACCATTATAGAGTAGCTGCTGTATCAGCGATGAGTTAATCTT

[0028] TGTCGTGGGCTT AAAGCTAGATTCTAGATAAAACTAGAGTTGACGTAGGT

[0029] TTTCGTCGTGTATCATACATGTTGCAAGCGTTACTAAAGTGATGAGATGCGA

[0030] AATCTGGCACCTATTGCTTCACCACGGTGTGTTGTTAGTGCCATCACTAAA

[0031] GCAATATGGCAGGCATAAGGTTGCTACCAAGAAATCTCGTCTCAGTATATG

[0032] GTAG C ATTCCACGGTTCTGTGAGTGTGGCCTTGAATGTAGCAGTCTTGGTT

[0033] ATTTATACGTAATATTGAACGTATCTTGGACTGACTAATGGAGAAAGGGAGT

[0034] TTAAGCGAGCGTTCTGGGTTAGGG G TGTTGTTACGGTCAAGTAAAAACAG

[0035] AGTCCAGCTTGCCAGCCAGTTGATCCTGGTAGTGCAGAAGCAAGGGCTAT

[0036] TGCTATT C TTAGATGTATATGCTCATATTGGCAGTAGCTATTGTTTACATAAA

[0037] CTCTGAACACCATATACGTATATTTAAAGCACATCATGTTTGTTGTTTAAAAA

[0038] TATTATTTTTT C GTATGAGAAATTATATTAAATATACTCGTACAAGTTTTATCGTA

[0039] TTCTTTTGTTAAGCAAAATTTAAATGTAATTTTTGGTCAACATACGTATAGG

[0040] CCTATTAGAACGTCGTCTGTTGCTAGTGTCAGTAAAGGCTTTTTTTGGTTCC

[0041] TGGCGTTGTCATCTGGTAACTTCACAATGTGCCAGCTCTGTATTGGTTACTC

[0042] TGATGTCACTTATTTAGATTGCTATTGTTTATATT G TTTAGATTCAAATAGTTG

[0043] TTATTATTTAGATTGGTGTATATTCATGGTTATTTAGACGTATATCTTAACTTC

[0044] AAC A TCGATTTTTAAAAGTACACAAGTATGTACTTTTACTCATGTACACTAC

[0045] T C CTGTGTAGTGTACACGAGTATGTTGGGTGCAGGTAATCTCATGGTCATGT

[0046] TTCTCTATCGCGTGTTTGATCGTTACTCTGGGCTCTCATTCTCTAACATTTTC

[0047] AGGCATCAATTGTAAAACTGACTATACTTGCTACCATATCAAGATCGTAAAG

[0048] TTAAATTGACTATTACTTTTAGAAAATTTGAAGTGTTTGTGAAATTTAGCGT

[0049] GTAGTGAAGAAGCAACTGGTCTTGCGAAACAGAGACTGTAGAGAGTCTCGT

[0050] GAATCTGTGAAAAATGAGTGTGAATTGATGATGGTATAACATTTATGCATTG

[0051] TGATATATTGTAATATAGAACAAATAAAATTGTTCCAATCAAAATAGCCTAA

[0052] CCTGAAAATCAAATGTTTGTGCTTGGTGAACTTTAACTGTCCGAAAAATTG

[0053] TGCCGACACTAGAAAAGAACATTTCCGATTGAACTTAGTGACTGTACGTAA

[0054] GTGTTTAAGGAAGAGAATATACTTACTT C ATAACCACTAGTAATAGTGTTGG

[0055] GTACCATGTTACTTTACGCTCGCAAGAAGTACCTGCGGGATGAGCGCGTG

[0056] TTGCAGCTGGTGCTACTGCTTAGCCTGCTCCGTGGTGACCCTGACACCCTG

[0057] CTGGGTCCCGGGGGCAACTCCCCCCTAGCTGACCTTCCCCATGACCTTATT

[0058] CTGGG A TCGTCGCTGGGCCACGTGTTACTTTACGCTCGCAAGAAGTACCTGCGGG ATG AGCGCGTGTTGCAGCTGtcgagatctgcgatctaagt(SEQ ID NO:1)

[0059] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the Nrf2 gene of Procambarus clarkii as described in the above technical scheme, the PCR system in step (7) is: 2 μL of each forward / reverse mutation primer (10 μM), 1 μL of 50 ng / μL pGL3-Nrf2pro non-mutant plasmid, 10 μL of 5×FastAlteration Buffer, 1 μL of FastAlteration DNA Polymerase, and 50 μL of RNase-Free ddH2O. The PCR amplification reaction program is: pre-denaturation at 95°C for 2 min; 18 cycles of denaturation at 94°C for 20 s, annealing at 55°C for 10 s, extension at 68°C for 2.5 min; and extension at 72°C for 5 min. The PCR product is digested with Dpn1 enzyme (20 U / μL) at 37°C for 1 h to digest the plasmid template.

[0060] SPSS 22.0 software was used for data processing, and the chi-square test was used to test the significant differences between genotypes and WSSV tolerance traits. The fragment containing the SNP site was amplified, and the mutant vector was directly sequenced.

[0061] Upstream primer: GG GGTACC CCGGCCTCTGCAAGTCTAAATCATCCA35bp;

[0062] Downstream primer: CC CTCGAG GGCAGCTGCAACACGCGCTCAT 30bp;

[0063] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the Nrf2 gene of Procambarus clarkii as described in the above technical scheme, the transfection system used in step (8) for transferring the plasmid into 293T cells is: 1000ng point mutation luciferase reporter vector, 100ng internal reference plasmid vector pRL-TK, 1uL PEI, and 100uL serum-free DMEM culture medium.

[0064] In the method for detecting the transcriptional activity of the point mutation luciferase reporter vector of the Nrf2 gene of Procambarus clarkii as described in the above technical scheme, 12 hours after the plasmid was transferred into 293T cells in step (8), the cells were treated with 500uM H2O2, 100uM SFN, and 1ug / mL poly(I:C) for 12 hours respectively, and another group was not treated after transfection.

[0065] Specifically, the present invention provides SNP molecular markers related to WSSV tolerance and / or antioxidant capacity in the Nrf2 gene of Procambarus clarkii, which are located at -50A>G and / or -774A>G in the 5'-end regulatory region of the Nrf2 gene of Procambarus clarkii, and are located at the 1672nd and 948th positions of the nucleotide sequence shown in SEQ ID NO:1, respectively.

[0066] Furthermore, when position 1672 of the sequence shown in SEQ ID NO: 1 is G, and / or position 948 is G, the Procambarus clarkii individuals exhibit traits of greater tolerance to WSSV and / or high antioxidant capacity.

[0067] The present invention also provides a primer set for detecting the SNP molecular marker, including primers as shown in SEQ ID NO: 2-3: PcNrf2proF: CTCTGAACACCATATACGTA (SEQ ID NO: 2); PcNrf2proR: CAGCTGCAACACGCGCTCAT (SEQ ID NO: 3).

[0068] The present invention also provides a kit for detecting the SNP molecular marker, comprising the primer set.

[0069] The present invention also provides the use of the SNP molecular marker, primer set or kit in any of the following:

[0070] A1) Identification of WSSV tolerance and / or antioxidant capacity of Procambarus clarkii;

[0071] A2) preparing products for characterizing the WSSV tolerance and / or antioxidant capacity of Procambarus clarkii;

[0072] A3) Breeding of crayfish strains that are tolerant to WSSV and / or have high antioxidant capacity;

[0073] A4) preparing and cultivating WSSV-tolerant and / or high antioxidant capacity varieties of crayfish;

[0074] A5) Screening for species or individuals of Procambarus clarkii that are resistant to WSSV and / or have high antioxidant capacity;

[0075] A6) Prepare and screen varieties or individual products of Procambarus clarkii for tolerance to WSSV and / or high antioxidant capacity.

[0076] The present invention also provides a method for identifying, screening and / or breeding WSSV-tolerant and / or high antioxidant capacity varieties of Procambarus clarkii, using the primer set or kit to detect any of the SNP molecular markers in the sample, selecting materials with the test results of -50A>G and / or -774A>G, and obtaining Procambarus clarkii individuals or parents with higher WSSV tolerance and / or high antioxidant capacity. That is, when the above SNP sites mutate, the WSSV tolerance and antioxidant capacity of Procambarus clarkii are significantly improved.

[0077] Beneficial effects:

[0078] 1. The present invention constructs a eukaryotic expression vector (pGL3-Nrf2pro) of the 5' end regulatory region of the Procambarus clarkii Nrf2 gene and a mutant luciferase reporter vector.

[0079] 2. The present invention provides two SNP molecular markers related to WSSV tolerance of Procambarus clarkii. The SNP sites are located in the 5' regulatory region of the PcNrf2 gene, among which mut / -50A>G and mut / -774A>G are favorable markers for WSSV tolerance of Procambarus clarkii.

[0080] 3. The present invention also provides primer sequences for amplifying the above-mentioned molecular markers, including an upstream primer PcNrf2proF and a downstream primer PcNrf2proR:

[0081] The upstream primer sequence PcNrf2proF: CTCTGAACACCATATACGTA;

[0082] The downstream primer sequence PcNrf2proR: CAGCTGCAACACGCGCTCAT. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0084] Figure 1 The PCR amplification product (1721 bp) of the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii in the embodiment;

[0085] Figure 2 In the embodiment, the 5' regulatory region of the Nrf2 gene of Procambarus clarkii was amplified by PCR using the pGL3-Nrf2pro reporter vector as a template;

[0086] Figure 3 In the example, the constructed Nrf2 mutant luciferase reporter vector was used as a template to PCR amplify the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii;

[0087] Figure 4 These are the experimental results of luciferase activity detection of pGL3-Nrf2pro and mutant luciferase reporter vector in the examples. DETAILED DESCRIPTION

[0088] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0089] Example

[0090] According to the analysis, the WSSV viral load of Procambarus clarkii in natural populations varies, and individuals with extremely low viral copy numbers (Low) and extremely high viral copy numbers (High) were selected for BSA sequencing.

[0091] The present invention combines the whole genome resequencing data of the laboratory to develop Nrf2 gene SNP sites: the Low group is a natural population with low WSSV tolerance, and the High group is a natural population with high WSSV tolerance. According to the BSA sequencing results, 10 SNP mutation sites were found in the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii, of which 2 SNP sites were significantly associated with WSSV tolerance in the Procambarus clarkii population. Through the transcriptional activity detection of the point mutation luciferase reporter vector of the PcNrf2 gene, 2 favorable SNP molecular markers related to the WSSV tolerance trait were finally screened out.

[0092] Table 1. The frequencies of the 10 SNPs in the Nrf2 gene of Procambarus clarkii

[0093]

[0094]

[0095] The invention obtains the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii by PCR amplification, purifies and digests the amplified product, connects it to a luciferase reporter gene vector pGL3-Basic, constructs a mutation vector, transfects the point mutation luciferase reporter vector into 293T cells, measures its transcriptional activity by a dual fluorescence reporter system kit, and compares it with the association analysis result to achieve the purpose of verifying the association analysis result.

[0096] 1. Construction of Nrf2 gene eukaryotic expression vector and point mutation luciferase reporter vector

[0097] 1.1 Construction of Nrf2 gene eukaryotic expression vector (pGL3-Nrf2pro)

[0098] The whole genome DNA of Procambarus clarkii containing the Nrf2 gene was used as a template, and primer pair P was used to amplify the 5' regulatory region of the Procambarus clarkii Nrf2 gene. The Kpn1 restriction site was introduced into the 5' primer, and the XhoI restriction site was introduced into the 3' primer. The PCR reaction primers were designed as follows (underline indicates the introduced restriction site):

[0099] Upstream primer: GG GGTACC CCGGCCTCTGCAAGTCTAAATCATCCA35bp;

[0100] Downstream primer: CC CTCGAG GGCAGCTGCAACACGCGCTCAT 30bp;

[0101] PCR amplification system: 1 μL of Procambarus clarkii whole genome DNA (100 ng / mL), 0.5 μL of Primer1 (100 μmol / L), 0.5 μL of Primer2 (100 μmol / L), 10 μL of 2×MasterMix, 8 μL of ddH2O, a total of 20 μL.

[0102] PCR amplification parameters: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 60 s; and extension at 72°C for 10 min.

[0103] The PCR products were recovered and subjected to 1% agarose gel electrophoresis. Figure 1 As shown, lane M is a marker, and lanes 1-2 show the amplified Nrf2 gene 5' end regulatory region fragment of the expected size (1721 bp).

[0104] The large fragment recovered after double digestion of plasmid pGL3-Basic with Kpn1 and XhoI was used to establish a T4 ligase ligation system with the Nrf2 gene amplified by PCR after the same double digestion, and the ligation was carried out at 16°C overnight. After the ligation was completed, the ligation product was transformed into competent cells DH5α, and after culturing in a 37°C incubator for 12 hours, a single clone colony was picked and inoculated into LB culture medium containing 100 mg / L of ampicillin, and cultured at 37°C on a shaker. After shaking and culturing overnight, the plasmid was extracted. The vector size was identified by 1% agarose gel electrophoresis ( Figure 2 ), the plasmid with the correct size was identified by digestion with Kpn1 and XhoI, and the plasmid verified to be correct by enzyme digestion was sent to Qingke Biotechnology for full sequence sequencing verification.

[0105] 1.2 Construction of Nrf2 mutant luciferase reporter vector

[0106] Based on the dual luciferase reporter gene vector pGL3-Nrf2pro, site-directed mutagenesis was performed at the corresponding sites in Table 1 to construct 10 mutation vectors (mut / -50A>G; mut / -232C>G; mut / -724C>A; mut / -774A>G; mut / -850G>C; mut / -1085C>T; mut / -1194C>A; mut / -1277G>T; mut / -1400C>A; mut / -1598A>G). All mutation vectors were sent to Qingke Bio for full sequence sequencing verification, and the primer sequences used for mutation are as follows (the underlined bases are the introduced mutation bases).

[0107] mut / -50A>GF:TTATTCT G TCGTCGCTGGGCCACG; R:GGTACTGGAATAAGACCC CAGCAGCGACCGGG

[0108] mut / -232C>GF:ATACTTACTT G ATAACCACTAGTAATAGTGTTG;CCTTCTCTTATATGAATGAATGA C TATTGGTGATC

[0109] mut / -724C>AF:GTACACTACT A CTGTGTAGTGTACACGAGTATG;R:CATGAAAATGAGTACATGTGATGA T GACACATCAC

[0110] mut / -774A>GF:TTAACTTCAAC C TCGATTTTTAAAAGTACACAAGTAT GT:R:AAATCTGCATATAGAATTGAAGTTG G AGCTAAAAATTTT

[0111] mut / -850G>CF:TATTGTTTATATT C TTTAGATTCAAATAGTTGTTATTATT TAGA; G AAATCTAAGTTTmut / -1085C>TF:AATATTAGTTTT T GTGAGAAATTATTATATACTTC G: AGTACAAAACAAATTTTTAATCAAAA A CATACTCTTTAA

[0112] mut / -1194C>AF:GCTATTGCTATT A TTAGATGTATATGCTCATATTGGCA:

[0113] R:GTCTTCTCCCGATAACTATA T AACTRECORD

[0114] mut / -1277G>TF:TTCTGGGTTAGGG T TGTTGTTACGGTCAAGTAAAAA CA:CTCGCAAGACCCAATCCC AACAACAATGCCA

[0115] mut / -1400C>AF:AGTATATGGTAG A ATTCCACGGTTCTGTGAGTG; R:TTAGAGCAGAGTCATATACCATC T TAAGGTGCCAAG

[0116] mut / -1598A>GF:GTCGTGGGCTT G AAGCTAGATTCTAGATAAAACTA GAG; R: CTCAATTAGAAACAGCACCCGAA C TTCGATCTAAG

[0117] PCR amplification system: 2 μL each of forward / reverse mutation primers (10 μM), 1 μL of 50 ng / μL pGL3-Nrf2pro non-mutation plasmid, 10 μL of 5×FastAlteration Buffer, 1 μL of FastAlteration DNAPol ymerase, add RNase-Free ddH2O to 50 μL.

[0118] PCR amplification parameters: pre-denaturation at 95°C for 2 min; 18 cycles of denaturation at 94°C for 20 s, annealing at 55°C for 10 s, extension at 68°C for 2.5 min; and extension at 72°C for 5 min.

[0119] Dpn1 enzyme (20U / μL) was used to digest the plasmid template at 37°C for 1 h.

[0120] Enzyme digestion system: PCR product 50μL, Dpn 1 restriction enzyme (20U / μL), Total Volume 51μL.

[0121] The digestion product was transformed into competent cells DH5α, and after culturing in a 37°C incubator for 12 hours, a single clone was picked and inoculated into LB culture medium containing 100 mg / L ampicillin, and cultured on a shaker at 37°C. After shaking and culturing overnight, the plasmid was extracted. The vector size was identified by 1% agarose gel electrophoresis ( Figure 3 ), the plasmid with the correct size was digested with Kpn1 and XhoI for restriction digestion verification, and the plasmid with the correct restriction digestion verification was sent to Qingke Biotechnology for full sequence sequencing verification.

[0122] Therein, a fragment containing the SNP site is amplified and the mutant vector is directly sequenced.

[0123] The upstream primer sequence PcNrf2proF: CTCTGAACACCATATACGTA (SEQ ID NO: 2);

[0124] The downstream primer sequence PcNrf2proR: CAGCTGCAACACGCGCTCAT (SEQ ID NO: 3).

[0125] 2. Transfection of point mutation luciferase reporter vector of Procambarus clarkii Nrf2 gene and determination of relative transcriptional activity

[0126] 2.1 The transfection system was: 1000ng point mutation luciferase reporter vector, 100ng internal reference plasmid vector pRL-TK, 1uL PEI, 100uL serum-free DMEM medium. The unmutated pGL3-Nrf2pro vector was used as a control. After 12 hours of transfection, the cells were treated with H2O2 (inducing cellular oxidative damage, providing a highly oxidative environment and activating Nrf2), SFN (an effective specific Nrf2 inducer), and poly(I:C) (which can be recognized by the host's pattern recognition receptors as a pathogen-associated molecular pattern, activating Nrf2 and antioxidant factors such as GSH) for 12 hours, and one group was always untreated (normal).

[0127] 2.2 24 hours after transfection, collect cells according to the instructions of the dual fluorescence reporter system kit and use a detector to measure the fluorescence activity.

[0128] The ratio of the firefly fluorescence value to the Renilla fluorescence value was used as the relative fluorescence activity of the group, and the test results were statistically analyzed using the software GraphPad Prism 7;

[0129] The results of luciferase activity assay are shown in Figure 4 As shown in the figure, in the four groups of experiments, compared with pGL3-Nrf2pro, the relative luciferase expression activities of -232C>G; -724C>A; -850G>C; -1085C>T; -1194C>A; -1277G>T; -1400C>A; -1598A>G were basically unchanged. The relative luciferase expression activities of -50A>G and -774A>G showed a significant upward trend (P<0.05).

[0130] 3. Verification of the relative activity of the luciferase reporter vector of the point mutation of the Nrf2 gene on the results of the association analysis

[0131] According to https: / / bioinfo.life.hust.edu.cn / AnimalTFDB / #! / , the transcription factor binding sites of different SNPs were predicted; the χ2 value and P value were calculated using SPSS26.0.

[0132] Table 2. Results of association analysis between SNP sites of Nrf2 gene and WSSV tolerance

[0133]

[0134]

[0135] The results in Table 2 show that 10 SNP sites were obtained in the 5' regulatory region of the Nrf2 gene in the Procambarus clarkii population, of which 2 (-50A>G and -232C>G) were significantly associated with WSSV tolerance. The prediction results of transcription factor binding sites showed that the SNP sites were associated with immune regulatory factors such as IRF1, MAF and SPI1, and their mechanisms can be further explored.

[0136] Combined with the results of relative transcriptional activity of different mutation sites: -50A>G and -774A>G had higher relative transcriptional activity. Compared with pGL3-Nrf2pro, the relative luciferase expression activity of -232C>G; -724C>A; -850G>C; -1085C>T; -1194C>A; -1277G>T; -1400C>A; -1598A>G had basically no change. That is, -50A>G and / or -774A>G were significantly correlated with WSSV traits, and the relative luciferase expression activity showed a significant upward trend (P<0.05).

[0137] In summary, mutations occurred in the -50A>G and / or -774A>G sites of the 5' regulatory region of the Nrf2 gene in Procambarus clarkii. The mutations affected the binding of transcription factors to the promoter region, enhanced gene expression, and thereby enhanced the antioxidant properties and tolerance of Procambarus clarkii to WSSV.

[0138] Therefore, WSSV tolerance and antioxidant properties can be selected by selecting crayfish with corresponding mutations in the -50A>G and / or -774A>G sites in the 5' regulatory region of the Nrf2 gene.

[0139] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A SNP molecular marker related to WSSV tolerance and / or antioxidant capacity in the Nrf2 gene of Procambarus clarkii, characterized in that: The SNP molecular marker is located at -50A>G and / or -774A>G in the 5' end regulatory region of the Nrf2 gene of Procambarus clarkii, which are respectively located at the 1672nd and 948th positions of the nucleotide sequence shown in SEQ ID NO:

1.

2. The SNP molecular marker according to claim 1, characterized in that: When position 1672 of the sequence shown in SEQ ID NO: 1 is G, and / or position 948 is G, the Procambarus clarkii individuals show traits of being more tolerant to WSSV and / or having high antioxidant capacity.

3. A primer set for detecting the SNP molecular marker according to any one of claims 1-2, characterized in that: The primers included are as shown in SEQ ID NO: 2-3: PcNrf2proF: CTCTGAACACCATATACGTA; PcNrf2proR: CAGCTGCAACACGCGCTCAT.

4. A kit for detecting the SNP molecular marker according to any one of claims 1-2, characterized in that: Comprising the primer set of claim 3.

5. Use of the SNP molecular marker according to any one of claims 1 to 2, the primer set according to claim 3 or the kit according to claim 4 in any of the following: A1) characterizing the WSSV tolerance and / or antioxidant capacity of Procambarus clarkii; A2) preparing products for identifying WSSV tolerance and / or antioxidant capacity of Procambarus clarkii; A3) Breeding of crayfish strains that are tolerant to WSSV and / or have high antioxidant capacity; A4) preparing and cultivating WSSV-tolerant and / or high antioxidant capacity varieties of crayfish; A5) Screening for species or individuals of Procambarus clarkii that are resistant to WSSV and / or have high antioxidant capacity; A6) Prepare and screen varieties or individual products of Procambarus clarkii for tolerance to WSSV and / or high antioxidant capacity.

6. A method for identifying, screening and / or breeding WSSV-tolerant and / or high antioxidant capacity crayfish species, characterized in that: The sample is tested for the SNP molecular markers of any one of claims 1-2 using the primer set described in claim 3 or the kit described in claim 4, and materials with test results of -50A>G and / or -774A>G are selected to obtain crayfish individuals or parents that are more tolerant to WSSV traits and / or have high antioxidant capacity.

Images