Method for screening antiviral target spot by targeting virus DNA (Deoxyribose Nucleic Acid)

Abstract

The invention discloses a method for screening antiviral targets by targeting virus DNA (deoxyribonucleic acid). The method comprises the following steps: respectively obtaining effective sgRNA (single guide ribonucleic acid) sequences targeting key DNA regions of varicella zoster virus, herpes simplex virus type I and Carbosi sarcoma related herpes virus; carrying out co-transfection on plasmids containing virus DNA and dCas9-sgRNA, and respectively carrying out immunoprecipitation enrichment on DNA of targeted varicella zoster virus, herpes simplex virus type I and Carbosi sarcoma related herpes virus to screen proteins for regulating virus replication; and identifying the protein by mass spectrum, and verifying that the method is also suitable for DNA screening of targeted human immunodeficiency virus to regulate and control the protein replication of the virus, so that the method for screening the protein replication of the virus by targeted virus DNA is established.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a method for screening antiviral targets by targeting viral DNA. Background Art

[0002] Herpesviruses are a class of DNA viruses that are widely present in nature and can cause a variety of acute and chronic diseases. This virus family includes herpes simplex virus (HSV-1 and HSV-2), varicella-zoster virus (VZV), human herpesvirus 6 (HHV-6), human herpesvirus 8 (HHV-8), and many other types. Since herpesviruses have the characteristics of latent infection, once infected, they may exist for life, so the research on this type of virus is of great significance.

[0003] Among them, herpes simplex virus (HSV) and varicella zoster virus (VZV) can induce serious infectious skin diseases, seriously endangering the health and quality of life of adults and immunocompromised children, and placing a heavy burden on families. KSHV (Kaposi's Sarcoma-associated Herpesvirus) is a human herpesvirus belonging to the family of gammaherpesviridae. KSHV is associated with the occurrence of many diseases, the most famous of which is Kaposi's sarcoma, a vascular tumor that usually occurs in people with impaired immune systems, such as AIDS patients. In addition, KSHV is also associated with primary lymphoma and multiple plasma cell diseases (such as multiple myeloma), which seriously affects the health and quality of life of patients. However, due to the lack of in vitro research models for viruses, it is difficult to explore the interaction between the host and the virus and the key regulatory methods of the host on the virus.

[0004] Currently, we can explore the interaction between host and virus by using various high-throughput analysis methods such as omics to compare the differences in host protein expression before and after viral infection, or by using sgRNA library screening to explore the knockdown of host genes and then discover related regulatory factors for in-depth mechanism exploration.

[0005] Therefore, exploring efficient research methods and discovering key targets to achieve the goal of controlling latent viral replication is a research hotspot in the field and also a need for clinical treatment.

[0006] At present, the main methods for studying protein regulation of viral gene transcription are as follows:

[0007] (1) Starting from a single protein: After analyzing the sequence of the viral promoter region, the conserved binding sites of potential transcription factor binding proteins are found, and then the transcription function is studied; the disadvantage of this method is that the transcription protein to be studied needs to be widely studied and its conserved binding sequence is known. [1] ;

[0008] (2) Based on high-throughput analysis methods such as proteomics and transcriptomics, the differences in protein expression before and after viral infection are compared to find proteins that may directly or indirectly participate in viral transcriptional regulation. The disadvantage of this method is that most of the differentially expressed proteins are not directly involved in the viral gene transcriptional regulation process, but may be the overall response of the host after viral infection, which is not specific for studying viral gene transcriptional regulation. [2] ;

[0009] (3) sgRNA / shRNA library screening: After knocking down or knocking out the host gene through the library, screen for proteins that affect viral gene transcription, and then verify the transcription function; the disadvantage of this method is that the loss of many key genes will affect cell growth, such as essential genes for cell survival; the noise background of these gene knockdowns often affects the screening results, and there is an obvious indirect effect [3] ;

[0010] (4) Using biotin probes to bind to viral promoter segments, such as using streptavidin-coupled beads to separate and purify proteins that interact with the segment. Although this method is more direct in finding regulatory factors, the method has poor protein enrichment specificity due to the high non-specificity of biotin-labeled probes binding to fragmented DNA. [4] .

[0011] Patent application number 202010131159.2, "Cas9-sgRNA-based viral LTR immunoprecipitation to screen for targets regulating viral transcription", discloses: for the first time, Cas9-sgRNA combined immunoprecipitation was used to detect proteins interacting with LTR in the HIV promoter region, proving that this method can be used to screen proteins that bind to viral LTRs and regulate HIV-1 gene transcription. This method has limitations and can only be applied to the HIV LTR region. In addition, this method is inefficient, and the number of proteins obtained by mass spectrometry is very limited.

[0012] Establishing a method that can be applied to both herpes virus and HIV LTR regions can expand the scope of virus screening more efficiently and can also achieve efficient screening of antiviral targets, but there are many difficulties for the following reasons:

[0013] The activation system needs to keep the promoter in a well-activated state, but the openness of chromatin affects the participation of transcriptional regulatory factors;

[0014] The difficulty in selecting sgRNA lies in: fully considering the coverage of the target DNA based on the effective targeting effect of sgRNA, and at the same time taking into account the lowest possible non-specificity to avoid excessive non-specific signals that affect specificity;

[0015] The sample volume required for CHIP experiments is usually large and the experimental cycle is long, involving multiple complex steps; the experimental process includes cell fixation, DNA shearing, immunoprecipitation, rinsing, cross-linking and DNA purification, etc., each step requires careful operation and proper optimization; due to the influence of different experimental conditions (such as antibody selection, shearing conditions, etc.) on the results, multiple rounds of experiments are required to determine the optimal conditions.

[0016] The complex life cycle and latent reactivation mechanism of herpes viruses make them a major challenge in virological research; extending the technology for screening proteins that interact with viral promoters to herpes virus research will help develop more effective prevention and control strategies to reduce the spread and impact of herpes virus infections, and has clinical application prospects.

[0017] References:

[0018] [1] Jayaram, N., D. Usvyat, and RMAC, Evaluating tools for transcription factor binding site prediction. BMC Bioinformatics, 2016.17(1):p.547.

[0019] [2] Cui, M., C. Cheng, and L. Zhang, High-throughput proteomics: amethodological mini-review. Lab Invest, 2022.102(11):p.1170-1181.

[0020] [3]Joung, J., et al., Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc, 2017.12(4):p.828-863.

[0021] [4]Cheah,JSand S.Yamada,A simple elution strategy for biotinylatedproteins bound to streptavidin conjugated beads using excess biotin andheat.Biochem Biophys Res Commun,2017.493(4):p.1522-1527. Summary of the invention

[0022] In view of the problems existing in the current research on protein regulation of key viral gene transcription, this application has established a method for screening antiviral targets by targeting viral DNA, and obtained an effective sgRNA sequence for the promoter region of the key immediate early protein (ORF4) of varicella-zoster virus; co-transfected a plasmid containing the ORF4 promoter region and dCas9-sgRNA; obtained an effective sgRNA sequence for the ICP27 promoter region of herpes simplex virus type I; co-transfected a plasmid containing the ICP27 promoter region and dCas9-sgRNA, and obtained an effective sgRNA sequence for the RTA promoter region of Posey's sarcoma-associated herpes virus; co-transfected a plasmid containing the RTA promoter region and dCas9-sgRNA, and respectively immunoprecipitated and enriched DNA targeting varicella-zoster virus, herpes simplex virus type I, and Posey's sarcoma-associated herpes virus to screen proteins that regulate viral replication; mass spectrometry identified proteins, and verified that this method is also applicable to DNA targeting HIV to screen proteins that regulate viral replication, and established a method for screening proteins that regulate viral replication by targeting viral DNA. To achieve the above objectives, the specific technical scheme of the present invention is as follows:

[0023] First, sgRNA design and plasmid construction

[0024] Design 10 sgRNAs with different sequences (SEQ ID NO.1-SEQ ID NO.10) for the ORF4 promoter region of varicella-zoster virus (VZV);

[0025] Eight sgRNAs with different sequences (SEQ ID NO.11-SEQ ID NO.18) were designed for the ICP27 promoter region of herpes simplex virus type 1 (HSV-1);

[0026] Targeting the LTR promoter region of HIV, three sgRNAs with different sequences, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, were mixed as the sgRNA pool for subsequent interaction with the dCas9 protein;

[0027] Eight sgRNAs with different sequences (SEQ ID NO.11-SEQ ID NO.18) were designed targeting the RTA promoter region of Kaposi's sarcoma-associated herpesvirus (KSHV).

[0028] Different sgRNA sequences were constructed into the PX459 vector plasmid containing Cas9.

[0029] Second aspect: Screening of effective sgRNA targeting viral DNA

[0030] Utilize the reporter system to verify the effectiveness of sgRNA targeting and obtain effective sgRNA sequences.

[0031] Targeting the ORF4 promoter of varicella-zoster virus (VZV), sgRNAs of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 were screened and mixed as the sgRNA pool for subsequent interaction with dCas9 protein;

[0032] Targeting the ICP27 promoter region of herpes simplex virus type 1 (HSV-1), sgRNAs of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were screened and mixed as the sgRNA pool for subsequent interaction with dCas9 protein;

[0033] Targeting the RTA promoter region of Kaposi's sarcoma-associated herpesvirus (KSHV), sgRNAs of SEQ ID NO.24, SEQ ID NO.27, and SEQ ID NO.29 were screened and mixed as a sgRNA pool for subsequent interaction with dCas9 protein.

[0034] Third, Chip-qPCR verified the binding of dCas9 in the VZV ORF4 promoter region, the HSV1ICP27 promoter region, and the KSHV RTA promoter region

[0035] To further verify the effectiveness of the second aspect of the experimental process, that is, whether dCas9 effectively binds to the region, some of the protein products to be identified in the second aspect were taken for q-PCR verification.

[0036] Results: Compared with the negative control group with sg-Gal4 added, sg-mix can significantly guide 3×Flag dCas9 to the promoter region, verifying the effectiveness of the second experimental process.

[0037] Fourth aspect: immunoprecipitation preparation of proteins interacting with VZV ORF4 promoter region / HSV1 ICP27 promoter region / HIV LTR promoter region / KSHV RTA promoter region

[0038] According to the mixed sgRNA of the second aspect, proteins that interact with the VZV ORF4 promoter region / HSV1 ICP27 promoter region / HIV LTR promoter region / KSHV RTA promoter region are prepared by immunoprecipitation to obtain a protein product to be identified.

[0039] Fifth aspect: Mass spectrometry identification of enriched interacting proteins

[0040] The protein product to be identified obtained in the fourth aspect was subjected to mass spectrometry analysis, and the results were as follows:

[0041] For the VZV ORF4 promoter, several proteins that can regulate varicella-zoster virus (VZV) were identified, and their gene names are: KRT86, MIF, RNF20, AASDHPPT, DUS3L, YY1, ILKAP, FLYWCH2, YBX1, NUP50, and CPSF6;

[0042] For the HSV1 ICP27 promoter, several proteins that can regulate herpes simplex virus type Ⅰ (HSV1) were identified, and their gene names are: H3C1, RNH1, WDR18, PAK1IP1, WARS1, PAICS, NOMO3, IRS4, CIRBP, CPNE3, RHOC;

[0043] For the KSHV RTA promoter, several proteins that can regulate Kaposi’s sarcoma-associated herpesvirus (KSHV) were identified, and their gene names are: POLR2B, CLIC4, STAU2, PPP1CB, TPR, WARS1, IRS4, PAICS, RAB8A, NOMO3, RAB1B, and TMEM33.

[0044] Sixth aspect, the screening process of the present application method

[0045] (I) Targeting of target DNA using single sgRNA and mixed sgRNA

[0046] Results: When using a single sgRNA, the individual efficiency is very high, but it cannot guarantee complete coverage of the target DNA. Using mixed sgRNA can ensure that each region can be well targeted; therefore, for varicella-zoster virus, a mixed sgRNA of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 was selected, for herpes simplex virus type Ⅰ, a mixed sgRNA of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 was used, and for Kaposi's sarcoma-associated herpes virus, SEQ ID NO.24, SEQ ID NO.27, and SEQ ID NO.29 were used.

[0047] (II) Targeting of magnetic beads or agarose beads to target DNA

[0048] Results: Magnetic beads were easy to operate during elution, but the nonspecific signal was too high. Agarose beads were easier to operate and had lower nonspecific signals, so agarose beads were selected.

[0049] (III) Targeting of target DNA with different agarose bead input

[0050] Results: The targeting efficiency of the experimental group with an input of 15 μL agarose beads was good, but the signal of the control group was too high. The input of 11 μL agarose beads resulted in a significant decrease in the signal of the control group due to a slight adjustment, so the input of 11 μL agarose beads was selected.

[0051] Seventh aspect, comparison between the method of the present application and the patent application number 202010131159.2

[0052] (I) Comparison of the targeting efficiency of this application and patent No. 202010131159.2 on HIV virus DNA

[0053] Results: The targeting efficiency of the method of the present application for HIV viral DNA is much higher than that of the patent application No. 202010131159.2, so the method of the present application is also suitable for screening and regulating HIV transcription targets, and the targeting efficiency of the method of the present application for HIV viral DNA is greatly improved compared with the method of the patent application No. 202010131159.2.

[0054] (II) Comparison of the efficiency of this application and the patent with application number 202010131159.2 in targeting herpes virus

[0055] Results: The targeting efficiency of the method of this application for varicella-zoster DNA is greatly improved compared with the method of patent application No. 202010131159.2; the method of patent application No. 202010131159.2 is not suitable for targeting varicella-zoster DNA to screen new antiviral targets due to its low efficiency.

[0056] Compared with the prior art, the beneficial effects of this application are:

[0057] 1. For the first time, a method for screening antiviral targets by targeting both herpes virus and HIV DNA was established, which can expand the scope of virus screening more efficiently;

[0058] 2. The targeting efficiency of the method of this application for HIV DNA is greatly improved compared with the method of patent application 202010131159.2;

[0059] 3. The identification of multiple proteins that can regulate varicella-zoster virus (VZV), herpes simplex virus type 1 (HSV1), and Kaposi's sarcoma-associated herpesvirus (KSHV) will help to clarify the pathogenic mechanism of herpes viruses and lay the foundation for revealing new anti-herpes virus therapeutic targets, thereby promoting the development of new drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 , Schematic diagram of varicella zoster virus sgRNA design;

[0061] Figure 2 , Schematic diagram of herpes simplex virus type Ⅰ sgRNA design;

[0062] Figure 3 , Schematic diagram of Kaposi's sarcoma-associated herpesvirus sgRNA design;

[0063] Figure 4 , luciferase experiments verified the targeting efficiency of sgRNA in the ORF4 promoter region of varicella-zoster virus;

[0064] Figure 5 , luciferase assay to verify the targeting efficiency of sgRNA in the ICP27 promoter region of herpes simplex virus type Ⅰ;

[0065] Figure 6 , luciferase assay to verify the targeting efficiency of sgRNA in the RTA promoter region of Kaposi's sarcoma-associated herpesvirus;

[0066] Figure 7 , Chromatin immunoprecipitation experiments verified the targeting of sgRNAmix to the target DNA in the ORF4 promoter region of varicella-zoster virus;

[0067] Figure 8 , Chromatin immunoprecipitation experiments verified the targeting of sgRNAmix to the target DNA in the ICP27 promoter region of herpes simplex virus type Ⅰ;

[0068] Fig. 9, Chromatin immunoprecipitation experiments verified the targeting of sgRNAmix to the target DNA in the RTA promoter region of Kaposi's sarcoma virus;

[0069] Fig.10 , mass spectrometry to obtain a map of proteins interacting with varicella-zoster virus DNA;

[0070] Fig.11 , mass spectrometry to obtain the protein map interacting with herpes simplex virus type Ⅰ DNA;

[0071] Fig.12 , mass spectrometry to obtain a protein map that interacts with Kaposi's sarcoma-associated herpesvirus DNA;

[0072] Fig.13 , targeting of varicella-zoster virus DNA using a single sgRNA;

[0073] Fig.14 , targeting of varicella-zoster virus DNA using mixed sgRNA;

[0074] Fig.15 , targeting of herpes simplex virus DNA using a single sgRNA;

[0075] Fig.16 , targeting of herpes simplex virus DNA using mixed sgRNA;

[0076] Fig.17 , using magnetic beads + mixed sgRNA to target herpes simplex virus DNA;

[0077] Fig.18 , using agarose beads + mixed sgRNA, targeting herpes simplex virus DNA;

[0078] Fig.19 , using magnetic beads + mixed sgRNA to target varicella-zoster virus DNA;

[0079] Fig. 20 , targeting of varicella-zoster virus DNA using agarose beads + mixed sgRNA;

[0080] Fig.21 , using 15 μL of mixed sgRNA + agarose beads, targeting varicella-zoster virus DNA;

[0081] Fig. 22 , using 11 μL of mixed sgRNA + agarose beads, targeting varicella-zoster virus DNA;

[0082] Fig.23, using 15 μL of mixed sgRNA + agarose beads, targeting herpes simplex virus DNA;

[0083] Fig.24 , using 11 μL of mixed sgRNA + agarose beads, targeting herpes simplex virus DNA;

[0084] Fig.25 2. The targeting efficiency of the method of the present application on HIV viral DNA is compared with the method of patent application number 202010131159.2 "Screening of regulated viral transcription targets by viral LTR immunoprecipitation based on Cas9-sgRNA";

[0085] Fig.26 , mass spectrometry to obtain a map of proteins interacting with HIV viral DNA;

[0086] Fig. 27 , the efficiency of targeting varicella-zoster virus DNA according to the patent application number 202010131159.2 "Screening of regulated viral transcription targets by viral LTR immunoprecipitation based on Cas9-sgRNA";

[0087] Fig.28 , according to the method of the present application, the efficiency of targeting varicella-zoster virus DNA.

[0088] Figure 1-28 middle,

[0089] 1-250bp, 251-500bp, 501-750bp, 751-1000bp refer to the fragment region of the target DNA;

[0090] *, **, *** and **** represent P<0.05, P<0.01, P<0.001 and P<0.0001, respectively, indicating that the difference between the two groups was statistically significant. DETAILED DESCRIPTION

[0091] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0093] All materials, reagents, etc. in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0094] Reagents and Materials

[0095]

[0096] instrument

[0097]

[0098] Definition of some terms

[0099] Unless otherwise defined hereinafter, the meaning of all technical terms and scientific terms used in the specific embodiments of the present invention are intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present invention.

[0100] The "immunoprecipitation (IP)" described in the present invention is that an antibody against a specific target protein forms an immune complex with the target protein in a sample (cell lysate, etc.), and then the immune complex is precipitated from the mixture using Protein A-agarose beads or Anti-Flag agarose beads. Finally, the target protein is eluted from the agarose beads, and the eluted protein is analyzed by SDS-PAGE, Western Blot, mass spectrometry, etc.

[0101] The "viral LTR immunoprecipitation based on Cas9-sgRNA (dCas9 / sgRNA-guidedviral LTR IP)" described in the present invention refers to the process of guiding the labeled Cas9 to the LTR region by designing a specific sgRNA targeting the LTR region based on the CRISPR-Cas9 principle. Since Cas9 carries a label for subsequent immunoprecipitation enrichment, all proteins interacting with LTR can be enriched, thus achieving the purpose of screening viral LTR interacting proteins by immunoprecipitation.

[0102] The "dCas9" described in the present invention refers to deactivated Cas9, which retains the ability to recognize and bind to sgRNA but loses the ability to cut DNA.

[0103] The ORF4 promoter region of the present invention refers to the promoter region of the immediate early protein ORF4 of varicella-zoster virus.

[0104] The ICP27 promoter region of the present invention refers to the promoter region of the immediate early protein of herpes simplex virus type I.

[0105] The RTA promoter region described in the present invention refers to the promoter region of the Kaposi's sarcoma-associated herpes virus immediate early protein.

[0106] Example 1. sgRNA design and plasmid construction

[0107] The present invention designs 10 sgRNAs with different sequences for the ORF4 promoter region of varicella-zoster virus (VZV), as shown in the schematic diagram Figure 1 , the specific sequence is as follows:

[0108]

[0109]

[0110] The present invention designs 8 sgRNAs with different sequences for the ICP27 promoter region of herpes simplex virus type 1 (HSV1), as shown in the schematic diagram Figure 2 , the specific sequence is as follows:

[0111] Serial Number Sequence information SEQ ID NO.11 GGTGGTACAAGAAGGTGACC SEQ ID NO.12 GTGGTGATGGTCAGAAACAG SEQ ID NO.13 GCGGCCTTGTCTGCGTTCTT SEQ ID NO.14 ATTGTGTTATATCGCCGTGG SEQ ID NO.15 GTATGACGTCACATCCAGGC SEQ ID NO.16 GTTGGGATCCAGGCTACACG SEQ ID NO.17 TGATTGGTCCTTGTCTGTGC SEQ ID NO.18 GTGCAGCCGTGTTCCAACCA

[0112] The present invention uses three sgRNAs with different sequences for the LTR promoter region of HIV, and the specific sequences are as follows:

[0113] Serial Number Sequence information SEQ ID NO.19 TAACTCGAGAGACCCAGTAC SEQ ID NO.20 GGGAGCTCTCTGGCTAACTA SEQ ID NO.21 TGCTTATATGCAGGATCTGA

[0114] The present invention designs 8 sgRNAs with different sequences for the Kaposi's sarcoma-associated herpes virus (KSHV) RTA promoter region, as shown in the schematic diagram Figure 3 , the specific sequence is as follows:

[0115] Serial Number Sequence information SEQ ID NO.22 AGTGTCCTGGAAGAGTATGG SEQ ID NO.23 CATCGTGTTTGAACGTCTGC SEQ ID NO.24 GGAACTCCACATCCACAAAG SEQ ID NO.25 GGAGACACATTCTTTCTGCG SEQ ID NO.26 AGATAGATTTATGCTGATAC SEQ ID NO.27 CAGACCTCTGAGAATACGCT SEQ ID NO.28 GTACATGTGACTGAACATGG SEQ ID NO.29 TCACAACAGACTACCCCTTG

[0116] The present invention establishes a rapid reporting system, constructs different sgRNA sequences into the PX459 vector plasmid containing Cas9, and co-transfects the plasmid and the luciferase reporter plasmid containing the ORF4 promoter into 293T cells. After adding the IE62 protein of VZV, the promoter transcription is activated. Effective sgRNA will specifically target this region to destroy the expression of luciferase, and the expression of luciferase will be reduced.

[0117] The results of luciferase experiment verification showed that among the 10 sgRNAs targeting the VZV ORF4 promoter region, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.7, and SEQ ID NO.10 had a significant effect of downregulating Luciferase expression. Figure 4 , indicating that sgRNAs of SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.7, and SEQ ID NO.10 can effectively target three different regions of the target DNA.

[0118] In order to further increase the enrichment efficiency of DNA sequences and eliminate the possibility that a single sgRNA / dCas9 and protein may occupy a certain region of the target DNA in space, resulting in low protein interaction efficiency, the present invention creatively selects a combination of sgRNA sequences, i.e., a mixture of sgRNAs of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 as the sgRNA pool for subsequent interaction with the dCas9 protein, and eliminates other interfering factors as much as possible from the experimental design.

[0119] The same method was used for the ICP27 promoter of HSV1. The results showed that among the eight sgRNAs targeting the HSV1 ICP27 promoter region, SEQ ID NO.11-SEQ ID NO.18 all had a significant effect of downregulating Luciferase expression. Figure 5 , indicating that these sgRNAs can effectively target different regions of the target DNA.

[0120] In order to minimize the influence of dCas9 protein occupancy and fully cover the target DNA fragment, we finally selected a combination of sgRNA sequences, i.e., a mixture of sgRNAs of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 as the sgRNA pool for subsequent interaction with dCas9 protein, and to exclude other interfering factors as much as possible from the experimental design.

[0121] Targeting the LTR promoter region of HIV, three sgRNAs with different sequences, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, were mixed as the sgRNA pool for subsequent interaction with the dCas9 protein.

[0122] The same method was used for the KSHV RTA promoter. The results showed that among the eight sgRNAs targeting the KSHV RTA promoter region, SEQ ID NO.22-SEQ ID NO.29 all had a significant effect of downregulating Luciferase expression. Figure 6 , indicating that these sgRNAs can effectively target different regions of the target DNA.

[0123] In order to minimize the influence of dCas9 protein occupancy and fully cover the target DNA fragment, we finally selected a combination of sgRNA sequences, i.e., a mixture of sgRNAs of SEQ ID NO.24, SEQ ID NO.27, and SEQ ID NO.29 as the sgRNA pool for subsequent interaction with dCas9 protein, and to exclude other interfering factors as much as possible from the experimental design.

[0124] Example 2: Targeting viral DNA to screen for new proteins that regulate viral replication

[0125] 1. Targeting the DNA of varicella-zoster virus VZV to screen for new proteins that regulate viral replication

[0126] 1. Transfection samples

[0127] 293T cells were transfected with a plasmid carrying the VZV ORF4 promoter region, an empty vector (as a negative control group), and a dCas9-sgRNA pool consisting of sgRNA sequences of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10;

[0128] 2. Cell cross-linking

[0129] Each sample had 8 dishes of 15 cm-dish cells. After 48 hours of transfection, the cells were fixed with 1% methanol-free formaldehyde for 15 minutes. After adding glycine for 5 minutes, the supernatant was discarded and the cells were rinsed twice with pre-cooled phosphate-buffered saline (PBS).

[0130] 3. Cell Lysis

[0131] 2 mL of PBS containing protease inhibitors was added to each dish to collect cells. After centrifugation at 1600 rpm, sodium dodecyl sulfate (SDS) lysis buffer containing protease inhibitors and dithiothreitol (DDT) was added to resuspend the cells evenly and fully lysed on ice;

[0132] 4. Obtain DNA fragments by ultrasound

[0133] Use an ultrasonic instrument to break the DNA to obtain DNA fragments with a size between 200 bp and 1000 bp; after repeated centrifugation at 15000 rpm for at least 3 times, take 1 mL of the fragmented DNA and dilute it to 3 mL;

[0134] 5. Pretreatment to remove non-specific binding

[0135] Pre-treat with protein A agarose beads and incubate with samples for 2 hours to reduce nonspecific binding;

[0136] 6. Co-immunoprecipitation

[0137] After discarding protein A beads, add 11 μL of Flag beads and incubate at 4°C overnight.

[0138] 7. Rinse and remove impurities to obtain the protein product to be identified

[0139] The agarose beads (Flag beads) with DNA interaction products were repeatedly washed with a wash buffer, and the washing sequence was low salt buffer for 11 minutes once, high salt buffer for 5 minutes once, low salt buffer for 11 minutes twice, TE for 5 minutes twice, and finally washed three times with PBS, all of which were shaken at a low speed on a shaker to obtain the protein product to be identified. The mass spectrometry identification samples were directly frozen in a -80°C refrigerator; among them, the low salt buffer (low salt) was: 0.1% sodium dodecyl sulfate, 1% Triton X-100, 2mM ethylenediaminetetraacetic acid, 20mM tris (hydroxymethyl) aminomethane hydrochloride, 150mM sodium chloride; the high salt buffer (high salt) was: 0.1% sodium dodecyl sulfate, 1% Triton X-100, 2mM ethylenediaminetetraacetic acid, 20mM tris (hydroxymethyl) aminomethane hydrochloride, 300mM sodium chloride; the buffer (TE) was: 10mM tris (hydroxymethyl) aminomethane hydrochloride, 1mM ethylenediaminetetraacetic acid.

[0140] 2. Targeting the DNA of herpes simplex virus type Ⅰ (HSV1) to screen for new proteins that regulate viral replication

[0141] 1. Transfection samples

[0142] 293T cells were transfected with a plasmid carrying the ICP27 promoter region of HSV1, an empty vector (as a negative control group), and a dCas9-sgRNA pool consisting of sgRNA sequences of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18;

[0143] The remaining steps (2-7) are the same as "1. Targeting the DNA of varicella-zoster virus VZV to screen for new proteins that regulate viral replication".

[0144] 3. Targeting HIV DNA to screen for new proteins that regulate viral replication

[0145] 1. Transfection samples

[0146] 293T cells were transfected with a plasmid carrying the LTR promoter region of HIV, an empty vector (as a negative control group), and a dCas9-sgRNA pool consisting of sgRNA sequences of SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21;

[0147] The remaining steps 2-7 are the same as “1. Targeting the DNA of varicella-zoster virus VZV to screen for new proteins that regulate viral replication”.

[0148] 4. Targeting the DNA of Kaposi's sarcoma-associated herpesvirus KSHV to screen for new proteins that regulate viral replication

[0149] 1. Transfection samples

[0150] 293T cells were transfected with a plasmid carrying the RTA promoter region, an empty vector (as a negative control group), and a dCas9-sgRNA pool consisting of sgRNA sequences of SEQ ID NO.24, SEQ ID NO.27, and SEQ ID NO.29;

[0151] The remaining steps 2-7 are the same as “1. Targeting the DNA of varicella-zoster virus VZV to screen for new proteins that regulate viral replication”.

[0152] Example 3: q-PCR verification of dCas9 binding in the VZV ORF4 promoter region and the HSV1 ICP27 promoter region

[0153] 1. Methods

[0154] To further verify the effectiveness of the experimental process in Example 2, that is, whether dCas9 effectively binds to this region, some of the protein products to be identified in Example 2 were taken, cross-linked at 65°C overnight, and then treated with RNase and protease, and the DNA was purified using a PCR fragment recovery kit; the binding of dCas9 to this promoter region was detected by q-PCR.

[0155] Primers were designed to amplify different regions of the ORF4 promoter (the promoter is 1000 bp in total, divided into 4 regions with 250 bp as a fragment, namely 1-250 bp, 251-500 bp, 501-750 bp, and 751-1000 bp). Here, HSV1 is the ICP27 promoter region, and KSHV is the RTA promoter region, which is also 1000 bp and divided into 4 regions with 250 bp as a fragment.

[0156] 2. Results

[0157] The results of VZV qPCR experiments are shown in Figure 7 , the results of HSV1 are shown in Figure 8 , the results of KSHV are shown in Fig. 9 , indicating that: compared with the negative control group with sg-Gal4 added, sg-mix can significantly guide 3×Flag dCas9 to the promoter region, verifying the effectiveness of the experimental process in Example 2.

[0158] Example 4: Mass spectrometry analysis

[0159] The protein product to be identified for targeting VZV DNA prepared in Example 2 was sent to Hangzhou Jingjie Biomass Spectrometry Platform for identification and analysis. The results showed that a variety of proteins that can bind to the DNA of varicella zoster virus (VZV) were screened, among which YY1, YBX1, etc. are proteins known in the prior art that can regulate VZV. This result also proves the accuracy and effectiveness of the method. The results are shown in Table 1 and Fig.10 .

[0160] Table 1. Some proteins that can bind to VZV DNA screened by the method of the present application

[0161] serial number Gene name scope(%) Number of peptides Unique peptide number O43790 KRT86 5.56 3 2 P14174 MIF 17.39 2 2 Q5VTR2 RNF20 12.92 11 10 Q9NRN7 AASDHPPT 8.74 2 2 Q96G46 DUS3L 6.46 4 4 P25490 YY1 22.46 9 9 Q9H0C8 ILKAP 23.47 10 10 Q96CP2 FLYWCH2 34.29 4 4 P67809 YBX1 29.01 6 4 Q9UKX7 NUP50 19.87 8 8 Q16630 CPSF6 8.53 4 4

[0162] The protein products prepared in Example 2 targeting HSV1 DNA were sent to the Hangzhou Jingjie Biomass Spectrometry Platform for identification and analysis, and a variety of interacting proteins were screened that could bind to the DNA of herpes simplex virus type Ⅰ (HSV1). The results are shown in Table 2 and Fig.11 .

[0163] Table 2. Some proteins that can bind to HSV1 DNA screened by the method of the present application

[0164] serial number Gene name scope(%) Number of peptides Unique peptide number P68431 H3C1 24.26 4 1 P13489 RNH1 13.67 5 5 Q9BV38 WDR18 5.56 2 2 Q9NWT1 PAK1IP1 11.22 4 4 P23381 WARS1 9.34 4 4 P22234 PAICS 16.94 6 6 P69849 NOMO3 5.32 5 5 O14654 IRS4 2.94 3 3 Q14011 CIRBP 14.53 2 2 O75131 CPNE3 16.57 9 9 P08134 RHOC 27.98 5 1

[0165] The protein products prepared in Example 2 targeting KSHV DNA were sent to Hangzhou Jingjie Biomass Spectrometry Platform for identification and analysis, and multiple interacting proteins were screened to bind to Kaposi's sarcoma (KSHV) DNA. The results are shown in Table 3 and Fig.12 .

[0166] Table 3. Some proteins that can bind to KSHV DNA screened by the method of the present application

[0167] serial number Gene name scope(%) Number of peptides Unique peptide number P30876 POLR2B 6.39 7 7 Q9Y696 CLIC4 28.46 6 6 Q9NUL3 STAU2 12.63 6 5 P62140 PPP1CB 19.57 6 2 P12270 TPR 2.67 6 6 P23381 WARS1 12.74 6 6 O14654 IRS4 5.25 6 6 P22234 PAICS 15.76 6 6 P61006 RAB8A 27.05 5 3 P69849 NOMO3 4.34 5 5 Q9H0U4 RAB1B 26.37 5 1 P57088 TMEM33 17.81 5 5

[0168] Example 5. Targeting of target DNA using single sgRNA and mixed sgRNA

[0169] 1. Targeting of varicella zoster DNA using single sgRNA and using mixed sgRNA

[0170] 1. Methods

[0171] The sgRNAs of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 were mixed as the sgRNA pool interacting with dCas9, or the single SEQ ID NO.2, SEQ ID NO.5, and SEQ ID NO.8 were used as the sgRNA interacting with dCas9 respectively; the protein (varicella-zoster virus) interacting with the ORF4 promoter was prepared by immunoprecipitation; the binding of dCas9 in the ORF4 promoter region was verified by qPCR, see the method in Example 1-3, and the Flag beads used in this example were 15 μL of magnetic beads.

[0172] 2. Results

[0173] When using a single sgRNA, the individual efficiency is high, but it cannot guarantee complete coverage of the target DNA, such as Fig.13 As shown;

[0174] Using mixed sgRNA can ensure that each region can be well targeted, such as Fig.14 shown.

[0175] 3. Conclusion

[0176] In summary, a mixed sgRNA of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 was selected for use.

[0177] 2. Targeting of HSV-1 DNA using single sgRNA and mixed sgRNA

[0178] 1. Methods

[0179] The sgRNAs of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were mixed as a sgRNA pool interacting with dCas9, or single SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were used as sgRNAs interacting with dCas9 respectively; a protein interacting with the ICP27 promoter (herpes simplex virus type I) was prepared by immunoprecipitation; and the binding of dCas9 to the ICP27 promoter region was verified by qPCR, as shown in the method of Examples 1-3. In this example, 15 μL of magnetic beads were used as Flag beads.

[0180] 2. Results

[0181] When using a single sgRNA, the individual efficiency is very high, but it cannot guarantee complete coverage of the target DNA. Fig.15 As shown;

[0182] Using mixed sgRNA can ensure that each region can be well targeted, such as Fig.16 shown.

[0183] 3. Conclusion

[0184] In summary, a mixed sgRNA of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 was selected for use.

[0185] Example 6: Targeting of magnetic beads or agarose beads to target DNA

[0186] 1. Targeting of varicella zoster virus DNA by magnetic beads or agarose beads

[0187] 1. Methods

[0188] The sgRNAs of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 were mixed as a sgRNA pool interacting with dCas9; the protein (varicella zoster virus) interacting with the ORF4 promoter was prepared by immunoprecipitation; the binding of dCas9 in the ORF4 promoter region was verified by qPCR, see the method in Examples 1-3, and the amount of Flag beads used in this Example was 15 μL.

[0189] 2. Results and Conclusions

[0190] Magnetic beads are easy to operate during elution, but the nonspecific signal is too high, such as Fig.17 As shown;

[0191] Agarose beads are easy to operate and have low nonspecific signals, such as Fig.18 As shown, agarose beads were therefore selected.

[0192] 2. Targeting of magnetic beads or agarose beads to herpes simplex virus type Ⅰ DNA

[0193] 1. Methods

[0194] The sgRNAs of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were mixed as a sgRNA pool interacting with dCas9, or single SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were used as sgRNAs interacting with dCas9 respectively; a protein interacting with the ICP27 promoter (herpes simplex virus type I) was prepared by immunoprecipitation; and the binding of dCas9 to the ICP27 promoter region was verified by qPCR, as shown in the method of Examples 1-3. In this example, 15 μL of magnetic beads were used as Flag beads.

[0195] 2. Results and Conclusions

[0196] Magnetic beads are easy to operate during elution, but the nonspecific signal is too high, such as Fig.19 As shown;

[0197] Agarose beads are easy to operate and have low nonspecific signals, such as Fig. 20 As shown, agarose beads were therefore selected.

[0198] Example 7: Effect of different agarose bead dosages on the targeting of target DNA

[0199] 1. Targeting of varicella-zoster virus DNA by different agarose bead dosages

[0200] 1. Methods

[0201] The sgRNAs of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10 were mixed as the sgRNA pool interacting with dCas9; the protein (varicella zoster virus) interacting with the ORF4 promoter was prepared by immunoprecipitation; and the binding of dCas9 in the ORF4 promoter region was verified by qPCR. See the method in Example 1-3.

[0202] 2. Results

[0203] Before adjustment, the input volume of agarose beads was 15 μL. The targeting efficiency of the experimental group was good, but the signal of the control group was too high. Fig.21 As shown;

[0204] After adjustment, the input volume of agarose beads was 11 μL. The slight adjustment resulted in a significant decrease in the signal of the control group. Fig. 22 shown.

[0205] 3. Conclusion

[0206] In summary, the input amount of agarose beads was selected to be 11 μL.

[0207] 2. Targeting of different agarose beads to herpes simplex virus type Ⅰ DNA

[0208] 1. Methods

[0209] The sgRNAs of SEQ ID NO.12, SEQ ID NO.15, and SEQ ID NO.18 were mixed as a sgRNA pool interacting with dCas9; a protein (herpes simplex virus type I) interacting with the ICP27 promoter was prepared by immunoprecipitation; and qPCR was used to verify the binding of dCas9 to the ICP27 promoter region. See the method in Example 1-3.

[0210] 2. Results

[0211] Before adjustment, the input volume of agarose beads was 15 μL. The targeting efficiency of the experimental group was good, but the signal of the control group was too high. Fig.23 As shown;

[0212] After adjustment, the input volume of agarose beads was 11 μL. The slight adjustment resulted in a significant decrease in the signal of the control group. Fig.24 shown.

[0213] 3. Conclusion

[0214] In summary, the input amount of agarose beads was selected to be 11 μL.

[0215] Example 8. Comparison of the targeting efficiency of the present application and the patent with application number 202010131159.2 on HIV virus DNA

[0216] 1. Methods

[0217] SgGal4: sgRNA / dCas9 complex prepared according to Examples 1-4 of the patent application number 202010131159.2 entitled "Screening of regulated viral transcription targets by viral LTR immunoprecipitation based on Cas9-sgRNA";

[0218] SgLTR: The sgRNA used in the patent application number 202010131159.2 "Screening of regulated viral transcription targets by viral LTR immunoprecipitation based on Cas9-sgRNA" is mixed as the sgRNA pool for subsequent interaction with dCas9;

[0219] The protein interacting with LTR was prepared by immunoprecipitation according to Example 2 of the present application;

[0220] q-PCR validation of dCas9 binding in the HIV-1 LTR region was performed according to Example 3 of the present application.

[0221] 2. Results

[0222] like Fig.25 and Fig.26 As shown, the targeting efficiency of the method of the present application for HIV viral DNA is much higher than that of the patent with application number 202010131159.2, P < 0.001.

[0223] Conclusion

[0224] 1. The method of this application is also applicable to screening and regulating HIV transcription targets;

[0225] 2. The targeting efficiency of the method of this application for HIV virus DNA is greatly improved compared with the method of patent application 202010131159.2.

[0226] Example 9. Comparison of the efficiency of the present application and the patent of application number 202010131159.2 in targeting herpes virus

[0227] 1. Methods

[0228] According to the method of "Cas9-sgRNA-based viral LTR immunoprecipitation to screen for regulatory viral transcription targets" of application number 202010131159.2, varicella-zoster virus DNA was targeted to screen for new targets that regulate viral replication;

[0229] The method of the present application targets varicella-zoster virus DNA to screen for new targets for regulating viral replication, see the methods in Examples 1-3.

[0230] 2. Results

[0231] According to the method of "Cas9-sgRNA-based viral LTR immunoprecipitation screening of regulatory viral transcription targets" of application number 202010131159.2, the efficiency of targeting varicella-zoster virus DNA was very low, and the results are shown in Fig. 27 ;

[0232] The method of this application targets varicella-zoster virus DNA and is highly efficient. The results are shown in Fig.28 .

[0233] Conclusion

[0234] 1. The targeting efficiency of the method of this application for varicella-zoster DNA is greatly improved compared with the method of patent application 202010131159.2;

[0235] 2. The method of "Cas9-sgRNA-based viral LTR immunoprecipitation screening of viral transcriptional targets" with application number 202010131159.2 is not suitable for targeting varicella-zoster DNA to screen new targets for regulating viral replication due to its low efficiency.

[0236] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A method for screening proteins that regulate viral replication by targeting viral DNA, the method comprising the following steps: (1) Transfection samples; (2) Cell cross-linking; (3) Cell lysis; (4) obtaining DNA fragments by ultrasound; (5) pretreatment to remove nonspecific binding; (6) co-immunoprecipitation; (7) rinsing and removing impurities to obtain the protein product to be identified; (8) Mass spectrometry analysis.

2. The method according to claim 1, characterized in that The virus is varicella zoster virus VZV, The (1) transfection sample refers to a plasmid carrying the VZV ORF4 promoter region transfected into 293T cells, as well as an empty vector and a dCas9-sgRNA pool as a negative control group, wherein the dCas9-sgRNA pool consists of sgRNA sequences of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.10; The (2) cell cross-linking means that each sample has 8 dishes of 15 cm-dish cells. After 48 hours of transfection, the cells are fixed with 1% methanol-free formaldehyde for 15 minutes. After adding glycine for 5 minutes, the supernatant is discarded and the cells are rinsed twice with pre-cooled phosphate buffered saline (PBS). The (3) cell lysis refers to adding 2 mL of PBS containing protease inhibitors to each plate to collect cells, centrifuging the cells at 1600 rpm, and then adding sodium dodecyl sulfate SDS lysis buffer containing protease inhibitors and dithiothreitol DDT to resuspend the cells to make them uniform, and fully lyse them on ice; The (4) obtaining DNA fragments by ultrasound refers to using an ultrasound instrument to break DNA to obtain DNA fragments with a size between 200 bp and 1000 bp; after repeated centrifugation at 15000 rpm for at least 3 times, 1 mL of the fragmented DNA is taken and diluted to 3 mL; The (5) pretreatment to remove non-specific binding refers to pretreatment with protein A agarose beads proteinA beads, incubating with the sample for 2 hours to reduce non-specific binding; The (6) immunoprecipitation refers to discarding the protein A agarose beads proteinA beads and then adding 11 μL of agarose beads Flagbeads, and incubating at 4°C overnight; The (7) rinsing and removing impurities to obtain the protein product to be identified refers to repeatedly washing the agarose beads Flagbeads carrying the DNA interaction product with a rinsing solution, the rinsing sequence is low salt 11 minutes once, high salt 5 minutes once, low salt 11 minutes twice, TE 5 minutes twice, and finally washing three times with PBS, all of which are shaken at a low speed on a shaker to obtain the protein product to be identified. The mass spectrometry identification sample is directly frozen in a -80°C refrigerator; The (8) mass spectrometry analysis refers to performing mass spectrometry analysis on the protein product to be identified.

3. The method according to claim 2, characterized in that The gene names of the proteins that interact with the varicella-zoster virus VZV ORF4 promoter region include: KRT86, MIF, RNF20, AASDHPPT, DUS3L, YY1, ILKAP, FLYWCH2, YBX1, NUP50, and CPSF6.

4. The method according to claim 2, characterized in that The viruses also include herpes simplex virus type 1 HSV1, and the (1) transfection sample refers to a plasmid carrying the ICP27 promoter region of HSV1 transfected in 293T cells, as well as an empty vector and a mixed dCas9-sgRNA pool as a negative control group, wherein the dCas9-sgRNA pool consists of sgRNA sequences of SEQ ID NO.12, SEQ ID NO.15 and SEQ ID NO.

18.

5. The method according to claim 4, characterized in that The gene names of proteins that interact with the herpes simplex virus type Ⅰ HSV1 ICP27 promoter region include: H3C1, RNH1, WDR18, PAK1IP1, WARS1, PAICS, NOMO3, IRS4, CIRBP, CPNE3, and RHOC.

6. The method according to claim 2, characterized in that The virus also includes Kaposi's sarcoma-associated herpes virus KSHV, and the (1) transfection sample refers to a plasmid carrying the RTA promoter region of KSHV transfected in 293T cells, as well as an empty vector and a dCas9-sgRNA pool as a negative control group, wherein the dCas9-sgRNA pool consists of sgRNA sequences of SEQ ID NO.24, SEQ ID NO.27 and SEQ ID NO.

29.

7. The method according to claim 6, characterized in that The gene names of proteins that interact with the Kaposi's sarcoma-associated herpes virus KSHV RTA promoter region include: POLR2B, CLIC4, STAU2, PPP1CB, TPR, WARS1, IRS4, PAICS, RAB8A, NOMO3, RAB1B, and TMEM33.

8. The method according to claim 2, characterized in that The viruses also include HIV, and the (1) transfection sample refers to a plasmid carrying the LTR promoter region of HIV transfected in 293T cells, as well as an empty vector (as a negative control group), and a dCas9-sgRNA pool, which consists of sgRNA sequences of SEQ ID NO.19, SEQ ID NO.20 and SEQ ID NO.21.

Images