A method and application of eyesabsent-2 gene editing in mud crab.

CN119859633BActive Publication Date: 2026-09-11EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411993893.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-09-11
Estimated Expiration
2044-12-31

AI Technical Summary

Benefits of technology

[0013] The fertilized egg carrier mold used in this application is a self-designed mold with a length and width of 300μm. It can prepare 300μm agarose egg channels, which are suitable for fertilized eggs of mud crab cells and ensure the stability of fertilized eggs during microinjection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119859633B_ABST
    Figure CN119859633B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of Scylla paramamosain, in particular to a method for editing an eyes absent-2 gene of Scylla paramamosain and application. The application synthesizes sgRNA as shown in SEQ ID NO:1 which is targeted to the eyes absent-2 gene, then combines the sgRNA with a Cas9 protein to obtain an RNP compound, the RNP compound is introduced into a fertilized egg of a single cell stage of Scylla paramamosain in a manner of microinjection, and Scylla paramamosain F0 generation with a target gene mutation can be obtained after hatching. The application efficiently realizes editing of the gene of Scylla paramamosain, and provides an effective technical means for carrying out breeding and gene function research of Scylla paramamosain.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of Scylla paramamosain technology, specifically to a method and application for editing the eyes absent-2 gene in Scylla paramamosain. Background Technology

[0002] The mud crab (Scylla paramamosain) belongs to the class Crustacea, order Decapoda, family Portunidae, and genus Scylla. Due to its delicious taste, high nutritional value, and rapid growth, it enjoys a large consumer market and has become an important farmed crab species in my country.

[0003] CRISPR / Cas9 gene editing technology is a molecular biotechnology that has emerged in recent years for gene function research. It enables the deletion or insertion of DNA sequences at the genomic level, ultimately elucidating gene function and obtaining corresponding gene mutants. Therefore, the application of this gene editing technology in mud crabs not only helps to understand the mechanisms by which genes function in the life activities of mud crabs, but also provides an important technical means for the development of new mud crab strains and the breeding of superior mud crab varieties. Summary of the Invention

[0004] This application targets the eyes absent-2 gene (NC_087164.1(17539317..17623131)) of the mud crab. A target sgRNA sequence was designed for the first exon of this gene, and then complexed with the Cas9 protein to obtain an RNP complex. The RNP complex was then introduced into single-cell stage fertilized eggs of mud crabs via microinjection. After hatching, F0 generation mud crabs with the target gene mutation were obtained. This process was continued to breed and cultivate for multiple generations to obtain homozygous individuals with the eyes absent-2 gene mutation. This application efficiently achieves the editing of the eyes absent-2 gene in mud crabs, providing an effective technical means for breeding and gene function research in mud crabs.

[0005] In the first aspect, the embodiments disclose sgRNA targeting the eyes absent-2 gene of Scylla paramamosain, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] In an embodiment of the first aspect, the sgRNA targets the first exon of the eyes absent-2 gene.

[0007] Secondly, the embodiments disclose a gene editing composition for Scylla paramamosain eyes absent-2, which includes the sgRNA and Cas9 protein described in the first aspect.

[0008] Thirdly, the embodiments disclose a gene editing kit for Scylla paramamosain eyes absent-2, which includes the sgRNA and Cas9 protein described in the first aspect.

[0009] Fourthly, the embodiments disclose a method for editing the eyes absent-2 gene of the mud crab (Scylla paramamosain), which includes injecting an RNP complex formed by sgRNA and Cas9 protein as shown in SEQ ID NO:1 into the fertilized eggs of the mud crab in the single-cell stage.

[0010] In the fourth aspect of the embodiments, the injection concentration of the sgRNA is 250 ng / μL, and the final injection concentration of the Cas9 protein is 500 ng / μL.

[0011] In an embodiment of the fourth aspect, mutants are screened from the offspring of the mud crab.

[0012] Fifthly, the embodiments disclose the application of the sgRNA described in the first aspect in the cultivation of mutant strains of mud crab.

[0013] The fertilized egg carrier mold used in this application is a self-designed mold with a length and width of 300μm. It can prepare 300μm agarose egg channels, which are suitable for fertilized eggs of mud crab cells and ensure the stability of fertilized eggs during microinjection.

[0014] The present invention provides sgRNA, gene editing composition, kit, method, and application. Utilizing gene editing technology, sgRNA of the eyes absent-2 gene (as shown in SEQ ID NO:1) and an RNP complex formed by Cas9 protein are injected into fertilized crab cells. Following in vitro culture of the crab embryos, sequencing-verified eyes absent-2 gene-edited mutant juvenile crabs can be obtained. This method is accurate and reliable, providing an important reference for subsequent research and development of new crab strains and the breeding of superior crab varieties. Attached Figure Description

[0015] Figure 1 The design drawing of the fertilized egg carrier mold provided for the embodiment.

[0016] Figure 2 The nucleotide editing type of the eyes absent-2 gene mutant of the mud crab provided in the example. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0018] 1. Experimental materials

[0019] Wild-type mud crab broodstock, both male and female, were raised at the Zhejiang Ninghai Research Center of the East China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences. Embryos used for microinjection into mud crabs were obtained from the artificially bred eggs of sexually mature male and female broodstock.

[0020] 2. Design of sgRNA

[0021] The sgRNA shown in SEQ ID NO:1 was synthesized, and its specific sequence is as follows:

[0022] m U m C m UGCAGCGCAAGCCCUAGA GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmUmUmUU, where the underlined part is the target sequence and "m" represents methylation.

[0023] 3. Processing of fertilized eggs

[0024] Prepare a 2.5% agarose solution using enzyme-free water, and pour the still-solidified 2.5% agarose solution into a petri dish. Immediately place a square mold containing fertilized crab eggs into the petri dish with the three convex ridges facing down, and allow it to cool and solidify naturally.

[0025] 4. Treatment of sgRNA and Cas protein

[0026] Chemically synthesized eyes absent-2 gene sgRNA and commercially available Cas9 protein (UniProt, accession number Q99ZW2) were diluted with enzyme-free water to 500 ng / μL and 1000 ng / μL, respectively. They were then mixed at a volume ratio of 1:1 to obtain sgRNA and Cas9 protein with final concentrations of 250 ng / μL and 500 ng / μL, respectively. The mixtures were then incubated at 25°C for 15 minutes to form RNPs.

[0027] 5. Microinjection

[0028] handheld Figure 1The curved handle at the top of the mud crab fertilized egg carrier mold is used to pull it out of the solidified agarose gel. The agarose egg carrier is rinsed with seawater of salinity 28. After rinsing, ensuring the carrier remains in seawater of salinity 28, the mud crab 1-cell fertilized eggs are arranged in the agarose egg carrier under a stereomicroscope using a pipette and fine needle. The RNPs of the eyesabsent-2 gene are injected sequentially according to their arrangement using a microinjector, with an injection volume of 0.3 nL. After injection, the fertilized eggs are left to stand for 15 minutes before being transferred to an incubation tank for artificial culture of mud crab embryos until they develop into juvenile crabs.

[0029] 6. Parent breeding

[0030] Mutant mud crabs are bred into parent F0 generation; only by continuing to breed and cultivate them for multiple generations to obtain homozygotes with the eyes absent-2 gene mutation can a stable mutant strain be obtained.

[0031] 7. Offspring testing

[0032] Ten injected and raised juvenile crabs were randomly collected, and genomic DNA was extracted from their swimming legs using a marine animal tissue genome extraction kit.

[0033] Using genomic DNA as a template, PCR was performed using PCR target verification primers F: 5'-TGTTGAAGGCTCAGACGCAT-3' (SEQ ID NO:2) and R: 5'-CTCCCCAAAGGACCTGATCG-3' (SEQ ID NO:3). The reaction mixture consisted of 10 μL of 2×Master Mix, 0.2 μL of each primer, 1 μL of DNA template, and dd H2O to a final volume of 20 μL. The PCR cycling program was as follows: initial 95℃ for 3 min, (98℃, 10 s; 60℃, 30 s; 72℃, 30 s) × 30; final 72℃ for 10 min.

[0034] The PCR products were sequenced, and the sequencing results were compared with the wild-type eyes absent-2 gene sequence, identifying five mutant juvenile crabs. Figure 2 As shown.

[0035] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. The application of the eye absent-2 gene editing method in the breeding of mutant strains of the mud crab (Scylla serrata) includes the following steps: The RNP complex formed by sgRNA and Cas9 protein as shown in SEQ ID NO:1 was injected into the fertilized eggs of single-cell stage of Scylla serrata, and mutant strains of Scylla serrata were obtained from the offspring of the Scylla serrata. The preparation steps of the RNP complex include: mixing the sgRNA and the Cas9 protein in equal volumes and incubating them statically to obtain the RNP complex; The concentration of the sgRNA is 250 ng / μL, and the concentration of the Cas9 protein is 500 ng / μL.