Wheat plant type gene and application

By regulating the expression of QIP3 protein using the CRISPR/Cas9 system, the problems of wheat plant height regulation and spike length enhancement were solved, resulting in improved wheat yield and nitrogen use efficiency.

CN119899253BActive Publication Date: 2026-07-24INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510041240.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2026-07-24
Estimated Expiration
2045-01-10

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
Patent Text Reader

Abstract

The application discloses a wheat plant type gene and application, and belongs to the technical field of genetic engineering breeding. The technical problem to be solved by the application is how to regulate the plant height or ear type of wheat. In order to solve the above technical problem, the application provides the application of a protein or biological material related to the protein in regulating the plant height and / or ear type of a plant, wherein the protein is QIP3 protein, and the QIP3 protein can be three of the three proteins with the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, any two or any one. The application mines a candidate gene QIP3 gene affecting the plant height and / or ear length of wheat, and the plant height of a knockout strain of the QIP3 gene is significantly reduced and the ear length is significantly increased. Research on the function of the QIP3 gene and application of the QIP3 gene in wheat breeding have important significance for improving the growth traits and yield of wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of genetic engineering breeding technology, specifically involving a wheat plant type gene and its application. Background Technology

[0002] Wheat is one of the world's major food crops, providing 21% of human dietary calories and 20% of protein. Variety contributes over 40% to increasing crop yield, with the discovery and utilization of key genes playing a crucial role in improving wheat yield genetics. Green Revolution Genes Rht-B1b , Rht-D1b By significantly reducing wheat plant height, increasing the harvest index, and solving the problem of lodging, a substantial increase in yield per unit area was achieved. However, Rht-B1b , Rht-D1b Dwarf allelic variations significantly reduce grain weight and nitrogen use efficiency. Therefore, discovering new wheat dwarf genes is crucial in the field of wheat genetics and breeding.

[0003] Based on a forward genetics research strategy, the Wheat Research Center of the College of Agriculture at China Agricultural University identified a semi-dwarf locus on the short arm of chromosome 4B that synergistically enhances wheat yield and nitrogen use efficiency. This locus consists of a large deletion of approximately 500 kb, resulting in the loss of three closely linked genes. Rht-B1 / EamA-B / ZnF-B It was named the rez haplotype. (This is related to the Green Revolution gene.) Rht-B1b In comparison, the rez deletion haplotype maintained a semi-dwarf plant type, and showed significant improvements in stem strength, density tolerance, harvest index, thousand-grain weight, and yield. TaMYB30-A1 Natural variations in the promoter affect WFZP's transcriptional repression of it. TaMYB30-A1 Superior haplotypes exhibit high expression levels, increasing spike length, number of fertile spikelets, and number of grains per spike. These haplotypes were selected for during wheat domestication and breeding, and may have played a significant role in wheat variety improvement in China. Wheat yield is primarily determined by the number of spikes per acre, thousand-grain weight, and number of grains per spike. Spike structure influences the number of spikelets, number of grains per spike, and yield, making it a crucial selective trait for breeding improvement. Identifying key regulatory genes in wheat spike development is essential for molecular design and precise improvement of wheat spike structure, and for overcoming yield bottlenecks. Summary of the Invention

[0004] The technical problem this application aims to solve is: how to regulate the plant height or ear type of wheat. More specifically, the technical problem this application aims to solve is: how to reduce the plant height of wheat and / or increase the ear length of wheat.

[0005] To address the aforementioned technical problems, this application provides the use of proteins or protein-related biological materials in any of the following: A1) Application in regulating plant height; A2) Application in the preparation of products that regulate plant height; A3) Application in regulating plant spikelet type; A4) Application in the preparation of products that regulate plant spikelet type; A5) Applications in plant breeding or plant-assisted breeding; A6) Application in the preparation of plant breeding or plant-assisted breeding products; The protein is a QIP3 protein, and the QIP3 protein may be any of the following: a1) The amino acid sequences are any three, any two, or any one of the three proteins in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 respectively; a2) Proteins obtained by substituting, deleting and / or adding amino acids to the amino acid sequence of the protein shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are related to plant height and / or spike type. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0006] In this application, the protein may be derived from wheat.

[0007] In this application, SEQ ID NO:1 consists of 333 amino acids. In this application, SEQ ID NO:2 consists of 339 amino acids. SEQ ID NO:3 consists of 336 amino acids.

[0008] a3) The connection can be made via peptide bonds. Specifically, the C-terminus of the tag is dehydrated and condensed with the N-terminus of the protein in a1) or a2) to form a peptide bond.

[0009] Alternatively, the N-terminus of the tag may be linked to a peptide bond formed by the dehydration condensation of an amino acid at the C-terminus of the protein (a1) or (a2).

[0010] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0011] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0012] In this application, the regulation may be to increase, promote, or adjust.

[0013] In this application, the regulation may also be a reduction, suppression, or downregulation.

[0014] In this application, the plant type includes, but is not limited to, plant height and / or ear type.

[0015] In this application, the evaluation indicators for plant breeding include plant height and / or panicle type. The panicle type may be panicle length.

[0016] In this application, the purpose of plant breeding may be to obtain a target plant with a plant height lower than that of the parent and / or to obtain a target plant with a spike length higher than that of the parent.

[0017] In the aforementioned application, the substance that regulates the protein content may be a substance that knocks out the coding gene of the protein and / or a substance that reduces the expression of the coding gene of the protein.

[0018] In the aforementioned application, the substance that regulates the protein content can also be a substance that enhances the expression of the gene encoding the protein.

[0019] In the application described, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0020] In the application described, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be accomplished by gene knockout or gene silencing.

[0021] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence. Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0022] In this application, the substance regulating gene expression can be an agent that inhibits or reduces gene expression. The agent that inhibits or reduces gene expression can be a gene knockout agent, such as an agent that knocks out the gene through homologous recombination or an agent that knocks out the gene through CRISPR-Cas9. The agent that inhibits or reduces gene expression can contain a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0023] Furthermore, in the aforementioned applications, the biomaterial may be any of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the QIP3 protein-encoding gene; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), nucleic acid molecules encoding the QIP3 protein; B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

[0024] Furthermore, in the aforementioned applications, B1) the nucleic acid molecule may be an RNA molecule whose target site nucleotide sequence is SEQ ID NO:7 and / or SEQ ID NO:8, or DNA encoding the RNA molecule.

[0025] Furthermore, in the aforementioned application, the nucleic acid molecule described in B8) may be a DNA molecule as described in any of the following: g1) The coding sequence of the coding strand is a DNA molecule with SEQ ID NO:4, 5 or 6; g2) DNA molecules whose nucleotide sequence of the coding strand has reference sequence numbers TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500. g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1 or g2, and that regulates plant height and / or spike type.

[0026] Furthermore, in the aforementioned applications, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0027] Furthermore, in the aforementioned applications, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0028] Furthermore, in the aforementioned applications, the transgenic plant organs may be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0029] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0030] This application also provides a method for regulating plant height and / or panicle type, the method comprising regulating plant height and / or panicle type of the recipient plant by regulating the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant.

[0031] Furthermore, the method includes reducing the plant height and / or increasing the spike length of the recipient plant by reducing the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant, wherein the recipient plant contains the encoding gene.

[0032] Furthermore, the method reduces the expression level of the QIP3 protein encoding gene and / or the content of the QIP3 protein in the recipient plant by knocking out the QIP3 protein encoding gene in the recipient plant.

[0033] This application also provides a method for preparing target plants with reduced plant height and / or increased ear length, the method comprising obtaining target plants with lower plant height and / or higher ear length by reducing the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant.

[0034] Furthermore, in the method, the encoding gene is a DNA molecule as described in any of the following: g1) The coding sequence of the coding strand is a DNA molecule with SEQ ID NO:4, 5 or 6; g2) DNA molecules whose nucleotide sequence of the coding strand has reference sequence numbers TraesCS2A02G286900, TraesCS2B02G303900 or TraesCS2D02G285500. g3) is a DNA molecule that has more than 80% identity with any of the DNA molecules described in g1 or g2, and that regulates plant height and / or spike type.

[0035] In this application, the plant or recipient plant may be selected from monocotyledonous plants.

[0036] In this application, the monocotyledonous plant may be selected from grasses.

[0037] In this application, the grass plant may be selected from plants of the genus Triticum.

[0038] In this application, the wheat species may be selected from wheat ( Triticum aestivum L.).

[0039] Furthermore, in the method, reducing the expression level of the gene encoding QIP3 protein and / or the content of QIP3 protein in the recipient plant is achieved by any one of the following M1) to M4): M1) By knocking out the gene encoding the QIP3 protein in the recipient plant using a genome editing system, the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant are reduced; Furthermore, the genome editing system is a CRISPR / Cas system; Furthermore, the CRISPR / Cas system can express gRNA targeting the gene encoding the QIP3 protein and the effector protein of the CRISPR / Cas system: the Cas9 protein; Furthermore, the target nucleotide sequence of the gRNA is SEQ ID NO:7 and / or SEQ ID NO:8; M2) Mutate any one, two, or three of the following mutations in the gene of the recipient plant (M21)-M23), wherein the plant is wheat: M21) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 is knocked out by deleting cytosine deoxyribonucleotide (C) at position 698. M22) A thymine deoxyribonucleotide (T) was inserted between positions 764 and 765 of the QIP3-2B gene in the recipient wheat with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene. M23) A single adenine deoxyribonucleotide (A) was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0040] M3) Mutate any one, two, or three of the following mutations in the gene of the recipient plant, wherein the plant is wheat: M31) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 is knocked out by deleting guanine deoxyribonucleotide (G) at position 697. M32) A single adenine deoxyribonucleotide (A) was inserted between positions 764 and 765 of the QIP3-2B gene in the recipient wheat with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene. M33) A cytosine deoxyribonucleotide (C) was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0041] M4) Mutate any one, two, or three of the following M41)-M43) mutations in the genes of the recipient plant, wherein the plant is wheat: M41) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 is knocked out by deleting four deoxyribonucleic acid (TTTG) positions from 694 to 697. M42) The QIP3-2B gene in the recipient wheat reference sequence TraesCS2B02G303900 is knocked out by deleting two deoxyribonucleotides (CT) at positions 462 to 463, and inserting a thymine deoxyribonucleotide (T) between positions 764 and 765 in TraesCS2B02G303900. M42) A thymine deoxyribonucleotide (T) was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0042] This application also provides proteins or compositions comprising said proteins, wherein said proteins are any three, any two, or any one of the three proteins whose amino acid sequences are respectively SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3.

[0043] This application also provides biomaterials related to the protein or a composition containing the protein, as shown in B1) to B9) above.

[0044] This application also provides a composition for genome editing. The composition is the genome editing system described above.

[0045] Furthermore, the genome editing system is a CRISPR / Cas system.

[0046] Furthermore, the CRISPR / Cas system can express gRNA encoding the gene that targets the QIP3 protein and the effector protein of the CRISPR / Cas system: the Cas9 protein.

[0047] Furthermore, the target nucleotide sequence of the gRNA is SEQ ID NO:7 and / or SEQ ID NO:8.

[0048] In this application, "editing" or "genome editing" means using targeted genome editing technology to produce a targeted mutation, deletion, inversion, or substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 1000, at least 2500, at least 5000, or at least 10,000 nucleotides of endogenous plant genome nucleic acid sequence.

[0049] In this application, “editing” or “genome editing” also covers the use of targeted genome editing technology to target and insert or site-specifically integrate at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 75, at least 100, at least 250, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 4000, at least 5000, or at least 10,000 nucleotides into the endogenous genome of a plant.

[0050] In this application, a “target site” for genome editing refers to a location within a plant genome of a polynucleotide sequence that is targeted and cleaved by a site-specific nuclease, thereby introducing a double-strand break (or single-strand nick) into the nucleic acid backbone and / or its complementary DNA strand. The site-specific nuclease may bind to the target site, for example, via a non-coding guide RNA (e.g., but not limited to CRISPR RNA (crRNA) or single-strand guide RNA (sgRNA)). The non-coding guide RNA provided herein may be complementary to the target site (e.g., complementary to the strand of a double-stranded nucleic acid molecule or the chromosome of the target site). A “target site” also refers to a location within the plant genome of a polynucleotide sequence that is bound and cleaved by another site-specific nuclease, which may not be guided by a non-coding RNA molecule, such as a broad-spectrum nuclease, zinc finger nuclease (ZFN), or transcription activator-like effector nuclease (TALEN), to introduce a double-strand break (or single-strand nick) into the polynucleotide sequence and / or its complementary DNA strand.

[0051] In this application, the term "guide RNA" or "gRNA" is a short RNA sequence comprising (1) a structural or scaffold RNA sequence required to bind or interact with RNA-guided nucleases and / or other RNA molecules (e.g., tracrRNA), and (2) an RNA sequence that is identical or complementary to a target sequence or target site (referred to herein as the "guide sequence"). A "single-stranded guide RNA" (or "sgRNA") is an RNA molecule comprising tracrRNA and crRNA covalently linked by a linker sequence, which may be expressed as a single RNA transcript or molecule. Guide RNA comprises a guide or target sequence ("guide sequence") that is identical or complementary to a target site within the plant genome, for example at or near a GA oxidase gene. An interstitial sequence adjacent motif (PAM) may be present immediately adjacent to the 5' end of a genomic target site sequence complementary to the target sequence of the guide RNA and upstream of it in the genome, i.e., downstream (3') of the sense (+) strand immediately adjacent to the genomic target site (relative to the target sequence of the guide RNA), as is known in the art. The genomic PAM sequence (relative to the target sequence of the guide RNA) on the sense (+) strand adjacent to the target site may contain 5'-NGG-3'. However, the corresponding sequence of the guide RNA (i.e., immediately downstream (3') of the target sequence of the guide RNA) is typically not complementary to the genomic PAM sequence. The guide RNA can usually be a non-coding RNA molecule that does not encode a protein.

[0052] In this application, "RNA-directed nuclease" refers to RNA-directed DNA endonucleases associated with the CRISPR system. Non-restricted examples of RNA-directed nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, their homologs or modified forms thereof. In one embodiment, the RNA-directed nuclease is Cas9. In another embodiment, the RNA-directed nuclease comprises N-terminal and C-terminal nuclear localization sequences (NLS).

[0053] In some embodiments of this application, the composition for genome editing may be co-delivered with a DNA molecule containing a selection or screening marker gene.

[0054] Furthermore, the Cas9 protein described in this application is not limited to a specific protein, as long as it can be used in conjunction with the gRNA or sgRNA described in this application. Furthermore, the Cas9 protein described herein is selected from Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9HF (high fidelity), nickase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9), and Treponema pallidum Cas9, as well as orthologs of Cas9 from other organisms, but not limited to these. The Cas9 protein may also include high-fidelity Cas9 mutants (such as SpCas9-HF1, eSpCas9-1.1, and TrueCut™ HiFiCas9 protein).

[0055] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0056] The aforementioned 90% or higher degree of identity can be interpreted as 90% or 95% or higher degree of identity.

[0057] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0058] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or more identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0059] The beneficial technical effects achieved by this application are as follows: Plant height and spike type are important factors directly affecting wheat growth traits and yield. This application identifies a candidate gene that influences wheat plant height and / or spike length; its knockout lines show significantly reduced plant height and significantly increased spike length. Studying the function of QIP3 and applying it in wheat breeding is of great significance for improving wheat growth traits and yield. Attached Figure Description

[0060] Figure 1 Sequencing results and phenotypic validation of the QIP3 gene-edited lines. (a) Nucleotide sequence of the target site of the QIP3 gene double knockout and genotype of the homozygous mutant line. (b) Plant height phenotype of the QIP3 gene-edited line and Fielder. (c) Ear type (ear length) phenotype of the QIP3 gene-edited line and Fielder. (d) Statistical results of plant height and significant difference analysis of the QIP3 gene-edited line and Fielder. (e) Statistical results of ear type (ear length) and significant difference analysis of the QIP3 gene-edited line and Fielder.

[0061] Figure 2 This is a structural diagram of the 964bp PCR product from Example 1. Detailed Implementation

[0062] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0063] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0064] The pBUE411 and pCBC-MT1T2 vectors in the following examples are described in the following literature: He, G., Zhang, Y., Liu, P., Jing, Y., Zhang, L., Zhu, Y. et al. (2021) The transcription factor TaLAX1 interacts with Q to antagonistically regulate grainthreshability and spike morphogenesis in bread wheat. New phytologist, 230, 988-1002.

[0065] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0066] The following examples use Excel statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used, and ** indicates that there is a significant difference (P < 0.01).

[0067] Example 1: Functional verification of the QIP3 gene and its encoded protein We identified a wheat spike-type regulatory protein QIP3 through yeast two-hybrid screening. Based on the chromosomal distribution of the coding gene for QIP3, it was divided into three subgenomes, named QIP3-2A, QIP3-2B, and QIP3-2D.

[0068] The reference sequence number for the QIP3-2A gene in EnsemblPlants is TraesCS2A02G286900, located at Chromosome 2A: 488841530-488853598.

[0069] The reference sequence number for the QIP3-2B gene in EnsemblPlants is TraesCS2B02G303900, located at Chromosome 2B: 431523309-431536849.

[0070] The reference sequence number for the QIP3-2D gene in EnsemblPlants is TraesCS2D02G285500, located at Chromosome 2D: 363322221-363334390.

[0071] The genome sequence lookup results are from EnsemblPlants (Ensembl Plants release 60 - October 2024 ©EMBL-EBI), URL: https: / / plants.ensembl.org / Triticum_aestivum / Info / Index.

[0072] The coding sequences of the three alleles of the QIP3 gene, QIP3-2A, QIP3-2B, and QIP3-2D, and the sequences of their encoded proteins are as follows: The coding region (CDS) nucleotide sequence of the QIP3-2A gene is shown in SEQ ID NO:4, and it encodes a protein with the amino acid sequence shown in SEQ ID NO:1, the protein being named QIP3-2A.

[0073] The coding region (CDS) nucleotide sequence of the QIP3-2B gene is shown in SEQ ID NO:5, and it encodes a protein with the amino acid sequence shown in SEQ ID NO:2, the protein being named QIP3-2B.

[0074] The coding region (CDS) nucleotide sequence of the QIP3-2D gene is shown in SEQ ID NO:6, and it encodes a protein with the amino acid sequence shown in SEQ ID NO:3, the protein being named QIP3-2D.

[0075] 1.1 Construction of QIP3 gene editing vector To validate the function of the QIP3 gene, we constructed the QIP3-2A / 2B / 2D (TraesCS2A02G286900 / TraesCS2B02G303900 / TraesCS2D02G285500) CRRISPR / Cas9 gene editing vector. Due to the high homology among the three genes, we designed a dual CRISPR / Cas9 target targeting the conserved sequence of the QIP3 gene. The nucleotide sequences of the designed sgRNA target sites are shown below: sgRNA1 target site: 5'-GCCGGCGTCAACGCTCTGA-3' (SEQ ID NO:7), sgRNA2 target site: 5'-GACATCGATCTCTTTGCGG-3' (SEQ ID NO:8).

[0076] The target sites of sgRNA1 are located on the QIP3-2A, QIP3-2B, and QIP3-2D genes; the target sites of sgRNA2 are also located on the QIP3-2A, QIP3-2B, and QIP3-2D genes; by using sgRNA1 and sgRNA2 as dual targets to target the QIP3-2A, QIP3-2B, and QIP3-2D genes, the QIP3-2A, QIP3-2B, and QIP3-2D genes (also known as the QIP3-2A / 2B / 2D genes) can be knocked out using the CRISPR / Cas9 system.

[0077] Based on the target sites of sgRNA1 and sgRNA2, the PCR amplification primer sequences (5' to 3') are designed as follows.

[0078] QIP3-F: aataatggtctcAGGCGGCCGGCGTCAACGCTCTGA; QIP3-R: ATTATTGGTCTCTAAAACCCGCAAAGAGATCGATGTC; QIP3-F0: gGCCGGCGTCAACGCTCTGAgttttagagctagaaatagc; QIP3-R0: CCGCAAAGAGATCGATGTCCGCTTCTTGGTGCC.

[0079] The gene editing vector construction process is as follows: 1) PCR amplification Dissolve and mix the four primers mentioned above, with the concentrations of QIP3-F / R primers being 10 µM and QIP3-F0 / R0 primers being 0.5 µM. The PCR reaction system is as follows: 47 µL of KOD Plus PCR reaction solution (which can be premixed), 2 µL of the four-primer mixture, 1 µL of pCBC-DT1T2 (diluted 100-fold), for a final volume of 50 µL. The KOD Plus PCR reaction solution consists of: 5 µL of KOD Plus buffer, 5 µL of 2 mM dNTP, 5 µL of 25 mM MgSO4, and 1 µL of KOD-Plus.

[0080] The PCR reaction conditions were as follows: 94℃, 2 min pre-denaturation; (94℃ 5 s; 60℃ 30 s; 68℃, 1 min) 30 cycles; 68℃, 6 min.

[0081] 2) Enzyme digestion and ligation The PCR product fragment (964 bp) was recovered, and its nucleotide sequence is SEQ ID NO:9. Its structure is as follows: Figure 2 As shown. In SEQ ID NO:9, positions 18 to 36 are the target nucleotide sequences of sgRNA1, and positions 929 to 947 are the target nucleotide sequences of sgRNA2.

[0082] The PCR product fragment was digested with BsaI and ligated to the pBUE411 vector using T4 Ligase. The digestion-ligation reaction system was as follows: PCR fragment (964-bp) 2µL, pBUE411 2µL, 10×NEB T4 Buffer 1.5µL, 10×BSA 1.5µL, BsaI (NEB) 1µL, T4 Ligase (NEB) 1µL, ddH2O 6µL, total system volume 15µL.

[0083] The recombinant vector pBUE411-QIP3 contains expression cassettes for two sgRNAs and one Cas9 protein. It can express sgRNA1 (SEQ ID NO:7), sgRNA2 (SEQ ID NO:2), and the CRISPR / Cas9 effector protein Cas9. After introduction into the receptor, the two transcribed guide RNAs (sgRNA1 and sgRNA2) target sequences near the PAM region of the receptor genome through base complementarity, specifically targeting the QIP3-2A, QIP3-2B, and QIP3-2D genes. The Cas9 protein causes double-strand breaks in the DNA at the target sites of these genes. Through the organism's own DNA damage repair mechanism, gene mutations occur in the cleaved regions during repair, thereby knocking out the QIP3-2A, QIP3-2B, and QIP3-2D genes.

[0084] 1.2 Preparation of gene-edited homozygous lines The recombinant vector pBUE411-QIP3 was transformed into the recipient wheat Fielder using conventional Agrobacterium-mediated transformation methods, resulting in multiple transformation events. Gene-editing-positive lines were screened and self-crossed three times consecutively. After PCR sequencing identification, three homozygous gene-edited lines c (QIP3-2A / 2B / 2D) were obtained. Figure 1 In (a), they are named qip3-1, qip3-2, and qip3-3 respectively.

[0085] Sequencing results show that: (1) Compared to wild-type wheat Fielder, in the qip3-1 mutant: The following changes occurred in the QIP3-2A genome on two homologous chromosomes of wheat: the cytosine deoxyribonucleotide (C) at position 698 of the QIP3-2A gene with reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the QIP3-2B genome on two homologous chromosomes of wheat: a thymine deoxyribonucleotide (T) was inserted between positions 764 and 765 of the QIP3-2B gene with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the QIP3-2D genome on two homologous chromosomes of wheat: an adenine deoxyribonucleotide (A) was inserted between positions 672 and 673 of the QIP3-2D gene with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0086] (2) Compared to wild-type wheat Fielder, in the qip3-2 mutant: The following changes occurred in the QIP3-2A genome on two homologous chromosomes of wheat: the guanine deoxyribonucleotide (G) at position 697 of the QIP3-2A gene with reference sequence number TraesCS2A02G286900 was deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the QIP3-2B genome on two homologous chromosomes of wheat: an adenine deoxyribonucleotide (A) was inserted between positions 764 and 765 of the QIP3-2B gene with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the QIP3-2D genome on two homologous chromosomes of wheat: a cytosine deoxyribonucleotide (C) was inserted between positions 672 and 673 of the QIP3-2D gene with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0087] (3) Compared to wild-type wheat Fielder, in the qip3-3 mutant: The following changes occurred in the QIP3-2A genome on two homologous chromosomes of wheat: four deoxyribonucleic acid (TTTG) nucleotides from position 694 to 697 of the QIP3-2A gene with reference sequence number TraesCS2A02G286900 were deleted, thereby knocking out the QIP3-2A gene; The following changes occurred in the QIP3-2B genome on two homologous chromosomes of wheat: two deoxyribonucleotides (CT) were deleted at positions 462 to 463 of the QIP3-2B gene with reference sequence number TraesCS2B02G303900, and a thymine deoxyribonucleotide (T) was inserted between positions 764 and 765 of TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; The following changes occurred in the QIP3-2D genome on two homologous chromosomes of wheat: a thymine deoxyribonucleotide (T) was inserted between positions 672 and 673 of the QIP3-2D gene with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

[0088] 1.3 Phenotypic Identification of QIP3 Gene-Edited Wheat Materials Phenotypic validation was conducted in spring planting at the experimental wheat field within the Chinese Academy of Agricultural Sciences, with a growth cycle from March to July 2024. The experiment employed row planting, with each line planted in 5 rows, 10 plants per row, a row spacing of 30 cm, and a plant spacing of 10 cm, with a total of three replicates.

[0089] Plant height and ear length were measured and statistically analyzed for each line at maturity. Twelve plants from each line were randomly selected for measurement, and the results were averaged. The results showed that the gene-edited lines exhibited superior agronomic traits of reduced plant height and increased ear length. Phenotypic data and statistical statistics for each line are shown below. Figure 1 These results indicate that QIP3 gene-edited wheat materials have the potential to increase wheat yield.

[0090] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The application of protein-related biomaterials in any of the following: A1) Application in reducing plant height; A2) Application in the preparation of products that reduce plant height; A3) Application in increasing plant spike length; A4) Application in the preparation of products that increase plant spike length; A5) Applications in plant breeding or plant-assisted breeding; A6) Application in the preparation of plant breeding or plant-assisted breeding products; The purpose of the plant breeding is to obtain target plants with a plant height lower than the parent plants and / or to obtain target plants with a spike length higher than the parent plants; The protein is a QIP3 protein, and the QIP3 protein is any of the following: a1) Three proteins with amino acid sequences of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1); The biomaterial is any one of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the QIP3 protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); The plant in question is wheat.

2. The application according to claim 1, characterized in that, B1) The nucleic acid molecule is an RNA molecule whose target site nucleotide sequence is SEQ ID NO:7 and / or SEQ ID NO:8, or DNA encoding the RNA molecule.

3. A method for reducing plant height and / or increasing spike length, characterized in that, The method includes reducing the plant height and / or increasing the spike length of the recipient plant by reducing the expression level of the gene encoding the QIP3 protein of claim 1 and / or the content of the QIP3 protein in the recipient plant, wherein the recipient plant contains the gene encoding the QIP3 protein; the plant is wheat.

4. The method according to claim 3, characterized in that, The expression level of the QIP3 protein encoding gene and / or the content of QIP3 protein in the recipient plant are reduced by knocking out the QIP3 protein encoding gene in the recipient plant.

5. A method for preparing a target plant with reduced plant height and / or increased ear length, the method comprising obtaining a target plant with a plant height lower than and / or an ear length higher than that of the recipient plant by reducing the expression level of the gene encoding the QIP3 protein of claim 1 and / or the content of the QIP3 protein in the recipient plant; wherein the plant is wheat.

6. The method according to claim 3 or 5, characterized in that, The coding genes are DNA molecules whose coding sequences are SEQ ID NO:4, 5 and 6, respectively.

7. The method according to any one of claims 3 to 5, characterized in that, Reducing the expression level of the gene encoding QIP3 protein and / or the content of QIP3 protein in recipient plants can be achieved by any of the following methods (M1) to (M4): M1) By knocking out the gene encoding the QIP3 protein in the recipient plant using a genome editing system, the expression level of the gene encoding the QIP3 protein and / or the content of the QIP3 protein in the recipient plant are reduced; M2) Introduce any one, two, or three of the following mutations into the genes in the recipient plant: M21)-M23) M21) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 was knocked out by deleting cytosine deoxyribonucleotide at position 698. M22) A thymine deoxyribonucleotide was inserted between positions 764 and 765 of the QIP3-2B gene in the recipient wheat with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene. M23) A single adenine deoxyribonucleotide was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene. M3) Introduce any one, two, or three of the following mutations into the genes in the recipient plant: M31)-M33) M31) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 is knocked out by deleting guanine deoxyribonucleotide at position 697. M32) An adenine deoxyribonucleotide was inserted between positions 764 and 765 of the QIP3-2B gene in the recipient wheat with reference sequence number TraesCS2B02G303900, thereby knocking out the QIP3-2B gene; M33) A cytosine deoxyribonucleotide was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene; M4) Introduce any one, two, or three of the following mutations into the genes in the recipient plant: M41)-M43) M41) The QIP3-2A gene in the recipient wheat with reference sequence number TraesCS2A02G286900 is knocked out by deleting four deoxyribonucleotides from positions 694 to 697. M42) The QIP3-2B gene in the recipient wheat reference sequence number TraesCS2B02G303900 is knocked out by deleting two deoxyribonucleotides at positions 462 to 463, and inserting a thymine deoxyribonucleotide between positions 764 and 765 in TraesCS2B02G303900. M43) A thymine deoxyribonucleotide was inserted between positions 672 and 673 of the QIP3-2D gene in the recipient wheat with reference sequence number TraesCS2D02G285500, thereby knocking out the QIP3-2D gene.

8. The method according to claim 7, characterized in that, The genome editing system is the CRISPR / Cas system.

9. The method according to claim 8, characterized in that, The CRISPR / Cas system can express gRNA encoding the gene that targets the QIP3 protein and the effector protein of the CRISPR / Cas system: the Cas9 protein.

10. The method according to claim 9, characterized in that, The target nucleotide sequence of the gRNA is SEQ ID NO:7 and / or SEQ ID NO:8.