SNP (Single Nucleotide Polymorphism) molecular marker related to fertility rate of 52-week-old pigeons as well as application and breeding method

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the fertility rate of pigeons at 52 weeks old as well as application and a breeding method of the SNP molecular marker, the molecular marker is located at the 5476830th basic group of the 15th chromosome of a pigeon reference genome colLiv2, C / T polymorphism exists, and based on genotype discovery of the specific SNP molecular marker, the specific SNP molecular marker can be used for identifying the fertility rate of pigeons at 52 weeks old. The fertilization rate of the pigeons with the 52-week age is remarkably higher than that of C / T genotype individuals and T / T genotype individuals, in breeding, the C / T genotype individuals and the T / T genotype individuals are eliminated, and the C / C genotype individuals are reserved, so that early selection of the fertilization rate of the pigeons with the 52-week age can be realized, the breeding accuracy is improved, the breeding progress is accelerated, the breeding cost is saved, and the breeding effect is improved.

Description

Technical Field

[0001] The present invention relates to the field of pigeon genetic breeding, and in particular to a SNP molecular marker associated with the fertilization rate of pigeons at 52 weeks of age, application of the SNP molecular marker, and a breeding method for improving the fertilization rate of pigeons at 52 weeks of age by using the SNP molecular marker at base position 5476830 of chromosome 15 of the pigeon reference genome colLiv2. Background Art

[0002] The fertilization rate of pigeons at 52 weeks of age refers to the percentage of fertilized eggs to the total number of eggs laid when the pigeons reach 52 weeks of age (i.e. 1 year old). The fertilization rate is an important indicator to measure the reproductive capacity of pigeons. A high fertilization rate means that more fertilized eggs can successfully hatch small pigeons, thereby improving reproductive efficiency. In pigeon farming, the fertilization rate is one of the important directions for pigeon breed improvement and new breed breeding. Traditional breeding technology has problems such as slow genetic progress and long generation cycle, and it is difficult to achieve precise breeding. With the development of molecular biotechnology, molecular marker-assisted selection technology has been widely used in the field of animal breeding and new breed breeding. The use of molecular marker-assisted selection technology can achieve early selection of target traits and improve selection accuracy, thereby accelerating the breeding progress, saving breeding costs, and improving breeding efficiency.

[0003] At present, there are patents for molecular markers related to pigeon fertilization rate, such as LECT2 (CN 118460737B) and CEPU-1 (CN 118460739 A) gene molecular markers. The protein product encoded by the nuclear receptor corepressor 2 (NCOR2) gene is a component of a multi-subunit complex that can bind to a variety of transcription factors to regulate the transcriptional activity of target genes. It works by recruiting class I and class IIa histone deacetylases (HDAC) to gene targets and is particularly effective in inhibiting the differentiation of primordial germ cell-like cells. Scavenger receptor class B member 1 (SCARB1) mediates selective lipid uptake and plays a key role in reverse cholesterol transport. Its expression level in supporting cells changes with the spermatogenic cycle. At present, there are no reports on the correlation between NCOR2 and SCARB1 genes and pigeon fertilization rate. Summary of the invention

[0004] One of the purposes of the present invention is to provide a SNP molecular marker associated with the fertilization rate of pigeons at 52 weeks of age, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1 or SEQ ID NO: 2:

[0005] SEQ ID NO:1

[0006] AGGGGTTTGAGCAGTTTCCCCTCTGACAGCCCGGACAGTGAGCCAAAAAATGACTCTGACACTGGAATCCTTCTTGGTTGAATCATTTGAATTTCCTGCTAATTTGGAAAAAATTT GTTAAAATTGAGTGTGCCTTGAAATAGCAACAATTTCAAGTAAGGGGGAACAACTGCACCTACACTGAATCACGGGCACTGTGCAAATTACACAAACCCCTCGTTTGTCCCAG C AATTAAATCTCCATCAACACTAGAATCAATCTGCAGAGCTGCTCTCCCTCCCGGCCGCGCTTGTAAAACTCCCACCCAACAACTCCCATAGCCCAACGCTGCTCTTTTTGTT AGTGACATTTCAGGGGTTTTTTAGGATGTGACATATAAAAGAGCAGCGACAACGAAGGAGGTGAGCGGCACAAGAAGCCAATTCCAGATCCTGAGTGAGCAGAATGAATAGT TCTTCAGGAAAGAAAAAGAAATCTAATCAAGAACTTTTCCATTCTTCCCTTTTTCTTTTTTTAACAAGGAGGGTATGTGATACATATAGTCTCAAAAGGATTTA CTAGACACTGCTGTGACTAAGGCAAGATGTAATTAGAAGGGGAGGAACATTTTATCATTTGCCAGAGTGAATTAGGTATTTCAACTTCTCAAAAGAATCGAGCGCAGAGGGT

[0007] SEQ ID NO:2

[0008] AGGGGTTTGAGCAGTTTCCCCTCTGACAGCCCGGACAGTGAGCCAAAAAATGACTCTGACACTGGAATCCTTCTTGGTTGAATCATTTGAATTTCCTGCTAATTTGGAAAAAATTT GTTAAAATTGAGTGTGCCTTGAAATAGCAACAATTTCAAGTAAGGGGGAACAACTGCACCTACACTGAATCACGGGCACTGTGCAAATTACACAAACCCCTCGTTTGTCCCAG TAATTAAATCTCCATCAACACTAGAATCAATCTGCAGAGCTGCTCTCCCTCCCGGCCGCGCTTGTAAAACTCCCACCCAACAACTCCCATAGCCCAACGCTGCTCTTTTTGTTAGTGACATTTCAGGGGTTTTTTAGGATGTGACATATAAAAGAGCAGCGACAACGAAGGAGGTGAGCGGCACAAGAAGCCAATTCCAGATCCTGAGTGAGCAGAATGAATAGT TCTTCAGGAAAGAAAAAGAAATCTAATCAAGAACTTTTCCATTCTTCCCTTTTTTTCTTATTTTTTAAACAAGGAGGGTATGTGATACATATAGTCTCAAAAGGAGATTTACTAGACACTGCTGTGACTAAGGCAAGATGTAATTAGAAGAGGGGAGGAACATTTATCATTTGCCAGAGTGAATTAGGTATTTCAACTTCTCAAAAGAATCGAGCGCAGAGGGT

[0009] The difference between the above two nucleotide sequences is that the 231st base is C or T, that is, the C / T polymorphism at the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2.

[0010] Preferably, the pigeon is a white Canuck male pigeon.

[0011] Another object of the present invention is to provide the application of the above-mentioned SNP molecular marker for detecting the fertilization rate of pigeons at 52 weeks of age.

[0012] Preferably, the detection comprises the following steps:

[0013] Step S1: performing PCR amplification on the pigeon DNA sample to be tested to obtain an amplification product;

[0014] Step S2: sequencing the amplified product;

[0015] Step S3: Determine the SNP molecular marker genotype based on the sequencing peak graph, and determine the fertilization rate of pigeons at 52 weeks of age.

[0016] Preferably, in step S1, the reaction system of the PCR amplification is calculated as 20 μl:

[0017] 60ng of pigeon DNA to be tested,

[0018] 2×Es Taq MasterMix 10μl,

[0019] 10 μM upstream primer F 1 μl,

[0020] 10 μM downstream primer R 1 μl,

[0021] Make up to 20 μl with sterile water;

[0022] The sequence of the upstream primer F is shown in SEQ ID NO: 3, and the sequence of the downstream primer R is shown in SEQ ID NO: 4:

[0023] SEQ ID NO:3

[0024] AGGGGTTTGAGCAGTTTCCC;

[0025] SEQ ID NO:4

[0026] ACCCTCTGCGCTCGATTCTT;

[0027] The reaction conditions of the PCR amplification are pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; extension at 72°C for 10 minutes; and storage at 4°C.

[0028] Further, in step S3, the judgment criterion is that the 52-week-old fertilization rate of pigeons with a C / C genotype at the 231st base of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is significantly higher than that of C / T genotype individuals and T / T genotype individuals; or the 52-week-old fertilization rate of pigeons with a C / C genotype at the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2 is significantly higher than that of C / T genotype individuals and T / T genotype individuals.

[0029] Furthermore, in step S3, the judgment criterion is that the 52-week-old fertilization rate of pigeons with a C / T genotype at the 231st base of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is higher than that of individuals with a T / T genotype; or the 52-week-old fertilization rate of pigeons with a C / T genotype at the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2 is higher than that of individuals with a T / T genotype.

[0030] The third object of the present invention is to provide a breeding method for improving the fertilization rate of pigeons at 52 weeks of age, by detecting the genotype of the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2, retaining individuals with C / C genotype and C / T genotype and eliminating individuals with T / T genotype.

[0031] Furthermore, individuals with the C / C genotype at base 5476830 of chromosome 15 of the pigeon reference genome colLiv2 were retained, while individuals with the C / T genotype were eliminated.

[0032] The present invention uses whole genome resequencing technology to perform SNP genotyping, and for the first time identifies molecular markers related to the fertilization rate of pigeons at 52 weeks of age. Based on the genotype of specific SNP molecular markers, it is found that the fertilization rate of C / C genotype pigeons during 52 weeks of age is significantly higher than that of C / T genotype individuals and T / T genotype individuals. By using the genomic DNA of the pigeon to be tested as a template, using a specific primer pair for PCR amplification, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the fertilization rate of pigeons can be selected based on the genotype of the SNP molecular marker. In breeding, by eliminating C / T genotype individuals and T / T genotype individuals and retaining C / C genotype individuals, early selection of the fertilization rate at 52 weeks of age can be achieved, while improving the accuracy of seed selection, accelerating the breeding progress, saving breeding costs, and improving the breeding effect, so as to better serve the breeding of pigeons and the cultivation of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the result of genome-wide association analysis of fertilization rate in pigeons at 52 weeks of age;

[0034] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0035] Example 1 Screening of SNP sites

[0036] 70 pairs of white Kanu pigeons with relatively consistent age were selected and raised under the same feeding conditions, with free diet and drinking water, natural incubation and feeding. After being paired in cages at 5-6 months of age, all the breeding egg data during 52 weeks were collected, and the average fertilization rate was calculated as phenotypic data. According to the average fertilization rate, they were divided into two groups, the average fertilization rate of the high fertilization rate group was 0.98±0.03, and the average fertilization rate of the low fertilization rate group was 0.43±0.25.

[0037] DNA was extracted from the above samples using the TIANamp genomic kit (TIANGEN, Beijing, China). TM One spectrophotometer to detect sample purity; Qubit Flurometer was used to detect the concentration of DNA samples; 1% agarose electrophoresis was used to detect the integrity of DNA samples. After the samples were tested, the library was constructed according to the instructions of MGIEasy Fast Enzyme Library Preparation Kit V2.0 (MGI, Shenzhen, China). First, the qualified DNA samples were cut and interrupted, followed by end repair and adapter connection. The target fragments were enriched and purified by PCR to obtain the sequencing library. The library that passed the quality control was circularized, and then DNA nanoballs (DNBs) were prepared by rolling circle amplification (RCA) technology, and then DNBs were loaded onto the sequencing chip by the fully automatic sample loading system. Finally, DNBSEQ-T7 (MGI, Shenzhen, China) was used for sequencing to obtain 150bp double-end sequencing reads.

[0038] After quality control of the sequencing data, SNP annotation is performed by comparing with the reference genome. Genome-wide association analysis detects common genetic variations (single nucleotide polymorphisms, copy number variations, and structural variations, etc.) across the entire genome, and then performs association analysis between the obtained genotypes and the observed trait phenotypes. Individual kinship and population structure are the main factors causing false positive associations during GWAS analysis. In order to reduce false positive association results, a mixed linear model (MLM) is used for trait association analysis, with population genetic structure as a fixed effect and individual kinship as a random effect to correct the effects of population structure and individual kinship on the results. The mixed linear model (MLM) used in GWAS analysis is:

[0039] y=Xα+Zβ+Wμ+e, y is the phenotypic trait, X is the indicator matrix of fixed effects, a is the estimated parameter of fixed effects; Z is the indicator matrix of SNPs, β is the effect of SNPs; W is the indicator matrix of random effects, μ is the predicted random individual, e is the random residual, and it obeys e~(0,σ e 2 ).

[0040] GEMMA was used to calculate the Kinship matrix, and the first three PCA components were selected as covariates for association analysis. Potential candidate SNP sites were screened out through the significance of the association (P-value). The results are as follows: Figure 1 As shown. Figure 1It can be seen that the candidate SNP sites with P values ​​less than the threshold are located on chromosomes 8, 15 and 19, respectively. The SNP gene frequencies of the high fertilization rate group and the low fertilization rate group are calculated, and the target SNP site is determined according to the gene frequency difference. The present invention finally selected the SNP site with the largest gene frequency difference of 0.35 between the two groups for verification, which is located in the NCOR2 and SCARB1 gene interval region, at the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2, and there is a C / T polymorphism.

[0041] Example 2 Correlation analysis between SNP molecular markers and male pigeon fertilization rate

[0042] 311 pairs of white Cano pigeons of relatively consistent age were selected and raised under the same feeding conditions, with free access to food and water, and natural incubation and feeding. After being paired in cages at 5-6 months of age, all breeding egg data during 52 weeks were collected, and the average fertilization rate was calculated as phenotypic data.

[0043] Blood was collected from the subwing vein of the male pigeon and placed in EDTA anticoagulant. Genomic DNA was extracted using a blood extraction kit and stored at -20°C after the concentration was measured.

[0044] The extracted DNA was diluted and then subjected to PCR reaction, and the primer combination was upstream primer F as shown in SEQ ID NO: 3, and downstream primer R as shown in SEQ ID NO: 4. The reaction system was as follows:

[0045] 60ng of pigeon DNA to be tested,

[0046] 2×Es Taq MasterMix(Dye)10μl,

[0047] 10 μM upstream primer F 1 μl,

[0048] 10 μM downstream primer R 1 μl,

[0049] Make up to 20 μl with sterile water;

[0050] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

[0051] The PCR products of each sample were subjected to Sanger sequencing to obtain product sequences as shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the sequencing peak graph was as shown in Figure 2 As shown, the genotyping data of the SNP molecular marker at base 5476830 of chromosome 15 of the pigeon reference genome colLiv2 were obtained.

[0052] SPSS software was used to perform AVOVA analysis on the fertilization rates of individuals with different genotypes, and Duncan's multiple comparison method was used for statistical analysis of the experimental pigeon group. P values ​​less than 0.05 indicated significant differences, and P values ​​less than 0.01 indicated extremely significant differences. The results are shown in Table 1. As shown in Table 1, the 52-week fertilization rates of the three genotype pigeons were extremely significant (P<0.01). The 52-week fertilization rate of the SNP molecular marker C / C genotype male pigeon was significantly higher than that of the C / T genotype male pigeon and the T / T genotype male pigeon (P<0.05), and the 52-week fertilization rate of the C / T genotype male pigeon was higher than that of the T / T genotype male pigeon (P<0.05).

[0053] genotype Number of individuals Fertilization rate at 52 weeks (%) CC 258 <![CDATA[83.45±23.55 a ]]> CT 44 <![CDATA[77.07±21.5 b ]]> TT 9 <![CDATA[35.58±20.50 c ]]>

[0054] Note: 1. The same letters on the shoulders of the data in the same column indicate no significant difference, and different letters on the shoulders indicate significant difference (P<0.05); 2. Breeding pigeons are paired with one male and one female. The male pigeon is the main factor affecting the fertilization rate of breeding eggs. Therefore, the screening and identification of molecular markers related to fertilization rate traits uses male pigeons as the experimental material.

[0055] SEQ ID NO:1

[0056] AGGGGTTTGAGCAGTTTCCCCTCTGACAGCCCGGACAGTGAGCCAAAAAATGACTCTGACACTGGAATCCTTCTTGGTTGAATCATTTGAATTTCCTGCTAATTGGAAAAAAATTGTTAAAATTGAGTGTGCCTTGAAATAGCAACAATTTCAAGTAAGGGGGAACAACTGCACCTACACTGAATCACGGGCACTGTGCAAATATTACACAAACCCCTCGTTTGTCCCAG CAATTAAATCTCCATCAACACTAGAATCAATCTGCAGAGCTGCTCTCCCTCCCGGCCGCGCTTGTAAAACTCCCACCCAACAACTCCCATAGCCCAACGCTGCTCTTTTTGTT AGTGACATTTCAGGGGTTTTTTAGGATGTGACATATAAAAGAGCAGCGACAACGAAGGAGGTGAGCGGCACAAGAAGCCAATTCCAGATCCTGAGTGAGCAGAATGAATAGT TCTTCAGGAAAGAAAAAGAAATCTAATCAAGAACTTTTCCATTCTTCCCTTTTTCTTTTTTTAACAAGGAGGGTATGTGATACATATAGTCTCAAAAGGATTTA CTAGACACTGCTGTGACTAAGGCAAGATGTAATTAGAAGGGGAGGAACATTTTATCATTTGCCAGAGTGAATTAGGTATTTCAACTTCTCAAAAGAATCGAGCGCAGAGGGT

[0057] SEQ ID NO:2

[0058] AGGGGTTTGAGCAGTTTCCCCTCTGACAGCCCGGACAGTGAGCCAAAAAATGACTCTGACACTGGAATCCTTCTTGGTTGAATCATTTGAATTTCCTGCTAATTGGAAAAATTGTTAAAATTGAGTGTGCCTTGAAATAGCAACAATTTCAAGTAAGGGGGAACAACT GCACCTACACTGAATCACGGGCACTGTGCAAATATTACACAAACCCCTCGTTTGTCCCAGTAATTAAATCTCCATCAACACTAGAATCAATCTGCAGAGCTGCTCTCCCTCCCGGCCGCGCTTGTAAAACTCCCACCCAACAACTCCCATAGCCCAACGCTGCTCTTTTT GTTAGTGACATTTCAGGGGTTTTTTAGGATGTGACATATAAAAGAGCAGCGACAACGAAGGAGGTGAGCGGCACAAGAAGCCAATTCCAGATCCTGAGTGAGCAGAATGAATAGTTCTTCAGGAAAGAAAAAGAAATCTAATCAAGAACTTTTCCATTCTTCCCTTTTTTTCTTTTTTAAACAAGGAGGGTATGTGATACATATAGTCTCAAAAGGAGATTTACTAGACACTGCTGTGACTAAGGCAAGATGTAATTAGAAGAGGGGAGGAACATTTATCATTTGCCAGAGTGAATTAGGTATTTCAACTTCTCAAAAGAATCGAGCGCAGAGGGT

[0059] SEQ ID NO:3:

[0060] AGGGGTTTGAGCAGTTCCC

[0061] SEQ ID NO:4:

[0062] ACCCTCTGCGCTCGATTCTT

Claims

1. A SNP molecular marker associated with the fertilization rate of pigeons at 52 weeks of age, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The use of the SNP molecular marker associated with the fertilization rate of pigeons at 52 weeks of age as claimed in claim 1, characterized in that: Used to detect the fertilization rate of pigeons at 52 weeks of age.

3. Application of SNP molecular markers in detecting the fertilization rate of pigeons at 52 weeks of age, wherein the SNP molecular marker is a C / T polymorphism at base position 5476830 of chromosome 15 of the pigeon reference genome colLiv2.

4. The SNP molecular marker according to claim 1 or the use according to claim 2 or 3, characterized in that: The pigeon is a white Cano male pigeon.

5. The use according to claim 2 or 3, characterized in that The detection comprises the following steps: Step S1: performing PCR amplification on the pigeon DNA sample to be tested to obtain an amplification product; Step S2: sequencing the amplified product; Step S3: Determine the SNP molecular marker genotype based on the sequencing peak graph, and determine the fertilization rate of pigeons at 52 weeks of age.

6. The use according to claim 5, characterized in that: In step S1, the reaction system of the PCR amplification is calculated as 20 μl: 60ng of pigeon DNA to be tested, 2×Es Taq MasterMix 10μl, 10 μM upstream primer F 1 μl, 10 μM downstream primer R 1 μl, Make up to 20 μl with sterile water; The sequence of the upstream primer F is shown in SEQ ID NO: 3, and the sequence of the downstream primer R is shown in SEQ ID NO: 4; The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

7. According to claim 5, it is characterized in that: In the step S3, the judgment standard is that the 52-week-old fertilization rate of pigeons whose 231st base of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is C / C genotype is significantly higher than that of C / T genotype individuals and T / T genotype individuals; or the 52-week-old fertilization rate of pigeons whose 5476830th base of chromosome 15 of the pigeon reference genome colLiv2 is C / C genotype is significantly higher than that of C / T genotype individuals and T / T genotype individuals.

8. According to claim 6, it is characterized in that: In step S3, the judgment standard is that the 52-week-old fertilization rate of pigeons with a C / T genotype at the 231st base of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is higher than that of individuals with a T / T genotype; or the 52-week-old fertilization rate of pigeons with a C / T genotype at the 5476830th base of chromosome 15 of the pigeon reference genome colLiv2 is higher than that of individuals with a T / T genotype.

9. A breeding method for improving the fertilization rate of pigeons at 52 weeks of age, characterized in that By detecting the genotype of base 5476830 of chromosome 15 of the pigeon reference genome colLiv2, selection was carried out to retain individuals with C / C genotype and C / T genotype and eliminate individuals with T / T genotype.

10. The breeding method according to claim 9, characterized in that: The individuals with C / C genotype at base 5476830 of chromosome 15 of the pigeon reference genome colLiv2 were retained, and the individuals with C / T genotype were eliminated.

Images