Degradation gene for protecting crops from quizalofop-p-ethyl phytotoxicity and application thereof

Abstract

According to the degradation gene for protecting crops from quizalofop-p-ethyl phytotoxicity and the application of the degradation gene, the degradation gene with a quizalofop-p-ethyl degradation effect is transferred into rice through a genetic transformation technology, so that the rice is protected from the quizalofop-p-ethyl phytotoxicity. The gene is obtained by genome annotation and sequence alignment, codes 268 amino acids, has the molecular weight of 30,166.88 Da, and has the capability of degrading quizalofop-p-ethyl. The gene contains a conserved sequence of esterase and a catalytic triad, and the interaction between the gene and quizalofop-p-ethyl, especially the important effect of Ser94, is verified through 3D structure modeling and molecular docking experiments. After the gene is transferred into rice, the resistance of the rice to quizalofop-p-ethyl can be remarkably improved, healthy growth is maintained, and the risk of phytotoxicity is reduced. Therefore, not only is the tolerance of crops enhanced, but also a new strategy is provided for agriculture, the yield and quality are improved, the environmental influence of pesticides is reduced, and the development of sustainable agriculture is promoted.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a degradation gene for protecting crops from quizalofop-ethyl pesticide damage and an application thereof. Background Art

[0002] When using AOOP herbicides, especially quizalofop-ethyl, rice may suffer serious phytotoxicity, thus affecting yield. As an inhibitor of acetyl-CoA carboxylase (ACCase), quizalofop-ethyl acts by being absorbed by weed stems and leaves, and conducting upward and downward in the plant body, accumulating in the apical and intermediate meristems, inhibiting cellular fatty acid synthesis, and causing weed necrosis. As a gramineous crop, rice does not have such selective protection against quizalofop-ethyl and is easily affected by it. The growth of rice may be inhibited, manifested as short plants and reduced tillering. In severe cases, growth stagnation may occur, and rice leaves may show symptoms such as chlorosis, yellowing, curling or necrosis, affecting photosynthesis and nutrient absorption, thereby affecting yield. Summary of the invention

[0003] The present invention provides a degradation gene for protecting crops from being harmed by quizalofop-ethyl and application thereof, aiming to solve the technical problem in the prior art that rice is easily harmed by quizalofop-ethyl.

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0005] In a first aspect, the present invention provides a degradation gene of Bacillus megaterium for protecting crops from quizalofop-ethyl, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] In a preferred embodiment, the degradation gene has a full length of 810 bp, a GC content of 41%, encodes 268 amino acids, and the molecular weight of the expression product is 30166.88 Da.

[0007] In a second aspect, the present invention provides a degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl as described in the first aspect.

[0008] In a third aspect, the present invention provides a recombinant strain comprising the degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl described in the first aspect.

[0009] In a fourth aspect, the present invention provides a degradation protein, which is the protein expressed by the degradation gene described in the first aspect.

[0010] In a fifth aspect, the present invention provides the use of the degradation gene described in the first aspect in degrading Quizalofop-P-ethyl.

[0011] In a sixth aspect, the present invention provides a method for protecting crops from quizalofop-ethyl phytotoxicity, by overexpressing the degradation gene of claim 1 in the crops.

[0012] In a preferred embodiment, the crop is rice.

[0013] In a preferred embodiment, the sequence of the amplification primer is AACACGGGGGACTTTGCAACatgat gtatcaattaaatggtgtatcttactatgtgcacac;

[0014] Or the sequence of the amplification primer is TGAAGACAGGCTAGTTACAttatgtagtagctaagaactcacttactattctaccaaaaa.

[0015] The beneficial effects of the present invention are:

[0016] The present invention provides a degradation gene for protecting crops from quizalofop-ethyl and its application. First, the degradation gene is obtained by whole genome annotation and amino acid sequence alignment screening, has a clear nucleotide sequence (SEQ ID NO: 1), a total length of 810 bp, a GC content of 41%, encodes 268 amino acids, and the molecular weight of the expression product is 30,166.88 Da, which provides a molecular basis for the effective degradation of quizalofop-ethyl. Secondly, the degradation gene and esterase have highly conserved GYSMG sequences and catalytic triads Ser-Asp-His, which enable it to effectively attack the ester-carbonyl of quizalofop-ethyl and achieve its degradation. In addition, through 3D structural modeling and molecular docking experiments, the interaction between the degradation protein and quizalofop-ethyl, especially the key role of Ser94 in catalytic binding, is further confirmed, which is experimentally supported by constructing an S94G mutant and verifying its loss of enzyme activity. In practical applications, the introduction of this degradation gene into rice significantly improved the resistance of rice to Quizalofop-PhD. Control tests showed that rice plants introduced with the degradation gene could maintain healthy growth in soil containing Quizalofop-PhD, while those without the introduction showed symptoms of pesticide damage. This genetic transformation technology not only enhances rice's tolerance to specific herbicides, but also provides new strategies for agricultural production and crop protection, improves crop yield and quality, reduces the impact of pesticides on the environment, and contributes to sustainable agricultural development. By overexpressing this degradation gene in crops, the tolerance of crops to Quizalofop-PhD can be improved, reducing the risk of pesticide damage caused by misuse or excessive use of herbicides, thus having important practical application value in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 It is the gel electrophoresis diagram of the PCR product of the rice genetic transformation seedling in the present invention.

[0019] Figure 2 It is a schematic diagram of the results of the experiment using rice in the present invention.

[0020] Figure 3 It is a multiple alignment result of the amino acid sequence of the degradation gene QpmH and other related esterases of the V family.

[0021] Figure 4 Phylogenetic analysis of the degradation gene QpmH showed its relationship with other esterases of subfamilies I-VIII.

[0022] Figure 5 It is the purified degradation gene QpmH.

[0023] Figure 6 It is a Ramachandran diagram of the homology modeling structure of the degradation gene QpmH.

[0024] Figure 7 This is the three-dimensional structure diagram of the degradation gene QpmH. DETAILED DESCRIPTION

[0025] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work belong to the protection scope of the present invention.

[0026] Embodiment 1:

[0027] This embodiment provides a degradation gene of Bacillus megaterium for protecting crops from quizalofop-ethyl, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0028] The degradation gene has a full length of 810 bp, a GC content of 41%, encodes 268 amino acids, and the molecular weight of the expression product is 30166.88 Da.

[0029] Example 2: This example provides a degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl as described in Example 1.

[0030] Example 3: This example provides a recombinant strain comprising the degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl described in Example 1.

[0031] Embodiment 4: This embodiment provides a degradation protein, the protein expressed by the degradation gene described in Embodiment 1.

[0032] Example 5: This example provides the application of the degradation gene described in Example 1 in degrading Quizalofop-P-ethyl.

[0033] Example 6: This example provides a method for protecting crops from quizalofop-ethyl, by overexpressing the degradation gene described in Example 1 in the crops.

[0034] Wherein, the crop is rice.

[0035] In addition, when constructing an overexpression vector, the degradation gene needs to be amplified, and an amplification primer is used in the amplification process. The sequence of the amplification primer is AACACGGGGACTTTGCAACatgatgta tcaattaaatggtgtatcttactatgtgcacac;

[0036] Alternatively, the sequence of the amplification primer is TGAAGACAGGCTAGTTACAttatgtagtagctaagaactcacttactattctaccaaaaa.

[0037] In addition, this embodiment provides a method for protecting rice from quizalofop-ethyl, comprising:

[0038] S1. Construction of overexpression vector: design amplification primers for amplifying degradation genes, and construct an overexpression vector with the amplified degradation genes;

[0039] S2. Electroporation of Agrobacterium: 0.8-1.2 parts by volume of the overexpression vector was mixed with 48-52 parts by volume of EHA105 Agrobacterium competent cells, and the mixture was transferred into an electroporation cup for electroporation to obtain electroporated Agrobacterium;

[0040] S3, activation of Agrobacterium: after electroporation, add 0.8-1.2 volumes of LB liquid medium, shake and culture in a shaker at 28-32°C and 180 rpm for 30 minutes, draw 48-52 volumes of Agrobacterium liquid and inoculate on LB solid medium, culture in the dark at 28-32°C for 45-50 hours, then put in the invasion dye to obtain Agrobacterium resuspension, and adjust the OD600 value of the Agrobacterium resuspension to 0.15-0.25;

[0041] S4, Agrobacterium infection: healthy rice grains are selected, sterilized and inoculated into an induction medium, cultured at 22-28° C. for 18-22 days to obtain callus tissue, the callus tissue and the Agrobacterium resuspension are mixed and infected for 10-15 minutes, and then the callus tissue is inoculated into a co-cultivation medium and cultured at 18-22° C. for 48-72 hours;

[0042] S5. Screening of transformed callus: inoculating the infected callus into a screening medium, culturing at 24-28°C in the dark for 20-30 days, and then inoculating into a secondary screening medium, culturing at 24-28°C in the dark for 7-10 days to obtain positive callus;

[0043] S6. Differentiation and rooting: The positive callus tissue is inoculated into a differentiation medium, cultured at 25-27° C. for 15-20 days, and after 2-5 cm buds are differentiated, inoculated into a rooting medium, cultured at 28-32° C. for 7-10 days to obtain rice seedlings containing the degradation gene.

[0044] In step S1, homologous recombination is used to construct an overexpression vector of the degradation gene and amplification primers.

[0045] In step S1, the sequence of the amplification primer is AACACGGGGGACTTTGCAACatgatgtatcaattaaatggtgtatcttactatgtgcacac;

[0046] Or the sequence of the amplification primer is TGAAGACAGGCTAGTTACAttatgtagtagctaagaactcacttactattctaccaaaaa.

[0047] In step S4, the healthy rice grains are disinfected by using 75% alcohol for 1-3 minutes, washing with sterile water for 1 minute, disinfecting with 12-16% sodium hypochlorite for 18-22 minutes, washing with sterile water for 2-4 minutes, and then inoculating into the induction culture medium.

[0048] Specifically, the selected healthy rice grains without mold spots and normal buds are placed in a 75% alcohol solution for disinfection for 1 to 3 minutes. Alcohol can quickly kill most of the microorganisms on the surface of rice grains, which is the first step of disinfection. After alcohol disinfection, the rice grains are washed with sterile water to remove the alcohol remaining on the rice grains. The washing time is 1 minute, which helps to reduce the potential impact of alcohol on the growth of rice grains during subsequent cultivation. Then, the rice grains are placed in a 12% to 16% sodium hypochlorite solution for a deeper disinfection treatment for 18 to 22 minutes. Sodium hypochlorite is a strong oxidant that can effectively kill microorganisms such as bacteria, viruses and fungi. After sodium hypochlorite disinfection, the rice grains are washed again with sterile water to remove the residual sodium hypochlorite for 2 to 4 minutes. This step is also important to ensure that no harmful chemicals remain on the rice grains. Finally, the thoroughly disinfected and washed rice grains are inoculated into the induction medium to start the subsequent cultivation process.

[0049] In step S6, the method for detecting the rice seedlings containing the degradation gene is: extracting rice genomic DNA using the CTAB method, designing detection primers for PCR amplification, and performing gel electrophoresis detection;

[0050] When a band identical to the degradation gene appears on the electrophoresis diagram of the rice genome, the degradation gene has been introduced into the rice genome; when a band identical to the degradation gene does not appear on the electrophoresis diagram of the rice genome, the degradation gene has not been introduced into the rice genome;

[0051] The upstream primer sequence of the detection primer is: 5'-CTGCCCGCTGTTCTACAACCGC-3', and the downstream primer sequence is: 3'-GACGGGCGACAAGATGTTGGCG-5';

[0052] Alternatively, the upstream primer of the detection primer is: 5'-GGAGCATATACGCCCGGAGTC-3'; the downstream primer sequence is: 3'-CCTCGTATATGCGGGCCTCAG-5'.

[0053] Specifically, DNA is first extracted from the rice genome using the CTAB method. CTAB (cetyltrimethylammonium bromide) is a cationic detergent that can bind to DNA in a high salt solution. After removing impurities such as proteins, polysaccharides, and phenols through organic solvent extraction, ethanol precipitation is added to separate the nucleic acid. The extracted DNA is used as a template and PCR amplification is performed using the designed detection primers. The PCR reaction system contains PCR buffer, dNTPs, Taq enzyme, primers, and template DNA. After the PCR product is mixed with a nucleic acid dye, it is separated by agarose gel electrophoresis. During the electrophoresis process, DNA fragments migrate under the action of an electric field according to their size and configuration, forming different bands. If a band of the same size as the degradation gene appears on the electrophoresis diagram of the rice genome, it indicates that the degradation gene has been successfully introduced into the rice genome. The presence of this band confirms the success of PCR amplification, and the amplified DNA fragment is consistent with the length of the target gene degradation gene. After the electrophoresis is completed, the DNA bands are observed under ultraviolet light, and the size of the PCR product is determined by comparing it with a nucleic acid molecular weight standard. During the PCR amplification process, the DNA template is melted at high temperature, renatured at low temperature, and extended at medium temperature, and exponential amplification of DNA fragments is achieved through multiple cycles.

[0054] The present invention will be further explained below in conjunction with experiments:

[0055] In this experiment, the present invention named the degradation gene QpmH.

[0056] 1. Identification and characterization of the degradation gene QpmH

[0057] See also Figure 3-Figure 4 ,in, Figure 3 Sequence alignment was performed using ClustalX and Espript 3.0. Similar residues are indicated by transparent boxes and identical residues are indicated by colored backgrounds. The secondary structural elements of QpmH (α helix [α], β fold [β], random coil [η], and β turn [T]) are indicated at the top of the alignment. The numbers above the amino acid sequence indicate the residue positions in QpmH. The GXSXG, GH motifs are underlined in red, and the possible catalytic triad (Ser [S], Asp [D], and His [H]) are indicated by a five-pointed star below the alignment.

[0058] This study describes the identification process and characterization analysis of a target gene named degradation. The degradation gene was obtained by whole genome annotation results and amino acid sequence comparison screening, and its nucleotide sequence is shown in SEQ ID NO: 1. The gene is 810 bp in length, with a GC content of 41%, encoding 268 amino acids, and the molecular weight of the expression product is 30,166.88 Da.

[0059] Further multiple sequence alignment analysis showed that degradation and closely related esterases have the GYSMG sequence, corresponding to the typical conserved motif (GXSXG) of the α / β-hydrolase superfamily and esterase family. Degradation also has a highly conserved catalytic triad of family V lipases, namely Ser-Asp-His (Ser94, Asp221, His248). In the conserved GXSXG motif, the 94th active serine residue of degradation was identified as the catalytic nucleophile that attacks the ester-carbonyl group. Aspartic acid 221 and histidine 248 were located through multiple sequence alignment results. The constructed phylogenetic tree verified the evolutionary relationship between degradation and its closest relatives, indicating that degradation belongs to family V and has 17% identity with the hydrolases of Pseudomonas sp. and Methylobacterium populi, which are the closest evolutionary distances. This result reveals the significant difference between degradation and other quizalofop-ethyl degrading enzymes.

[0060] 2. 3D structural modeling and molecular docking of degraded proteins

[0061] See also Figure 5 In this experiment, Ni-NTA affinity chromatography was used to purify the recombinant protein. Ni-NTA affinity chromatography is a commonly used purification method that uses the affinity of histidine (His) tags with metal ions to purify proteins.

[0062] This example describes the process of constructing the three-dimensional structure of the degradation protein by homology modeling using SWISS-MODEL software and the 2XMZ template. The homology between the 2XMZ sequence template and the degradation is 37.40%. By Ramachandran plot analysis, about 91.9% of the amino acid residues are located in the favorable region, 7.6% are located in the allowed region, and no residues are observed in the torsion angle forbidden zone (see Figure 6 , triangles represent glycine / proline, and squares represent other amino acids). This indicates that the dihedral angles of all amino acid residues of the degraded protein obtained by modeling are within a reasonable range and conform to the stereochemical energy rules.

[0063] In order to better understand the interaction between the degradation protein structure and quizalofop-p-ethyl at the molecular level, molecular docking experiments were performed. The three-dimensional structure of the degradation protein and the binding site between the substrate and the degradation protein were constructed (see Figure 7 A, yellow dotted line represents hydrogen bond), the binding energy of quizalofop-p-butyl to degradation is -7.8 kcal mol-1. The oxygen atom of the ether bond in quizalofop-p-butyl forms a hydrogen bond with Ser 94, and the distance between the two is 2.8 nm. This shorter distance may be the main factor leading to the good catalytic activity of quizalofop-p-butyl.

[0064] To verify this conclusion, a single-site variant named S94 G (Ser 94 replaced by glycine in degradation) was constructed. The hydrogen bonding between the substrate and the side chain hydroxyl group can be confirmed by glycine, and the effect of the hydrophobic interaction generated by the entire side chain on the catalytic binding of the enzyme can be confirmed. The mutant recombinant protein S94 G was successfully purified by the same method as above. The recombinant protein S94 G was dialyzed and concentrated and then used for enzyme activity assay. The experiment found that S94G showed a loss in its ability to convert quizalofop-p-ethyl. This finding is consistent with the computational analysis and verifies that Ser94 is a key residue affecting the flexibility of degradation towards quizalofop-p-ethyl.

[0065] 3. Genetic transformation of rice

[0066] 1.1 Agrobacterium preparation

[0067] Design primers to amplify the degradation gene, and use homologous recombination to construct the degradation gene and overexpression vector. After obtaining the above plasmid, take 1μL and add it to 50μL Agrobacterium competent cells, mix well and then transfer to the electroporation cup, add 1mL LB liquid culture medium after electroporation, mix well and then transfer to a 1.5mL centrifuge tube, shake and culture on a shaker at 30℃ and 180rpm for 30min, take 50μL of the activated Agrobacterium liquid and inoculate it on LB solid culture medium, and culture it in the dark at 30℃ for 48h. The correct positive clone was obtained after sequencing verification.

[0068] 1.2 Rice genetic transformation

[0069] Select rice grains (Nipponbare) without mold spots and with normal buds for induction. Disinfect with 75% alcohol for 1 minute, wash with sterile water for 1 minute each time; disinfect with 15% sodium hypochlorite for 20 minutes, wash with sterile water 3 times for 1 minute each time; inoculate the disinfected rice grains into the induction medium and culture at 26°C for 20 days. Then, infect with Agrobacterium, pick Agrobacterium from the infection solution, and prepare the OD 600 =0.2 Agrobacterium resuspension, pick callus in a triangular flask, add Agrobacterium resuspension, infect for 10-15min and then discard the bacterial solution, inoculate callus in co-cultivation medium, co-cultivate at 20℃ for 48-72h. Inoculate the above callus in screening medium, incubate in the dark at 26℃ for 20-30 days; inoculate positive callus in secondary screening medium, be sure to pick monoclonal callus in the callus picking process, and incubate in the dark at 26℃ for 7-10 days. Inoculate positive callus into differentiation medium for differentiation and rooting, incubate in light at 25-27℃ for 15-20 days, inoculate into rooting medium after differentiation of 2-5cm buds, and incubate in light at 30℃ for 7-10 days. After the cultivation cycle is completed, extract rice genomic DNA by CTAB method, design detection primers for PCR amplification, and detect by gel electrophoresis.

[0070] 1.3 Results of rice genetic transformation

[0071] See also Figure 1 , (+: positive control; M: mark; -: negative control; 1-11: 11 random test seedlings) In gel electrophoresis, it was observed that groups 1-11 all had DNA bands consistent with the degradation gene, indicating that the degradation gene had been successfully integrated into the rice genome.

[0072] 4. To investigate the growth status of rice plants with and without degradation genes introduced in soil containing Quizalofop-Ph-ethyl

[0073] 2.1 Materials and methods

[0074] 4.1.1 Nipponbare rice, the active ingredient is 20% quizalofop-p-butyl emulsion, the dosage is 17-25 ml / mu, and the water content is 30 kg water

[0075] 4.1.2 Experimental Grouping

[0076] Control group: 2 groups of water controls (WT control, degradation gene control)

[0077] Treatment groups: 4 groups were treated with different doses of Quizalofop-P-ethyl, as shown below:

[0078] WT0.5 dose: 0.5 times the recommended field dose

[0079] Degradation gene 0.5dose: 0.5 times the recommended field dose, degradation genotype rice

[0080] WT1 dose: 1 times the recommended field dose

[0081] Degradation gene 1dose: 1 times the recommended dose in the field, degradation genotype rice

[0082] Plant Nipponbare rice to the three-leaf one-heart stage, prepare 1x and 0.5x solutions of Quizalofop-ethyl EC at a dosage of 17-25 ml / mu, and add 30 kg of water to each group. Apply the pesticide to the rice according to the grouping. Observe and record the growth of each group of rice 15 days after application. Compare the growth of each group of rice, especially the growth difference between the degradation genotype and the non-genotype rice at different doses, to evaluate the ability of the degradation gene to resist Quizalofop-ethyl in rice.

[0083] 4.3 Test results

[0084] Test results reference Figure 2In the water control group (WT control, degradation gene control), the rice showed typical healthy growth characteristics. The leaves were slender and green, indicating that the rice could photosynthesize and grow normally without the interference of quizalofop-p-ethyl.

[0085] In contrast, rice treated with 0.5 and 1 times the recommended dose of Quizalofop-Ph-ethyl showed obvious growth inhibition. The leaves turned yellow, the stems were bent, and they were close to wilting. These symptoms showed that Quizalofop-Ph-ethyl had a significant negative impact on rice growth, causing growth stunting by interfering with plant hormone balance or directly damaging cell structure.

[0086] Under the treatment of 0.5 times the dose of Quizalofop-Phthiophene, the rice introduced with the degradation gene (0.5 dose of degradation gene) was able to maintain green leaves and good growth, showing the effective resistance of the degradation gene to the toxicity of Quizalofop-Phthiophene. More significantly, under the treatment of 1 times the dose of Quizalofop-Phthiophene, the rice introduced with the degradation gene (1 dose of degradation gene) was still able to maintain a good growth state. This further confirms the protective effect of the degradation gene on rice in a higher concentration of Quizalofop-Phthiophene environment.

[0087] Therefore, it is concluded that the introduction of degradation genes significantly improves the tolerance of rice to Quizalofop-PhD, allowing it to grow healthily in soil containing Quizalofop-PhD, which is of great significance for agricultural production, especially in rice fields where Quizalofop-PhD is needed to control weeds. Rice with degradation genes can reduce the use of pesticides while maintaining the healthy growth of rice, thereby increasing crop yield and quality and reducing environmental pollution.

[0088] The present invention is not limited to the above-mentioned optional implementation modes. Anyone can derive other various forms of products under the inspiration of the present invention. However, no matter what changes are made in the shape or structure, all technical solutions that fall within the scope defined by the claims of the present invention fall within the protection scope of the present invention.

Claims

1. A degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl, characterized in that: The nucleotide sequence is shown in SEQ ID NO:

1.

2. The degradation gene of Bacillus megaterium for protecting rice from quizalofop-ethyl according to claim 1, characterized in that: The degradation gene has a full length of 810 bp, a GC content of 41%, encodes 268 amino acids, and the molecular weight of the expressed product is 30166.88 Da.

3. A recombinant vector, characterized in that: The invention comprises the degradation gene of Bacillus megaterium for protecting rice from the quizalofop-ethyl pesticide as claimed in claim 1.

4. A recombinant strain, characterized in that: The invention comprises the degradation gene of Bacillus megaterium for protecting rice from the quizalofop-ethyl pesticide as claimed in claim 1.

5. A degraded protein, characterized in that The protein expressed by the degraded gene according to claim 1.

6. Use of the degradation gene according to claim 1 in degrading Quizalofop-P-ethyl.

7. A method for protecting crops from quizalofop-ethyl, characterized in that: Overexpressing the degradation gene according to claim 1 in crops.

8. The method for protecting crops from quizalofop-ethyl according to claim 7, characterized in that: The crop is rice.

9. An amplification primer for amplifying the degradation gene according to claim 1, characterized in that: The sequence of the amplification primer is AACACGGGGGACTTTGCAACatgatgtatcaattaaatggtgtatcttactatgtgcacac; Or the sequence of the amplification primer is TGAAGACAGGCTAGTTACAttatgtagtagctaagaactcacttactattctaccaaaaa.

Images