Hydrolysates of kelp polysaccharides and shiitake stem polysaccharides and their applications in promoting the proliferation of *Westernella*.
By preparing hydrolysates of kelp polysaccharides and shiitake stem polysaccharides, the problem of insufficient growth and reproduction of Weissella in existing technologies has been solved, enabling the promotion of its application in fermented foods and its benefits to human health, especially the balance of intestinal microbiota and the enhancement of immunity.
Patent Information
- Application Number
- CN202510197045.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2045-02-21
AI Technical Summary
The lack of effective substances to promote the growth and reproduction of Weissella in existing technologies affects its application in fermented foods and its health benefits.
By preparing kelp polysaccharide and shiitake mushroom stem polysaccharide hydrolysates, the polysaccharides were extracted using ethanol precipitation and dialysis techniques, and then hydrolyzed with hydrochloric acid to obtain a polysaccharide preparation that promotes the growth of Weissella asiatica.
Hydrolysates of kelp polysaccharides and shiitake mushroom stem polysaccharides significantly promote the growth and reproduction of Weissella, enhancing its role in fermented foods and its health benefits, particularly in regulating gut microbiota balance and boosting immunity.
Smart Images

Figure CN120005053B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to kelp polysaccharide, lentinan hydrolysate, and their application in promoting the proliferation of Weissella asiatica. Background Technology
[0002] Fermented foods have a significant impact on human life in many aspects, including the economy and health, making them a vital industry. One key reason for their popularity is the diversity of flavor compounds, most of which are produced by the growth and metabolism of microorganisms. Among these microorganisms, lactic acid bacteria play a crucial role. Weissella, a common genus of lactic acid bacteria, is widely distributed across various fermentation systems and environments, exhibiting high relative abundance in different fermented foods.
[0003] Weissella is a rod-shaped, Gram-positive (G) bacterium. + Weissella facultative anaerobic, acid-resistant bacteria are widely distributed in nature, but are mainly concentrated in food-related environments such as dairy products, grains, sewage, beer, wine, fruit juice, pickles, and malt extract. Furthermore, as a type of lactic acid bacteria, Weissella wiltii has a positive effect on human health. It participates in the balance regulation of intestinal microbiota, interacting with other intestinal microorganisms to maintain a balanced state; it also enhances immunity; regular intake of foods containing Weissella wiltii or probiotic preparations can strengthen the body's immunity and reduce the risk of disease; in addition, Weissella wiltii also promotes digestion and improves the intestinal environment. Therefore, developing substances that promote the growth and reproduction of Weissella wiltii is of great significance. Summary of the Invention
[0004] In view of this, the present invention provides kelp polysaccharide, shiitake mushroom stem polysaccharide hydrolysate and their application in promoting the proliferation of Weissella, which is of great significance for promoting the growth and reproduction of Weissella.
[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0006] This invention provides a method for preparing kelp polysaccharides, comprising the following steps:
[0007] S1. Mix kelp powder with water, heat in a water bath at 78-82℃ for 3.5-4.5 hours, filter, and collect filtrate 1 and filter residue;
[0008] S2. Repeat the extraction of the filter residue once, filter, and collect filtrate 2 under the same extraction conditions as S1;
[0009] S3. Combine filtrate 1 and filtrate 2, concentrate, and obtain kelp extract concentrate;
[0010] S4. Add ethanol to the kelp extract concentrate to make the final ethanol concentration 18-22% v / v. After centrifugation, take the precipitate and dissolve it in water. Dialyze it through an 8000-12000 Da dialysis bag, take the solution in the dialysis bag, concentrate it, and freeze-dry it to obtain kelp polysaccharide.
[0011] Preferably, the mass-to-volume ratio of kelp powder to water is 20g:900-1100mL.
[0012] Preferably, after filtrate 1 and filtrate 2 are combined, the solution is concentrated to 8-12% of its original volume.
[0013] The present invention also provides kelp polysaccharides prepared by the aforementioned preparation method.
[0014] This invention also provides a method for preparing lentinan hydrolysate from shiitake mushroom stems, comprising the following steps:
[0015] (1) Mix shiitake mushroom stem powder with water at a ratio of 50g: 1800-2200mL, stir at 58-62℃ for 3.5-4.5h, filter, and collect the supernatant and residue;
[0016] (2) Extract the residue once more, filter, and collect the supernatant 2. The extraction conditions are the same as in step (1).
[0017] (3) Combine supernatant 1 and supernatant 2, and concentrate to 8-12% of the original volume to obtain concentrated extract of shiitake mushroom disease;
[0018] (4) Add ethanol to the extract concentrate of shiitake mushroom stems to make the final ethanol concentration 18-22% v / v. After centrifugation, take the precipitate and dissolve it in water. Then add ethanol to make the final ethanol concentration 48-52% v / v. Collect the precipitate, which is crude polysaccharide of shiitake mushroom stems.
[0019] (5) Dissolve the crude polysaccharide of shiitake mushroom stem in water to obtain a crude polysaccharide solution of shiitake mushroom stem. Add Sevage solution to the crude polysaccharide solution of shiitake mushroom stem. The volume of Sevage solution is 18-22% of the volume of the crude polysaccharide solution of shiitake mushroom stem. Centrifuge to remove the protein. Repeat 6-7 times until there is no white precipitate.
[0020] (6) Dialyze the solution obtained in step (5) through a dialysis bag of 8000-12000 Da, take the solution in the dialysis bag, concentrate and freeze dry to obtain shiitake stem polysaccharide;
[0021] (7) Dissolve the shiitake stem polysaccharide in HCl solution, sonicate at 58-62℃ for 3.5-4.5h, cool and neutralize with NaOH, dialyze with an 8000Da dialysis bag for 70-72h, take the solution outside the dialysis bag, concentrate and freeze dry to obtain shiitake stem polysaccharide hydrolysate.
[0022] Preferably, the Sevage solution is prepared by mixing chloroform and n-butanol in a volume ratio of 4:1.
[0023] Preferably, the mass-to-volume ratio of lentinan to HCl solution is 1g:0.8-1.2mL, and the concentration of the HCl solution is 0.8-1.2mol / L.
[0024] The present invention also provides a lentinan hydrolysate of shiitake stem prepared by the aforementioned preparation method.
[0025] The present invention also provides the application of the kelp polysaccharide or the lentinan hydrolysate in at least one of the following:
[0026] (1) Application in promoting the proliferation of Weissella brevis;
[0027] (2) Application in the preparation of preparations that promote the proliferation of Weissella.
[0028] This invention provides a preparation for the proliferation of Weissella asiatica, comprising the aforementioned kelp polysaccharide and / or the aforementioned lentinan polysaccharide degradation product.
[0029] By adopting the above technical solution, the present invention has the following beneficial effects: In this invention, kelp powder is mixed with water for extraction and concentration, then precipitated with ethanol at a final concentration of 18-22% v / v. The precipitate is dissolved in water and dialyzed to obtain kelp polysaccharides. Similarly, shiitake mushroom stem powder is mixed with water for extraction and concentration, then precipitated first with ethanol at a final concentration of 18-22% v / v, followed by precipitation with ethanol at a final concentration of 48-52% v / v to remove proteins. After hydrolysis with hydrochloric acid solution and dialyzed, shiitake mushroom stem polysaccharide hydrolysates are obtained. The kelp polysaccharides and shiitake mushroom stem polysaccharide hydrolysates of the present invention promote the growth and reproduction of *Vibrio vulnificus* and can be used to prepare formulations that promote *Vibrio vulnificus* proliferation. Attached Figure Description
[0030] Figure 1 This is a diagram of the colony morphology of Weissella.
[0031] Figure 2 The content of Weissella after fermentation of different types of polysaccharides.
[0032] Figure 3 The growth curves of Weissella in different types of polysaccharide culture media are shown. Detailed Implementation
[0033] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0034] Example 1. Preparation of kelp polysaccharides
[0035] Kelp was dried in an oven at 60℃ for 4 hours, crushed and ground into powder, sieved through a 60-mesh sieve, and stored in a dry and ventilated place. 20g of kelp powder was added to 1000mL of distilled water and heated in a water bath at 80℃ for 4 hours. The mixture was filtered through four layers of gauze, and the filtrate was collected. The residue was extracted once more with 1000mL of distilled water. The filtrates were combined and concentrated to 200mL by rotary evaporation. 95% ethanol was added for alcohol precipitation to a final concentration of 20% v / v. The mixture was allowed to stand at 4℃ for 24 hours, centrifuged at 9000 rpm, and the precipitate was dissolved in water. The solution was placed in an 8000Da dialysis bag, which was then immersed in deionized water for 72 hours. The solution in the dialysis bag was collected, concentrated, and freeze-dried to obtain kelp polysaccharide, named LJP-20.
[0036] Example 2. Preparation and hydrolysis of lentinan from shiitake stems
[0037] Preparation of polysaccharide from shiitake mushroom stems: Shiitake mushroom stems were dried in an oven at 60℃ for 4 hours, crushed and ground into powder, passed through a 100-mesh sieve, and 50g was accurately weighed. 2000mL of water was added, and the mixture was stirred at 60℃ for 4 hours. The residue was filtered through gauze, and the supernatant was collected. Then, 2000mL of water was added to the residue, and the extraction was repeated once. The supernatants were combined and concentrated by rotary evaporation to obtain 0.4L. Add 95% ethanol (v / v) to a final concentration of 20% v / v, incubate at 4°C for 24 h, centrifuge at 9000 rpm, then dissolve the collected precipitate in 50 mL of water. Add 95% ethanol (v / v) in a gradient to a final concentration of 50% v / v, incubate at 4°C for 24 h, centrifuge at 9000 rpm, collect the precipitate, dissolve it in water, and then add 20% (v / v) of Sevage solution (prepared from 80 mL of chloroform and 20 mL of n-butanol). Shake vigorously, centrifuge at 9000 rpm to remove protein, repeat 7 times until no white precipitate remains. Place the resulting aqueous solution into an 8000 Da dialysis bag, immerse the dialysis bag in deionized water, and dialyze for 72 h. Collect the solution from the dialysis bag, concentrate, and freeze-dry to obtain lentinan from shiitake mushroom stems, named LESP-50.
[0038] Hydrolysis of lentinan from shiitake stems: 100 mg of LESP-50 was dissolved in 100 mL of 1 mol / L HCl solution, sonicated at 60 °C for 4 h, and then neutralized with 1 mol / L NaOH after cooling. The solution was dialyzed through an 8000 Da dialysis bag for 72 h. The solution outside the dialysis bag was collected, concentrated, and then freeze-dried. The solution was named LESO-50.
[0039] Comparative Example 1
[0040] Unlike Example 1, the final concentration of ethanol during alcohol precipitation was 50% v / v, and the resulting kelp polysaccharide was named LJP-50.
[0041] Comparative Example 2
[0042] The cation exchange resin used in this comparative example was purchased from Sigma-Aldrich, USA, model: (Dowex 50W×8, 400 mesh).
[0043] Unlike Example 1, LJP-20 underwent desulfate treatment after obtaining it. The specific steps were as follows: 1g of kelp polysaccharide LJP-20 was dissolved in 300mL of water. After stirring and dissolving, the solution was passed through a cation exchange resin until the pH was neutral and the kelp polysaccharide was completely eluted. Pyridine was added to make the solution alkaline, and the solution was lyophilized to obtain two pyridine salts of kelp polysaccharides. 62.5mL of dimethyl sulfoxide and 7.5mL of anhydrous methanol were added to the pyridine salts. After ultrasonic dissolution, the solution turned bright yellow. The solution was sealed and heated in a water bath at 80°C for 10 hours. The reaction was terminated by adding 7.5mL of distilled water. The solution was dialyzed using a 3500Da dialysis bag for 72 hours and then lyophilized. This process was repeated three times until the sulfate ions were completely removed, and the resulting product was named DeLJP-20.
[0044] Comparative Example 3
[0045] Unlike Comparative Example 1, after obtaining kelp polysaccharide LJP-50, it was also subjected to desulfate treatment, and the desulfate treatment steps were the same as those in Comparative Example 2.
[0046] Comparative Example 4
[0047] Comparative Example 4 prepared Lycium barbarum polysaccharide. The preparation method was as follows: 100g of dried Lycium barbarum fruit was soaked in 400mL of distilled water and left at room temperature for 2 hours. The extract was then concentrated to 50mL. The extraction process was repeated twice, and the extracts were combined. Then, 95% ethanol was added to bring the final concentration to 50% v / v. The mixture was allowed to stand at 4℃ for 24 hours, centrifuged at 9000 rpm, and the precipitate was dissolved in 50mL of distilled water. Then, 10mL of Sevage solution (prepared from 80mL of chloroform and 20mL of n-butanol) was added, and the mixture was shaken vigorously and centrifuged at 9000 rpm to remove free protein. This process was repeated 7 times until no white gel-like precipitate formed in the solution. Finally, this solution was placed in an 8000Da dialysis bag, immersed in deionized water, dialyzed for 72 hours, concentrated, and lyophilized, and named LBP-50.
[0048] Comparative Example 5
[0049] Unlike Comparative Example 4, the final concentration of ethanol during alcohol precipitation was 30% v / v, and the resulting Lycium barbarum polysaccharide was named LBP-30.
[0050] Comparative Example 6
[0051] Unlike Comparative Example 4, LBP-50 was further debranched after being obtained. The specific steps were as follows: 100 mg of LBP-50 was dissolved in 20 mL of 0.02 mol / L H2SO4 solution, heated in a water bath at 80 °C for 12 h, and then neutralized with 1 mol / L NaOH after cooling. The solution was dialyzed in an 8000 Da dialysis bag for 72 h. The solution in the dialysis bag was collected, concentrated, and then freeze-dried to obtain partially acid-hydrolyzed linear Lycium barbarum polysaccharide, which was named BLBP-50.
[0052] Comparative Example 7
[0053] Unlike Example 2, the final concentration of ethanol during the second alcohol precipitation was 20% v / v, and the resulting lentinan was named LESP-20. LESP-20 was not hydrolyzed.
[0054] Comparative Example 8
[0055] Unlike Example 2, after obtaining the lentinan LESP-50 from shiitake mushroom stems, ESP-50 was not hydrolyzed.
[0056] Comparative Example 9
[0057] Unlike Example 2, the final concentration of ethanol during the second alcohol precipitation was 80% v / v, and the resulting lentinan was named LESP-80. LESP-80 was not hydrolyzed.
[0058] In the embodiments and comparative examples of this invention, the outside of the dialysis bag is filled with deionized water.
[0059] Experimental Example 1
[0060] The yield and solubility of the extracts in the examples and comparative examples were determined, and the results are shown in Table 1.
[0061] Extract yield = Mass of extract / Mass of raw material
[0062] Table 1. Yield and solubility of extracts from each group
[0063]
[0064] As shown in Table 1, the solubility of Lycium barbarum polysaccharide LBP-30 is poor, and the extraction rates of Lentinus edodes stem polysaccharides LESP-20 and LESP-80 are relatively low. Therefore, kelp polysaccharides LJP-20 and LJP-50, desulfurized kelp polysaccharides DeLJP-20 and DeLJP-50, Lycium barbarum polysaccharide LBP-50, debranched Lycium barbarum polysaccharide BLBP-50, Lentinus edodes stem polysaccharide LESP-50, and Lentinus edodes stem polysaccharide hydrolysate LESO-50 were used for subsequent experiments.
[0065] Experiment Example 2
[0066] To clarify the basic characteristics of polysaccharides, the physicochemical properties of kelp polysaccharides LJP-20, LJP-50, desulfurized kelp polysaccharides DeLJP-20, DeLJP-50, wolfberry polysaccharide LBP-50, debranched wolfberry polysaccharide BLBP-50, shiitake stem polysaccharide LESP-50, and shiitake stem polysaccharide hydrolysate LESO-50 were analyzed, and the results are shown in Table 2.
[0067] Table 2 Physicochemical properties of different types of polysaccharides
[0068]
[0069]
[0070] The results showed that the total sugar content of LJP-20, LJP-50, DeLJP-20, DeLJP-50, LBP-50, BLBP-50, LESP-50, and LESO-50 were 66.97%±4.77%, 64.54%±4.23%, 71.02%±2.62%, 69.35%±3.21%, 61.52%±4.70%, 64.93%±2.96%, 82.37%±3.22%, 71.26%±3.23%, 88.49%±1.03%, and 92.74%±2.27%, respectively. LJP-20, LJP-50, DeLJP-20, DeLJP-50, LBP-50, and BLBP-50 are acidic sugars with uronic acid contents of 23.21±6.02%, 22.06%±5.05%, 18.16%±3.82%, 20.39%±4.26%, 23.50%±4.05%, and 23.47%±2.95%, respectively. LJP-20, LJP-50, DeLJP-20, and DeLJP-50 also contain fucose with contents of 8.96%±0.06%, 13.26%±0.05%, 10.53%±0.25%, and 11.73%±1.78%, respectively. The sulfate content of LJP-20 and LJP-50 is 1.42% ± 0.09% and 5.47% ± 0.11%, respectively.
[0071] Experiment Example 2. Experiment on bacterial strain proliferation
[0072] (1) Preparation of basal culture medium: Weigh 2g tryptone, 2g yeast extract, 0.1g sodium chloride, 0.04g dipotassium hydrogen phosphate, 0.04g potassium dihydrogen phosphate, 0.01g magnesium sulfate, 0.01g calcium chloride, 2g sodium bicarbonate, 0.5g cysteine hydrochloride, 0.5g taurine bile salt, 0.05g heme, 0.01g vitamin K3, and 2mL Tween 80 into a beaker. Add 1000mL distilled water to the natural pH value. Stir until completely dissolved, then dispense into anaerobic tubes and sterilize at 121℃ for 20min.
[0073] (2) Add prebiotics to the basal culture medium: Add 0.5% LJP-20, LJP-50, DeLJP-20, DeLJP-50, LBP-50, BLBP-50, LESP-50 and LESO-50 to the basal culture medium for screening.
[0074] (3) Bacterial culture: Inoculation with OD 600 An anaerobic culture of 0.6% Weissella spp. was performed with S-shaped horizontal shaking at 60 rpm at 37°C for 24 hours, followed by OD measurement. 600 The supernatant and bacterial precipitate were separated by centrifugation and then frozen separately.
[0075] (4) Polysaccharide consumption determination: Take 50 μL of the supernatant from the culture medium before and after fermentation, and add distilled water to 2.0 mL. Add 50 μL of 80% (w / w) phenol solution, add 2.5 mL of 98% concentrated sulfuric acid, let stand for 10 min, cool to room temperature, vortex to mix, and let stand for another 20 min. Measure the absorbance of the sample at 490 nm. Calculate the total sugar content of the culture medium before and after fermentation according to the standard curve, and then calculate the sugar consumption.
[0076] The results of the polysaccharide consumption analysis of different types of polysaccharides are shown in Table 3:
[0077] Table 3 Sugar consumption after fermentation of different types of polysaccharides
[0078]
[0079] Note: When p < 0.05, different letters in the table represent significant differences (n = 3).
[0080] The results showed that the sugar consumption of LJP-20, LJP-50, DeLJP-20, DeLJP-50, LBP-50, BLBP-50, LESP-50, and LESO-50 before and after fermentation was 57.59%±0.20%, 46.61%±0.92%, 29.97%±1.67%, 46.08%±2.68%, 47.32%±1.18%, 38.00%±0.83%, 21.94%±1.56%, and 44.95%±2.84%, respectively, indicating that LJP-20, LJP-50, DeLJP-50, LBP-50, BLBP-50, LESP-50, and LESO-50 could be well utilized by Weissella.
[0081] (5) Identification and content determination of *Westernella*: DNA was extracted from the test strain and amplified using universal primers 338F (5'-ACTCCTACGGGAGGCAGCAG-3') (SEQ ID NO.1) and 806R (5'-GGACTACHVGGGTWTCTAAT-3') (SEQ ID NO.2). PCR amplification products were detected by 1% agarose gel electrophoresis and then sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results are shown in SEQ ID NO.3. The obtained sequences were annotated by comparing them with the NCBI database using the BLASTN program. The content of *Westernella* was analyzed by qPCR amplification and quantification.
[0082] SEQ ID NO.3:
[0083] GGGGGGCGTGGCCTATACATGCAAGTCGAACGCTTTGTGGTTCAACTG
[0084] ATTTGAAGAGCTTGCTCAGATATGACGATGGACATTGCAAAGAGTGGC
[0085] GAACGGGTGAGTAACACGTGGGAAACCTACCTCTTAGCAGGGGATAA
[0086] CATTTGGAAACAGATGCTAATACCGTATAACAATAGCAACCGCATGGTT
[0087] GCTACTTAAAAGATGGGTTCTGCTATCACTAAGAGATGGTCCCGCGGTGC
[0088] ATTAGTTAGTTGGTGAGGTAATGGCTCACCAAGACGATGATGCATAGCC
[0089] GAGTTGAGAGACTGATCGGCCACAATGGGACTGAGACACGGCCCATA
[0090] CTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGGCGAAAGCC
[0091] TGATGGAGCAACGCCGCGTGTGTGATGAAGGGTTTCGGCTCGTAAAAC
[0092] ACTGTTGTAAGAGAAGAATGACATTGAGAGTAACTGTTCAATGTGTGA
[0093] CGGTATCTTACCAGAAAGGAACGGCTAAATACGTGCCAGCAGCCGCGG
[0094] TAATACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAG
[0095] CGCAGACGGTTATTTAAGTCTGAAGTGAAAGCCCTCAGCTCAACTGAG
[0096] GAATTGCTTTGGAAACTGGATGACTTGAGGTGCAGTAGAGGAAAGTGG
[0097] AACTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAAGAACACCAG
[0098] TGGCGAAGGCGGCTTTCTGGACTGTAACTGACGTTGAGGCTCGAAAGT
[0099] GTGGGTAGCAAACAGGATTAGATACCCTGGGTAGTCCACACCGTAAACG
[0100] ATGAGTGCTAGGTGTTTGAGGGTTTCCGCCCTTAAGTGCCGCAGCTAA
[0101] CGCATAAGCACTCCGCCTGGGGAGTACGACCGCAAGGTTGAAACTCA
[0102] AAGGAATTGACGGGGACCCGCCAAGCGGTGGAGCTGTGGTTTATTCCA
[0103] AGCACGCGAAAACCTTACCGGGCTTGACTCCCTTGACACTCCAAGAAGGAACGTTCCTTCGGGAACAGGTGAAGGGGGG.
[0104] BLAST online analysis and comparison with gene sequences in the database showed that the isolated strain showed 100% homology with *Weissella*. Combined with morphological identification results, it was determined to be *Weissella*. Figure 1 Quantitative results obtained by qPCR analysis of bacterial cell pellets after fermentation in different types of polysaccharide culture media are as follows: Figure 2 As shown. Figure 2 The results showed that the lactic acid bacteria content of LJP-20, LESO-50, and XYLO cultures was significantly higher than that of other polysaccharides. The lactic acid bacteria content of LJP-50, DeLJP-20, and DeLJP-50 was slightly higher than that of LBP-50, BLBP-50, and LESP-50. The lactic acid bacteria content of LESO-50 cultures was significantly increased compared to unhydrolyzed LESP-50 cultures.
[0105] (6) Determination of Weissella's ability to utilize different types of polysaccharides
[0106] Culture medium inoculated with OD 600 The OD was measured after liquid culture of a 0.6% Weissella bacterial suspension. 600 The growth curves of the strains were plotted, and different types of polysaccharides were selected as carbon sources, with glucose as a control, to study the utilization ability of Weissella vesicatoria.
[0107] The assay revealed that *Westernella* was present in higher concentrations in fecal microbiota fermented using LJP-20, LJP-50, DeLJP-20, LESP-50, and LESO-50 as carbon sources. Further investigation was conducted using these polysaccharides to ferment single strains of *Westernella*, with glucose as a control. The basal medium was supplemented with 0.5% LJP-20, LJP-50, DeLJP-20, LESP-50, and LESO-50, respectively, with glucose as a control. After anaerobic culture for 24 hours, the OD values were measured. 600 Growth curves were plotted to analyze the ability of *Westernella* to utilize different types of polysaccharides. Figure 3 As shown, Weissl bacilli grow better in media supplemented with LJP-20 and LESO-50 than with glucose, which is more conducive to the growth and reproduction of Weissl bacilli. They can be used to prepare preparations that promote the proliferation of Weissl bacilli, or as prebiotics to promote the proliferation of Weissl bacilli in the intestine.
[0108] As can be seen from the above embodiments, the present invention provides kelp polysaccharide and shiitake mushroom stem polysaccharide hydrolysates and their application in promoting the proliferation of *Vibrio vulgaris*. The kelp polysaccharide and shiitake mushroom stem polysaccharide hydrolysates prepared by the present invention promote the growth and reproduction of *Vibrio vulgaris* and can be used to prepare formulations that promote the proliferation of *Vibrio vulgaris*.
[0109] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The application of kelp polysaccharide in the preparation of agents that promote the proliferation of Weissella bursa-pastoris, characterized in that, The preparation method of the kelp polysaccharide includes the following steps: S1. Mix kelp powder with water, heat in a water bath at 78-82℃ for 3.5-4.5 hours, filter, and collect filtrate 1 and filter residue; S2. Repeat the extraction of the filter residue once, filter, and collect filtrate 2 under the same extraction conditions as S1; S3. Combine filtrate 1 and filtrate 2, concentrate, and obtain kelp extract concentrate; S4. Add ethanol to the kelp extract concentrate to make the final ethanol concentration 18-22% v / v. After centrifugation, take the precipitate and dissolve it in water. Dialyze it through an 8000-12000 Da dialysis bag, take the solution in the dialysis bag, concentrate it, and freeze-dry it to obtain kelp polysaccharide. The mass-to-volume ratio of kelp powder to water is 20g: 900-1100mL.
2. The application according to claim 1, characterized in that, After combining filtrate 1 and filtrate 2, concentrate to 8-12% of the original volume.
Citation Information
Patent Citations
Method for comprehensively extracting algal polysaccharide, algal polyphenol and fucoxanthine
CN108034008A