Recombinant filamentous fungus transformant screening method based on Zhongshengmycin resistance

Abstract

The invention discloses a recombinant filamentous fungus transformant screening method based on Zhongshengmycin resistance. The Zhongshengmycin is used as a pressure source for screening filamentous fungus gene modification transformants, and the nat gene is used as a Zhongshengmycin resistance gene, so that exogenous DNA can be efficiently integrated into a filamentous fungus genome with low background. According to Zhongshengmycin resistance-based transformant screening, the transformation efficiency is not lower than that of common markers, and the genetic background is far lower than that of common antibiotics of filamentous fungi such as hygromycin. An efficient selection marker is added for rational transformation of filamentous fungi, multiple antibiotics including zhongshengmycin, hygromycin and the like can be used in the same wild type strain for multiple screening, the gene continuous transformation difficulty of the strain is greatly reduced, the continuous genetic transformation mode of a filamentous fungi synthetic biological chassis is enriched, and the application prospect is wide. The method expands thinking for construction of industrial filamentous fungus microbial cell factories, and has important reference value for high-throughput screening of other filamentous fungi.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a method for screening recombinant filamentous fungi transformants based on sinomorph resistance. The present invention uses sinomorph, a low-cost pesticide antibiotic, as a pressure source for screening filamentous fungal gene-modified transformants, and uses the nourseothricin acetyltransferase nat gene as a sinomorph resistance gene, which can integrate exogenous DNA into the filamentous fungal genome with low background and high efficiency. Based on the screening of transformants resistant to sinomorph, the transformation efficiency is not lower than that of commonly used markers, and the genetic background is much lower than that of commonly used antibiotics for filamentous fungi such as hygromycin. This method adds an efficient screening marker to the rational transformation of filamentous fungi, greatly reduces the difficulty of continuous genetic transformation of strains, and enriches the continuous genetic transformation method of the synthetic biology chassis of filamentous fungi. Background Art

[0002] Filamentous fungi have important economic value and are widely used in the field of biomanufacturing. For example, Aspergillus niger and Aspergillus oryzae are commonly used fermentation strains in industry, which can produce a variety of organic acids such as citric acid, malic acid, kojic acid, etc., and can also secrete a variety of hydrolases such as amylase, saccharifying enzyme, and protease at high levels. Aspergillus terreus is a commonly used strain for industrial production of products such as itaconic acid, aconitic acid, and lovastatin. Trichoderma reesei is often used for high production of cellulase. Filamentous fungi not only have the ability to produce high-quality proteins or metabolites, but also have the ability to produce heterologous proteins and heterologous products. Whether it is to increase the yield of metabolites of filamentous fungi themselves or to express heterologous products, it is necessary to construct and screen genetically modified strains.

[0003] Directed genetic modification of filamentous fungi can be an efficient method to obtain high-yield strains, but genetic modification of filamentous fungi is currently difficult. Given the current low transformation efficiency of filamentous fungi and limited screening markers, it is extremely difficult to continuously modify the same strain. This is because continuous modification of the same strain involves the problem of marker recovery, and the introduction of exogenous nucleases to recover markers will increase the growth pressure of the host. In addition, the commonly used nutritional deficiency screening method can only be used for defective strains, has a limited scope of application, and affects the production performance of the strain, and is not suitable for production chassis modification. A more desirable method is to develop a new and efficient resistance screening scheme.

[0004] Common resistance screening methods for filamentous fungi mainly include hygromycin / hygR. Hygromycin has the advantages of good stability (screening cost 244.6 yuan / L culture medium), wide application of filamentous fungi, etc., and is the most commonly used resistance screening method. However, the background growth of filamentous fungi in hygromycin culture medium is strong, which makes the screening efficiency far less than nutritional deficiency screening methods such as pyrG uridine / uracil. However, the premise of using nutritional deficiency screening methods is to construct corresponding nutritional deficiency strains. Constructing nutritional deficiency strains in filamentous fungi not only requires additional workload, but also nutritional deficiency itself will damage the production characteristics of the strain. It can be seen that the lack of efficient genetic modification resistance screening methods in filamentous fungi seriously limits its development as a synthetic biology chassis.

[0005] Researchers have also developed some other resistance screening methods in filamentous fungi, such as the pyrithiamine (screening cost 131.8 yuan / L culture medium) / ptrA screening method. Pyrithiamine is a vitamin analog that competitively binds to vitamin B1. The full length of the pyrithiamine resistance gene is 2002bp, which is much larger than the 1023bp of the hygromycin resistance marker, which not only increases the difficulty of vector construction, but also reduces the efficiency of transformant screening. As an atypical resistance screening method, the pyrithiamine screening method can only have a screening effect in non-natural culture media with limited nutrients. As we know, transformants on non-natural culture media often take an additional 3-5 days to grow, which greatly affects the screening efficiency. In addition, some studies have attempted to introduce antibiotics such as zeocin and G418 into yeast for screening of filamentous fungal transformants, but filamentous fungi are often insensitive to these antibiotics.

[0006] In summary, the current screening methods for transformants of directed transformation of filamentous fungi are limited and generally have various defects. There is an urgent need for a resistance screening method with high screening efficiency, low background, wide applicability, convenient vector construction, and low cost for rapid filamentous fungal gene modification and transformant acquisition. Summary of the invention

[0007] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide a method for screening recombinant filamentous fungi transformants based on zhongshengmycin resistance. The present invention adopts PEG-mediated protoplast transformation to introduce an expression vector with zhongshengmycin resistance gene nat into fresh protoplasts of filamentous fungi to screen and obtain transformants; the transformed protoplasts are placed on a culture medium containing zhongshengmycin, and only gene-inserted transformants can grow. After genome verification and phenotypic verification, the correct transformants can be efficiently screened out. The present invention introduces zhongshengmycin, a novel filamentous fungal antibiotic, and its resistance gene nourseothricin acetyltransferase nat, which significantly enriches the screening method of filamentous fungal genetic modification, and can be used for wild-type strain directional modification. It has high screening positive rate, low background growth, wide application range, and low drug cost (screening cost 1.04 yuan / L culture medium), which can greatly help the deep transformation of filamentous fungal industrial strains.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] Application of nourseothricin acetyltransferase nat gene as a selection marker gene in the screening of sinothricin resistance.

[0010] Furthermore, the nourseothricin acetyltransferase nat gene is used as a selection marker gene in the selection of filamentous fungal transformants with resistance to streptomycin.

[0011] Furthermore, the nourseothricin acetyltransferase nat gene is used as a selection marker gene in the preparation of a filamentous fungus target gene expression strain and / or a transgenic filamentous fungus strain.

[0012] Furthermore, the application of biological materials related to the nourseothricin acetyltransferase nat gene in the preparation of filamentous fungal target gene expression strains and / or transgenic filamentous fungal strains.

[0013] Further, the filamentous fungus includes at least one of Aspergillus and Trichoderma, etc.; preferably includes at least one of Aspergillus niger, Aspergillus oryzae, Aspergillus terreus, Aspergillus nidulans, Trichoderma reesei and Aspergillus fumigatus.

[0014] Furthermore, the final concentration of Zhongshengmycin is 0.2 to 2 g / L; preferably 0.24 to 1.2 g / L; more preferably 0.24 to 0.48 g / L.

[0015] The biological material related to the nourseothricin acetyltransferase nat gene is at least one of the following materials:

[0016] (a) an expression cassette containing the above-mentioned nourseothricin acetyltransferase nat gene;

[0017] (b) a recombinant expression vector containing the above-mentioned nourseothricin acetyltransferase nat gene;

[0018] (c) a recombinant expression vector containing the expression cassette described in (a);

[0019] (d) a recombinant microorganism containing the above-mentioned nourseothricin acetyltransferase nat gene;

[0020] (e) a recombinant microorganism containing the expression cassette described in (a);

[0021] (f) A recombinant microorganism containing the recombinant expression vector described in (b) or (c).

[0022] Furthermore, the expression cassette in (a) includes a promoter, a nourseothricin acetyltransferase gene nat, and a terminator; preferably, the promoter includes a constitutive promoter, such as a promoter PtrpC, etc.; and the terminator includes a terminator TpyrG, etc.

[0023] Further preferably, the nucleotide sequence of the expression cassette is as shown in SEQ ID NO.2.

[0024] Furthermore, the starting vector of the recombinant expression vector described in (b) and (c) can be any filamentous fungal expression plasmid, including but not limited to pFC330, pFC332, T vector and other expression plasmids containing filamentous fungal promoter, terminator and selection marker.

[0025] Furthermore, the host microorganism corresponding to the recombinant microorganism in (d), (e) and (f) is selected from filamentous fungi, etc. The filamentous fungi include fungi such as Aspergillus. More specifically, the filamentous fungi is Aspergillus niger.

[0026] In one embodiment, in order to better achieve the expression of nourseothricin-resistant filamentous fungi, the nourseothricin acetyltransferase nat gene can be codon-optimized for the corresponding filamentous fungi (such as Aspergillus niger).

[0027] The nourseothricin acetyltransferase nat is derived from Streptomyces noursei, and its amino acid sequence is shown in SEQ ID NO.1; the nucleotide sequence after Aspergillus niger codon optimization is shown in SEQ ID NO.2, bp 325 to 897.

[0028] A method for screening recombinant filamentous fungal transformants based on zhongshengmycin resistance comprises the following steps:

[0029] (1) transforming a recombinant expression vector containing a nourseothricin acetyltransferase nat gene into filamentous fungal protoplasts to obtain protoplasts containing the recombinant expression vector;

[0030] (2) culturing the protoplasts containing the recombinant expression vector in step (1) on a culture medium plate containing Zhongshengmycin to obtain growing transformed protoplasts;

[0031] (3) Further verifying the transformed protoplasts obtained in step (2) to obtain recombinant filamentous fungal transformants.

[0032] Furthermore, in step (1), the expression cassette of the nourseothricin acetyltransferase nat gene is connected to the expression cassette of the target gene to construct a filamentous fungus recombinant expression vector.

[0033] Furthermore, the target gene includes a reporter gene, etc.; preferably a fluorescent protein gene, etc., more preferably a green fluorescent protein gene, but not limited thereto.

[0034] Preferably, the expression cassette comprises a promoter and a terminator;

[0035] Further preferably, the expression cassette of the nourseothricin acetyltransferase nat gene comprises a promoter PtrpC, a nourseothricin acetyltransferase nat gene and a terminator TpyrG; and the expression cassette of the target gene comprises a promoter Ptef, a target gene and a terminator Ttef.

[0036] Further, in step (1), the method used for the transformation is a PEG-mediated protoplast transformation method, specifically referring to the filamentous fungus industrial microorganism protoplast transformation method. Simply put, 0.1-1.0g of fresh bacterial cells are hydrolyzed with 20mL of enzymatic solution containing 0.1% snail enzyme, 0.1% cellulase, and 0.05% lytic enzyme, 30°C, 100r / min enzymatic hydrolysis for 3-5h, and then the fresh protoplasts are collected through four layers of filter cloth, washed twice with STC buffer, resuspended with 1mL STC buffer, and finally dispensed into 160μL; 60μL of PEG 4000 buffer and 100μL of filamentous fungus recombinant expression vector with a concentration greater than 200ng / μL are added, incubated on ice for 30min, and then 1.5mL of PEG 4000 buffer is added, and incubated at room temperature for 25min to obtain a protoplast transformation solution.

[0037] Preferably, the protoplast particles are full, have intracellular circulation, are highly active, do not aggregate, and the number of protoplasts is greater than 100,000 / mL.

[0038] The protoplast transformation solution is spread on a high osmotic CD medium plate containing Zhongshengmycin and placed in a dark environment at 30°C for static culture. Only successfully transformed protoplasts can grow in the medium containing Zhongshengmycin.

[0039] The PEG 4000 buffer is composed of a solute and a solvent, wherein the solute is PEG 4000 60% w / v, calcium chloride 50mM, pH=7.5 Tris-HCl 10mM, and the rest is a solvent, which is distilled water. After the solvent and the solute are mixed, sterilization is performed by a membrane.

[0040] The STC buffer solution is composed of a solute and a solvent, wherein the solute is 1.2 M sorbitol, 100 mM calcium chloride, 10 mM Tris-HCl, pH = 7.5, and the rest is a solvent, which is distilled water. After the solvent and the solute are mixed, sterilization is performed by a membrane.

[0041] The hypertonic CD medium is composed of a solute and a solvent, wherein the solute is 1M sucrose, 3g / L sodium nitrate, 2g / L potassium chloride, 1g / L potassium dihydrogen phosphate, 0.5g / L magnesium sulfate heptahydrate, and 0.01g / L iron sulfate heptahydrate, and the rest is a solvent, which is distilled water. If 15-20g / L agar is added to the solid medium, the solvent and the solute are mixed and sterilized by high-pressure steam at 115°C for 20min.

[0042] Furthermore, in step (2), the final concentration of the zhongshengmycin is 0.2 to 2 g / L; preferably 0.24 to 1.2 g / L; more preferably 0.24 to 0.48 g / L.

[0043] The Zhongshengmycin mother solution is composed of a solute and a solvent. The solute of each 20 mL Zhongshengmycin mother solution is 600 mg of Zhongshengmycin, and the rest is a solvent. The solvent is water. After the solvent and the corresponding solute are mixed, centrifuged at 3500r / min for 5 minutes, and the supernatant is sterilized by a 0.22μm water filter membrane.

[0044] The protoplasts were placed in a hypertonic CD medium containing zhongshengmycin and cultured for about 4 days, and further screening and verification were performed to obtain the correct transformants.

[0045] Compared with the prior art, the present invention has the following advantages and effects:

[0046] (1) The present invention is the first to use nat and nourseothricin acetyltransferase gene nat as nat resistance genes to screen transformants of filamentous fungi, and the transformation efficiency is not lower than that of the nutritional deficiency screening method, such as the orotidine-5′-phosphate decarboxylase pyrG screening method that complements the uridine / uracil nutritional deficiency. In the same batch, the number of transformants obtained by the nat / nat screening method was 12, of which 9 were correctly inserted, and the screening efficiency was 75%; correspondingly, the number of transformants obtained by the pyrG complement screening method was 8, of which 4 were correctly inserted, and the screening efficiency was 50%.

[0047] (2) The present invention successfully used the nourseothricin acetyltransferase nat gene as a neutrophil resistance gene in filamentous fungi for the first time. The nat coding nucleotide sequence is only 570 bp, which is much smaller than the 1023 bp coding region of the hygromycin B resistance gene hygromycin B phosphotransferase gene hygR, and also smaller than the 823 bp coding region of the uridine / uracil auxotrophic complement gene pyrG, which can significantly reduce the difficulty of constructing vectors in genetic modification.

[0048] (3) The present invention uses Zhongshengmycin to screen filamentous fungal transformants, which has a low growth background and high screening efficiency compared to the commonly used hygromycin B. The unit market price is only 1 / 235 of that of the commonly used antibiotic hygromycin B for filamentous fungi, which greatly reduces the cost of filamentous fungal transformation;

[0049] (4) The present invention introduces zhongshengmycin into the resistance screening of filamentous fungal transformants. This method has low growth background, low screening cost, simple genetic modification, and high modification efficiency, and is a very effective way to screen transformants. Zhongshengmycin resistance screening can be combined with other resistance markers such as hygromycin B resistance screening to efficiently perform continuous modification of multiple genes in the same wild-type strain.

[0050] (5) The method of the present invention can significantly shorten the transformation cycle of filamentous fungal protoplasts, avoid label recovery, simplify the operation process, and improve the transformation success rate and screening efficiency of filamentous fungi. It expands the ideas for constructing industrial filamentous fungal microbial cell factories and has important reference value for high-throughput screening of other filamentous fungi. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below. Obviously, the drawings described below are only for the present invention to protect some embodiments. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0052] Figure 1 This is a diagram showing the effect of the Zhongshengmycin used in Example 1 of the present invention on inhibiting spore germination;

[0053] Figure 2 This is a diagram showing the effect of Zhongshengmycin used in Example 1 of the present invention on inhibiting protoplast germination;

[0054] Figure 3 Schematic diagram of the construction process of the p14pn vector used in Example 1 of the present invention;

[0055] Figure 4 This is the growth diagram of the transformants on the high-osmotic CD plate of Zhongshengmycin used in Example 1 of the present invention;

[0056] Figure 5This is a green fluorescence microscopic observation image of the Golgi apparatus localization of the transformant used in Example 1 of the present invention;

[0057] Figure 6 This is the overall flow chart of Example 1 of the present invention. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. If specific experimental conditions are not indicated in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally used. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0059] The strains, raw materials, reagents and instruments involved in the present invention: Aspergillus niger CBS-CT is disclosed in the document "Dong Hongzhi. Establishment of Aspergillus niger CRISPR genome editing technology and research on endoplasmic reticulum phospholipid regulation mechanism [D]. South China University of Technology." and is a material preserved in this laboratory. Escherichia coli Mach1 T1 competent cells are materials preserved in this laboratory. The chemical reagents and drugs involved in the present invention: sodium chloride, citric acid, potassium chloride, glucose, magnesium sulfate heptahydrate, potassium dihydrogen phosphate (Tianjin Damao Chemical Reagent Factory), snail enzyme, cellulase (Beijing Dingguo Changsheng Biotechnology Company), peptone, yeast powder (UK OXOID Company), dimethyl sulfoxide (DMSO), polyethylene glycol (PEG4000), Tris, sorbitol, anhydrous calcium chloride, ampicillin, lysozyme, uridine, Triton X-100 (Sigma, USA), 12% Zhongshengmycin water-soluble powder (Fujian Kaili Biological Products Co., Ltd.), CAS number of Zhongshengmycin: 861228-39-9, PDA medium (Shanghai Bowei Microbiology Technology Co., Ltd.), agarose, restriction endonuclease, Rapid Taq Master Mix (Nanjing Novozyme Biotechnology Co., Ltd.), Max DNA polymerase, Snap Assembly MasterMix, DNA marker, 6× Loading buffer, pMD-18T vector (TaKaRa, Japan), GelRed nucleic acid dye (Biotum, USA), Miracloth filter cloth (Merck, Germany), PCR product purification kit, plasmid large-scale extraction kit (Guangzhou Jiebei Biotechnology Co., Ltd.), other chemical reagents and drugs are domestic or imported analytical grade or above; the main instruments and equipment involved in the present invention: NanoDrop1000 micro-spectrophotometer (Thermo Fisher, USA), high pressure sterilizer (MLS-3750, SANYO, Japan), DNA gel electrophoresis instrument (Bio-Rad, USA), DNA gel imager (CareStream, USA) Health Company), mold incubator (SHP-450D, Shanghai Senxin Experimental Instrument Co., Ltd.), constant temperature air bath shaker (Suzhou Peiying Experimental Instrument Co., Ltd.), pipette gun, small desktop centrifuge (Eppendorf, Germany), clean bench (SW-CJ-1FD, Suzhou Purification Co., Ltd.), ice machine (IMS-20 Guangzhou Shenhua Biotechnology Co., Ltd.), ultrapure water meter (Shanghai Lingde Instrument Co., Ltd.), pH meter, high-precision balance (Sartorius, Germany), vortex oscillator (SCILOGEX, USA), vacuum pump (DOA-P70-BN, PALL, USA).

[0060] The pFC332 plasmid used in the example is disclosed in the document “CN115851804A, A Aspergillus niger base editing system and its construction method and application”.

[0061] Example 1

[0062] The present invention first verifies whether Zhongshengmycin can inhibit the growth of filamentous fungal spores and protoplasts, then verifies whether the nourseothricin acetyltransferase nat gene can be used as a resistance screening gene for filamentous fungi to Zhongshengmycin, and confirms whether Zhongshengmycin resistance screening can be used as a screening marker for genetic modification of filamentous fungi. Endogenous genes, functional proteins, and fusion proteins can be selected according to actual needs to apply this method for expression or knockout. The transformation method used below is a better experimental method selected by the inventor, and the sequences and materials used are all obtained from public channels by those skilled in the art as needed, but the embodiments of the present invention are not limited to this method.

[0063] (1) Sensitivity of fresh Aspergillus niger spores to different concentrations of spores: 0.1 mL of Aspergillus niger CBS-CT spores in a glycerol tube were spread on a PDA plate and incubated at 30°C for 5 days. The spores were collected with sterile water and the concentration was adjusted to 108 Pipette 10 6 Spores and 10 5 The spores were plated on PDA plates with different concentrations of sinoprotinin (0, 0.12, 0.24, 0.48, 0.96, and 1.92 g / L) and incubated at 30 °C for 4 days to observe the growth of the spores. Figure 1 As shown in the figure, it can be seen that adding 0.24 g / L or higher concentration of zhongshengmycin to the PDA plate can completely inhibit the growth of Aspergillus niger spores.

[0064] (2) Cultivation of Aspergillus niger mycelium: 10 4 The spores of Aspergillus niger CBS-CT were inoculated into a conical flask containing 100 mL DPY medium (2.0% monohydrate glucose, 0.5% yeast extract, 1% tryptone, 0.5% potassium dihydrogen phosphate, 0.05% magnesium sulfate heptahydrate), and cultured in a shaking incubator at 30°C and 220 r / min for 2 days. The cells were collected by filtration, and the mycelia were washed twice with distilled water and 0.8 M sodium chloride in turn. 0.6 g was taken and added to 20 mL of sterile enzymatic solution containing 0.1% snail enzyme, 0.1% cellulase, and 0.05% lytic enzyme, and enzymatically hydrolyzed at 30°C and 100 r / min for 4 hours to release abundant protoplasts. Freshly enzymatically hydrolyzed protoplasts were filtered through four layers of Miracloth, then washed twice with a hypertonic solution STC buffer (10 mM Tris-HCl, 1.2 M sorbitol, 100 mM calcium chloride, pH 7.5, first fixed to volume and then adjusted to pH, sterilized by 0.22 μm membrane filtration), resuspended with 1 mL STC buffer, and 160 μL of protoplasts were dispensed into 2 mL EP tubes and stored at 4°C.

[0065] (3) Zhongshengmycin inhibited protoplast germination: different concentrations (2.5×10 7 / mL, 5×10 7 / mL, 20×10 7 160 μL of protoplasts (100 μL / mL) were coated on a plate containing 1M sucrose medium (1M sucrose, 2g / L potassium chloride, 1g / L potassium dihydrogen phosphate, 3g / L sodium nitrate, 0.5g / L magnesium sulfate heptahydrate, 0.01g / L ferrous sulfate heptahydrate) and 0.24g / L Zhongshengmycin, and incubated at 30°C in the dark for 4 days to observe the growth of the protoplasts. Figure 2 As shown in the figure, 0.24 g / L of zhongshengmycin in hypertonic CD medium can completely inhibit 5×10 7 / mL concentration of protoplasts germinated. Even 20×10 7 There was also little background growth of protoplasts at a concentration of 100 / mL, which indicated that Zhongshengmycin was also effective in inhibiting filamentous fungal protoplasts with a high upper limit.

[0066] (4) Construction of Zhongshengmycin resistance expression vector:

[0067] Using pFC332 plasmid as template, primers PtrpC-F / R were used to amplify PtrpC, the nucleotide sequence of which is shown in 1-324 bp of SEQ ID NO.2. Using pUC57-nat-T (pUC57-nat-T was purchased from Nanjing GenScript Biotech Co., Ltd., in which the nat nucleotide sequence was synthesized after Aspergillus niger codon optimization) as template, MaxDNA Polymerase uses forward primer nat-F and reverse primer nat-R to amplify nat-T, the nucleotide sequence of which is shown in SEQ ID NO.2, 325 to 935 bp. Max DNA Polymerase was used to amplify p14p with the forward primer pyrGdn-F and the reverse primer Ttef-R to remove the linearized plasmid backbone p14 of ANpyrG, and the above fragments were purified using a DNA purification kit. Snap Assembly Master Mix connects PtrpC and nat-T to the linearized plasmid backbone p14 and transforms them into competent E. coli Mach1 T1 cells. Finally, an early Golgi localization vector expressing sed5-megfp fusion protein at the pyrG site with a sed5 resistance marker is obtained, which is denoted as p14pn. The schematic diagram of the construction process of the p14pn vector is shown in Figure 3 shown.

[0068] Among them, the construction process of the p14p plasmid is as follows: the universal expression vector constructed based on pMD18T is used as the starting vector (the universal expression vector constructed based on pMD18T is disclosed in the document "Zheng J, Yao L, Zeng X, et al. ERV14 receptor impacts mycelial growth via its interactions with cell wall synthase and transporters in Aspergillus niger [J]. Frontiers in Microbiology, 2023, 14. DOI: 10.3389 / fmicb.2023.1128462.", including: the promoter and terminator are Ptef and Ttef, leaving the restriction site BglII in the middle, and then ANpyrG as a screening marker, and the upstream and downstream 1000bp fragments of pyrG are used as homologous arms at both ends), and a vector for fluorescent localization of the Golgi apparatus is constructed, the expression frame Ptef-sed5-megfp-Ttef, recorded as p14p. sed5 is a gene commonly used by Aspergillus niger to locate the early Golgi apparatus, with gene access number: NCBI Reference Sequence: XM_001400392.3, and protein access number: NCBI Reference Sequence: XP_001400429.1. megfp is a green fluorescent protein gene optimized by Aspergillus niger codons, and its nucleotide sequence is shown in SEQ ID NO.2 in Chinese Patent Publication No. CN117965416A. sed5 and megfp are connected by GA5 linker (nucleotide sequence of GA5 linker: ggcgcaggcgccggcgcaggcgccggcgca) to obtain the fusion gene sed5-megfp.

[0069] The primers used are as follows, all of which were synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.:

[0070] Forward primer PtrpC-F: 5′-gctagtggaggtcaacacat-3′;

[0071] Reverse primer PtrpC-R: 5′-ttggatgcttgggtagaatagg-3′;

[0072] Forward primer nat-F: 5′-tattctacccaagcatccaaatgaccacacttgatgacac-3′;

[0073] Reverse primer nat-R: 5′-cccttttagtcaataccgttac-3′;

[0074] Forward primer pyrGdn-F: 5′-aacggtattgactaaaagggcggatacggaagcggaaac-3′;

[0075] Reverse primer Ttef-R: 5′-atgtgttgacctccactagcgtattgggatgaattttgtatgcac-3′.

[0076] (5) Protoplast transformation:

[0077] In step (1), the newly prepared 2.5×10 7 60 μL of PEG 4000 buffer (60% (w: v) PEG4000, 50 mM calcium chloride, 10 mM Tris-HCl, pH 7.5, make up to volume first and then adjust pH, sterilize at high temperature and high pressure) and 100 μL of linearized p14pn vector with a concentration greater than 200 ng / μL were added to protoplasts with a concentration of 100 ng / μL. The linearized pyrG complementation vector p14p with the same concentration was used as a control. The cells were incubated on ice for 30 min and gently inverted every 10 min to mix. Then, 1.5 mL of PEG 4000 buffer was added and incubated at room temperature for 25 min to obtain the protoplast transformation solution.

[0078] The protoplast transformation solution was spread on a hypertonic CD plate containing 0.24 g / L zhongshengmycin and placed in a dark environment at 30°C for 4 days. The protoplast transformation solution without carrier was placed on a normal hypertonic CD plate and a hypertonic CD plate containing 0.24 g / L zhongshengmycin in sequence as a positive control (positive control), a negative control (negative control), and a transformation control (pyrG control) on a normal hypertonic CD plate with pyrG complementation. After 4 days of culture, the following observations were made: Figure 4 As shown, the positive control plate grew normally, the negative control plate had no transformant growth, but a small amount of gray contaminated bacteria, and the transformant with dispersed hyphae grew on the transformation plate, and there was no background growth. After further sequencing verification, positive transformants were obtained. In this batch, the number of transformants obtained by the nat / zhongshengmycin screening method was 12, of which 9 were correctly inserted, and the screening efficiency was 75%; correspondingly, the number of transformants obtained by the back-filling pyrG screening method was 8, of which 4 were correctly inserted, and the screening efficiency was 50%.

[0079] (6) Transformant expression verification of Zhongshengmycin resistance screening:

[0080] To verify that the recombinant protein SED5-MEGFP screened in the transformants with sedoxins resistance can be expressed normally.

[0081] Take the transformed sporozoites and inoculate them in DPY medium for overnight culture. Under a fluorescence microscope with a 10x eyepiece and a 40x objective lens, use a fluorescent light source to observe the expression of fluorescent protein in the transformant hyphae, and use a visible light source to observe the morphology of hyphae in the same field of view. The typical morphology of germinating hyphae is as follows: Figure 5 As shown. Figure 5 It can be seen that the transformants emit obvious early Golgi punctate distribution fluorescence, indicating that the transformants screened for resistance to sinoprotegerin can be used to express exogenous proteins, which further verifies the feasibility of this scheme in resistance screening of Aspergillus transformants.

[0082] The overall process of this embodiment is as follows: Figure 6 As shown, first, the inhibitory concentration of nourseothricin on fresh spores and protoplasts of filamentous fungi is confirmed respectively, then the expression plasmid containing nourseothricin acetyltransferase nat is transformed into the protoplasts of filamentous fungi and placed on a nourseothricin plate to screen transformants, and finally the correct transformants are obtained through genome verification and phenotypic verification.

[0083] In the description of this specification, the description with reference to the terms "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner.

[0084] The preferred embodiments of the present invention disclosed above are only used to help explain the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to only specific implementation methods. Obviously, many modifications and changes can be made according to the content of this specification. This specification selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and use the present invention well. The present invention is limited only by the claims and their full scope and equivalents.

[0085] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of nourseothricin acetyltransferase nat gene as a selection marker gene in the screening of sinothricin resistance.

2. The use according to claim 1, characterized in that: Application of nourseothricin acetyltransferase nat gene as selection marker gene in screening filamentous fungal transformants with sinothricin resistance.

3. The use according to claim 2, characterized in that: The invention discloses an application of the nourseothricin acetyltransferase nat gene as a screening marker gene in preparing a filamentous fungus target gene expression strain and / or a transgenic filamentous fungus strain.

4. Use of biological materials related to the nourseothricin acetyltransferase nat gene in the preparation of target gene expression strains of filamentous fungi and / or transgenic filamentous fungal strains, characterized in that: The biological material related to the nourseothricin acetyltransferase nat gene is at least one of the following materials: (a) an expression cassette containing the above-mentioned nourseothricin acetyltransferase nat gene; (b) a recombinant expression vector containing the above-mentioned nourseothricin acetyltransferase nat gene; (c) a recombinant expression vector containing the expression cassette described in (a); (d) a recombinant microorganism containing the above-mentioned nourseothricin acetyltransferase nat gene; (e) a recombinant microorganism containing the expression cassette described in (a); (f) A recombinant microorganism containing the recombinant expression vector described in (b) or (c).

5. The use according to any one of claims 1 to 4, characterized in that: Nourseothricin acetyltransferase nat is derived from Streptomyces noursei. Further, its amino acid sequence is shown in SEQ ID NO.

1.

6. The use according to any one of claims 1 to 4, characterized in that: The final concentration of Zhongshengmycin is 0.2-2 g / L; further 0.24-1.2 g / L; further 0.24-0.48 g / L.

7. The use according to any one of claims 1 to 4, characterized in that: The filamentous fungus includes at least one of Aspergillus and Trichoderma; and further includes at least one of Aspergillus niger, Aspergillus oryzae, Aspergillus terreus, Aspergillus nidulans, Trichoderma reesei and Aspergillus fumigatus.

8. A method for screening recombinant filamentous fungal transformants based on zhongshengmycin resistance, characterized in that: The steps include: (1) transforming a recombinant expression vector containing a nourseothricin acetyltransferase nat gene into filamentous fungal protoplasts to obtain protoplasts containing the recombinant expression vector; (2) culturing the protoplasts containing the recombinant expression vector in step (1) on a culture medium plate containing Zhongshengmycin to obtain growing transformed protoplasts; (3) Further verifying the transformed protoplasts obtained in step (2) to obtain recombinant filamentous fungal transformants.

9. The method for screening recombinant filamentous fungi transformants based on Zhongshengmycin resistance according to claim 8, characterized in that: In step (2), the final concentration of the zhongshengmycin is 0.2 to 2 g / L; further 0.24 to 1.2 g / L; further 0.24 to 0.48 g / L.

10. The method for screening recombinant filamentous fungi transformants based on Zhongshengmycin resistance according to claim 8, characterized in that: The filamentous fungus includes at least one of Aspergillus and Trichoderma; and further includes at least one of Aspergillus niger, Aspergillus oryzae, Aspergillus terreus, Aspergillus nidulans, Trichoderma reesei and Aspergillus fumigatus.

Images