Application of soybean argonaute family gene Gmago5 in improving yield and quality

Abstract

The application discloses application of a soybean ARGONAUTE family gene GmAGO5. A soybean GmAGO5 protein coding gene GmAGO5 has a nucleotide sequence as shown in SEQ ID NO. 1. A plant gene editing knock-out vector pSCM-GmAGO5 is constructed and transformed into a receptor material Tianlong No. 1 by using a cotyledon node transformation method. By knocking out the GmAGO5 gene, the gene edited soybean plant height is reduced, the branch angle is reduced, and the soybean seed protein content is significantly improved. It can be seen that the soybean GmAGO5 protein coding gene GmAGO5 can be applied to reducing the soybean plant height, reducing the branch angle and improving the soybean seed protein content by means of genetic engineering.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant genetic engineering, and relates to application of a soybean ARGONAUTE family gene GmAGO5. Specifically, the present application relates to application of an ARGONAUTE family gene GmAGO5 derived from cultivated soybean, which is highly expressed in roots and pods and is related to regulation of soybean plant type and seed development, in regulation of plant height, branch angle, and protein content, and other plant type and quality traits. BACKGROUND

[0002] Human diet and livestock feed mainly come from cereal and legume crops, among which soybean (Glycine max L.) originated in China, and its seeds contain rich protein and oil, so it has a wide application in the fields of agriculture and industry. As a short-day crop, soybean is planted in a wide geographical area, and plant height and branch angle are important plant architecture traits of soybean, which have important influence on its yield (Yang Shengxian et al., 2011). Especially in the mode of soybean-corn strip interplanting, plant height and branch angle determine the planting characteristics of soybean against lodging and dense planting, and further determine the yield of soybean under high-density planting, while yield traits often show a negative correlation with quality traits. Therefore, it is an important breeding goal in soybean breeding to improve yield as much as possible while ensuring that the fat and protein content in soybean seeds does not change greatly. Therefore, it has important application value to excavate genes that can simultaneously regulate soybean plant height, branch angle and protein content for breeding soybean varieties with ideal plant type, high yield, high quality and good adaptability. AGO protein (Argonaute protein) is a kind of protein widely existing in animals, plants and microorganisms, and has a high degree of conservation. The main conserved domains include PAZ and PIWI. AGO protein exerts its function by binding with sRNA: first, it exerts its function by affecting the transcription pathway or inhibiting the translation process to control the downstream target genes; second, it regulates the methylation of the DNA sequence of the downstream genes to activate or inhibit the expression of the downstream genes; third, it regulates the histone modification of the genes to regulate the expression of the genes. The number of AGO family members also varies in different species. For example, there are 27 AGO genes in the genome of microorganism nematode; in plants, such as Arabidopsis thaliana genome and rice genome, there are 10 AGO genes and 19 AGO genes respectively, and the AGO protein family in maize and soybean is 17 and 22 respectively, which are consistent with the classification in Arabidopsis thaliana; in animals, there are 5 AGO genes in the genome of fruit fly (Cai Jianyu et al., 2017). Previous studies have shown that AGO protein is involved in the defense of plants against viruses and also participates in the RNA-based immune response of viruses (Morel JB et al., 2002). However, there are few studies on the regulation of AGO protein on plant architecture and seed development, especially on soybean plant height, branch angle and protein content. SUMMARY

[0003] The purpose of the present application is to disclose the application of a soybean ARGONAUTE family gene GmAGO5.

[0004] Another purpose of the present application is to provide the genetic engineering application of the gene in regulating soybean plant height, branch angle and protein content.

[0005] The object of the application can be achieved by the following technical solutions:

[0006] The nucleotide sequence of the soybean ARGONAUTE family gene GmAGO5 is: SEQ ID NO. 1.

[0007] The protein encoded by the cultivated soybean ARGONAUTE family gene GmAGO5 has an amino acid sequence of SEQ ID NO. 2.

[0008] The gene editing vector containing the soybean ARGONAUTE family gene GmAGO5.

[0009] The application of the cultivated soybean GmAGO5 protein coding gene GmAGO5 in improving the plant type and quality of gene editing plants.

[0010] As a preferred embodiment of the application, the transgenic soybean with GmAGO5 knocked out by CRISPR / Cas9 technology has a reduced plant height, a reduced branch angle, and a significantly increased protein content.

[0011] When constructing a plant expression vector using GmAGO5, any enhanced promoter or inducible promoter can be added before the transcription initiation nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a selectable marker gene (GUS gene, GFP gene, etc.) or an antibiotic marker (gentamicin marker, kanamycin marker, hygromycin marker, etc.) resistant gene that can be expressed in plants. For the safety of transgenic plants, no selectable marker gene can be added, and the transformed plants can be directly screened for phenotypic traits.

[0012] The plant expression vector carrying the GmAGO5 of the application can be transformed into plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc. The transformed plant tissues are cultivated into plants. The transformed plant hosts can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis, soybean, rape, cucumber, tomato, poplar, turf grass, and alfalfa.

[0013] Beneficial effects:

[0014] The GmAGO5 in the application belongs to the ARGONAUTE family and contains a PAZ and PiWi domain. Through tissue expression analysis, it is found that GmAGO5 is expressed in each tissue, wherein the expression amount in the stem is the lowest, the expression amount in the root is the highest, and the pod is the second. Subcellular localization shows that the GmAGO5 protein is mainly located in the cell nucleus and the cell membrane. By using a plant gene editing vector pSCM-GmAGO5, the GmAGO5 in the application is knocked out in a soybean variety Tianlong No. 1, so as to regulate the plant height, branch angle and protein content of soybean. Compared with the control, the plant height of the GmAGO5 gene edited soybean is significantly reduced, the branch angle is significantly reduced, and the protein content is significantly increased. The application discloses the effect of the gene on regulating the plant height, branch angle and protein content of soybean. The plant height, branch angle and protein content of soybean can be directedly modified, so as to improve the plant type and grain quality of plants. BRIEF DESCRIPTION OF DRAWINGS

[0015] The application will be further described below in combination with the drawings and examples.

[0016] Figure 1 Cloning of GmAGO5 gene

[0017] A 2877bp DNA fragment is obtained by using the leaf cDNA of Nannong 1138-2 in the flowering stage as a template for PCR amplification according to the sequence information of GmAGO5 predicted by the phytozome website. The sequence information of the 2877bp fragment is consistent with the sequence predicted by the phytozome website, that is, the 2877bp fragment is the GmAGO5 gene. The marker is 5k, and the 300, 500, 800, 1000, 1500, 2000, 3000 and 5000bp are sequentially arranged from bottom to top.

[0018] Figure 2 Tissue expression analysis of GmAGO5 gene

[0019] The real-time fluorescent quantitative PCR technology is used to study the expression of GmAGO5 in different tissues of Tianlong No. 1 soybean, and the different tissues of soybean are roots, stems, leaves, flowers, 35d pods and seeds.

[0020] Figure 3 Subcellular localization of GmAGO5 (A) d35s::GFP; (B) d35s::GmAGO5-GFP

[0021] Figure 4 Vector map of pSCM-GmAGO5

[0022] Figure 5 Bar test paper strip identification of GmAGO5 gene edited soybean

[0023] Bar test paper detection of T0 generation GmAGO5 gene edited soybean plants. WT represents the receptor Tianlong No. 1, 1-3 respectively represent three T0 generation positive single plants.

[0024] Figure 6 PCR identification of GmAGO5 gene edited soybean.

[0025] 1 is pSCM-GmAGO5 recombinant plasmid (positive control); 2-4 are three different T1 generation transgenic lines of single plants, KO-31, KO-55, KO-W35; WT is the receptor Tianlong No. 1 (negative control). Among them, Marker is 2k, from bottom to top, 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp.

[0026] Figure 7 Relative expression amount of GmAGO5 in gene edited soybean

[0027] KO-31, KO-55, KO-W35 are different transgenic lines, TL is the receptor Tianlong No. 1, same below. Figure 8 Comparison of plant height of GmAGO5 gene edited soybean and control

[0028] Compared with the control TL, the plant height of the three GmAGO5 gene edited soybeans increased, among which the KO-31, KO-55 and KO-W35 lines reached extremely significant difference. * represents significant difference at 0.01

[0029] Figure 9 Comparison of branch angle of GmAGO5 gene edited soybean and control

[0030] Compared with the control TL, the branch angle of the three GmAGO5 gene edited soybeans decreased, among which the KO-31, KO-55 and KO-W35 lines reached extremely significant difference. * represents significant difference at 0.01

[0031] Figure 10 Comparison of protein content of GmAGO5 gene edited soybean and control

[0032] Compared with the control TL, the protein content of three GmAGO5 gene edited soybeans increased, among which the KO-31 and KO-55 strains reached a highly significant difference, and the protein content of the KO-W35 strain increased. * represents a significant difference at the level of 0.01 DETAILED DESCRIPTION

[0033] The present application will be further described in detail below in conjunction with the accompanying drawings and examples, and with reference to the data. These examples are only for illustrating the present application, and do not limit the scope of the present application in any way. In the following examples, various processes and methods that are not described in detail are conventional methods known in the art. The primers used are all indicated when first mentioned, and the same primers used thereafter are all the same as first indicated.

[0034] Example 1 Cloning and identification of soybean GmAGO5 and its encoding gene

[0035] Primers were designed according to the GmAGO5 sequence information predicted by the phytozome website, and cDNA of the leaf of Nannong 1138-2 at the flowering stage was used as a template for PCR amplification.

[0036] Upstream primer GmAGO5-F: ACCACACTTCCTTCCCTCCTA;

[0037] Downstream primer GmAGO5-R: CACAACGCTCTGTTTACCGC.

[0038] GmAGO5 gene was amplified from total RNA of soybean leaves by RT-PCR method. The soybean leaf tissue was taken, crushed with a mortar, added to a 1.5 mL EP tube containing lysis solution, shaken thoroughly, and then transferred to a glass homogenizer. After homogenization, it was transferred to a 1.5 mL EP tube, and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of total RNA was identified by formaldehyde denaturing gel electrophoresis, and then the RNA content was determined on a spectrophotometer. The obtained total RNA was used as a template, and the first strand of cDNA was synthesized according to the instructions of the reverse transcription kit provided by Takara company. PCR amplification reaction was performed. The PCR reaction system was: 2 μl cDNA (0.05 μg), 2 μl of upper and lower primers (10 μM) each, 25 μl 2x PhantaMax Buffer, 1 μl dNTP (10 mM), and 1 U Phanta Max Super-Fidelity DNA polymerase (Vazyme), and the volume was made up to 50 μl with ultrapure water. The PCR program was as follows: performed on a Bio-RAD PTC200 PCR instrument, the program was 94°C pre-denaturation for 3 min; 94°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 45 s, a total of 30 cycles; then 72°C extension for 5 min to terminate the reaction, and 4°C storage. The PCR product was recovered and cloned into pGEM-Teasy vector, and after sequencing, the cDNA sequence of soybean gene GmAGO5 with complete coding region was obtained, SEQ ID NO. 1, 2877 bp in length, encoding 959 amino acids as shown in SEQ ID NO. 2.

[0039] Example 2 Expression characteristics of GmAGO5 in different organs of soybean

[0040] The RNA of Tianlong No. 1 roots, stems, leaves, flowers, 35 d pods, and seeds was extracted, and cDNA was reverse-transcribed for RT-PCR analysis.

[0041] The total RNA was extracted as in Example 1. The soybean constitutive expression gene Tubulin was used as an internal reference gene, and its amplification primers were Tubulin upper primer sequence: GGAGTTCACAGAGGCAGAG, and Tubulin lower primer sequence: CACTTACGCATCACATAGCA. The cDNA from different tissues or organs of soybean was used as a template for real-time fluorescent quantitative PCR analysis. The amplification primers of GmAGO5 were: GmAGO5-qPCR-F: CAACCAGATTCACGCCATCC, GmAGO5-qPCR-R: GAGACGCGGCA CGAACAG. The results Figure 2 ) analysis showed that the expression of GmAGO5 in roots and pods was relatively high, indicating that GmAGO5a may be related to the development of soybean pods.

[0042] Subcellular localization of GmAGO5

[0043] Subcellular localization was performed by the method of Nicotiana benthamiana transient expression, and the vector used was P2, and the primers were GmAGO5-P2-F: ACAAATCTATCTCTCTCGAGATGTCTCGTCGCGGTGGCTC, GmAGO5-P2-R: GCTCACCATGGATCCACAGAAGAACATCACATCTT. After the target band was correctly amplified by PCR, it was recovered by gel cutting, and the gel recovery product was connected to the vector by homologous recombination to construct the subcellular localization vector p2-GmAGO5 (the gene is at the N terminus of GFP). After transient expression in tobacco, dark culture for 48 h, and laser irradiation by laser confocal microscope (Zeiss, LSM780), green fluorescent signals were generated, the protein was located, and observation and photography were performed. The results are shown in Figure 3 GmAGO5:GFP fusion protein was distributed in the nucleus and cell membrane, indicating that GmRNF1a may function in the cell membrane and nucleus.

[0044] Gene engineering application of GmAGO5

[0045] The CDS region sequence of GmAGO5 gene was placed into CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ), sgRNA was obtained, and sgRNAs with higher targeting efficiency and lower off-target rate were selected. To improve the targeting efficiency, four sgRNAs were selected: GmAGO5-sgF1: GGCCAGGGTTCGGTCTTGTAGTTTTAGAGCTAGAAATAGCAAG,

[0046] GmAGO5-sgR1: TACAAGACCGAACCCTGGCCCAATCCATATGTTTTCCTGGGAC;

[0047] GmAGO5-sgF2: AGACGCGGCACGAACAGGTGGTTTTAGAGCTAGAAATAGCAAG,

[0048] GmAGO5-sgR2: CACCTGTTCGTGCCGCGTCTTGACCAGACATGTCACGCTTAGT;

[0049] GmAGO5-sgF3: GACGGAGACGCGGCACGAACGTTTTAGAGCTAGAAATAGCAAG,

[0050] GmAGO5-sgR3: GTTCGTGCCGCGTCTCCGTCCAATCCATATGTTTTCCTGGGAC;

[0051] GmAGO5-sgF4: ATTCAGTGAACGGCCAGGGTTGTTTTAGAGCTAGAAATAGC AAG,

[0052] GmAGO5-sgR4: AACCCTGGCCGTTCACTGAATTGACCAGACATGTCACGCTT AGT.

[0053] The specific operation is as follows. The sgRNA targeting sequence is constructed, the pGmU6 plasmid is used as a template, a pair of primers of U6-F (GGAATTGTGAGCGGATAAC) and GmAGO5-sgR1 is used, another pair of primers of GmAGO5-sgF1 and U6-R (CCATGAATAGGTCTATGACC) is used, and PCR reactions are respectively performed to obtain two fragments of U6-F—GmAGO5-sgR1 and GmAGO5-sgF1—U6-R; the pGmU3 plasmid is used as a template, a pair of primers of U3-F (TAGAGGAGCTGTTCTGCTTC) and GmAGO5-sgR2 is used, another pair of primers of GmAGO5-sgF2 and U3-R (CCATGAATAGGTCTATGACC) is used, and PCR reactions are respectively performed to obtain U3-F—GmAGO5-sgR2 and GmAGO5-sgF2—U3-R; U6-F—GmAGO5-sgR3 and GmAGO5-sgF3—U6-R and U3-F—GmAGO5-sgR4 and GmAGO5-sgF4—U3-R are additionally obtained through the same PCR method.

[0054] Subsequently, bridge PCR reaction was performed with U6-F—GmAGO5-sgR1 and GmAGO5-sgF1—U6-R as templates to obtain U6-F—GmAGO5-sgRNA1—U6-R fragment; through the same bridge PCR reaction, U3-F—GmAGO5-sgRNA2—U3-R, U6-F—GmAGO5-sgRNA3—U6-R, U3-F—GmAGO5-sgRNA4—U3-R were obtained again, a total of 4 bridge PCR reaction products, which realized the connection of sgRNA1 and sgRNA3 to U6 promoter, and the connection of sgRNA2 and sgRNA4 to U3 promoter, and the connection of 4 bridge PCR reaction products to T vector for preservation.

[0055] Tail PCR amplification was performed on the bridge products U6-F—GmAGO5-sgRNA1—U6-R and U6-F—GmAGO5-sgRNA3—U6-R using primers pU6-F (GTCAGTCGACGGAATTGTGAGCGGATAAC) and pU6-R (CTAGTCTAGACCATGAATAGGTCTATGACC) to make the product fragments have NcoI and BamHI enzyme cutting sites on both sides; tail PCR amplification was performed on the bridge products U3-F—GmAGO5-sgRNA2—U3-R and U3-F—GmAGO5-sgRNA4—U3-R using primers pU3-F (CATGCCATGGTAGAGGAGCTGTTCTGCTT) and pU3-R (GTCAGTCGACATGAATAGGTCTATGACC) to make the product fragments have BamHI and XbaI enzyme cutting sites on both sides. The original pSCM vector plasmid was double-cut with NcoI and XbaI endonucleases, and the above-mentioned U6-F—GmAGO5-sgRNA1—U6-R and U3-F—GmAGO5-sgRNA2—U3-R which had been added with enzyme cutting sites were connected to the lac of the cut pSCM vector, i.e. the gRNA scaffold position, using T4 ligase, thus a two-connected vector (pSCM-U6-F—GmAGO5-sgRNA1—U6-R—U3-F—GmAGO5-sgRNA2—U3-R) was constructed. Figure 4 Another two-connected vector containing sgRNA3 and sgRNA4 was obtained in the same way.

[0056] With the pSCM vector plasmid connected with sgRNA3 and sgRNA4 as a template, pSC-M-F (GATGTGTTAAATGCTGCGGCTCGTATGTTGTGTGGAATTG) and pSC-M-R (ATCGGGGAAATTCGAGCTCTATACGCTAAGGGAATGCTTG) as primers, PCR amplification was performed to obtain a fragment product of U6-sgRNA3-U3-sgRNA4. The pSCM vector plasmid connected with sgRNA1 and sgRNA2 was single-enzymatically cut by Eco91I, and then was connected with the amplification product of U6-sgRNA3-U3-sgRNA4 by a recombination ligase, thus a four-sgRNA-edited four-connected pSCM vector pSCM-GmAGO5 was constructed. The pSCM-GmAGO5 was transformed into Agrobacterium tumefaciens strain EHA105 by a freeze-thaw method. And the strain was used for a tissue culture experiment of soybean target gene knockout.

[0057] The transformation of soybean cotyledon node was mediated by Agrobacterium strain EHA105, the specific process is as follows: select the surface without any defects, full of particles, size seed coat uniform and consistent soybean seeds, sterilization in fume hood. The chemical reaction of HCl (concentrated) + NaClO → Cl2↑+ NaOH (concentrated hydrochloric acid and sodium hypochlorite volume ratio of about 1:10) generated chlorine to disinfect. In the experiment, 120 ml of NaClO was placed in a conical flask. At this time, the beans placed in a petri dish were placed in the middle of the dryer, and the conical flask was placed in the middle of the dryer, covered with a lid. Then 15 ml of concentrated HCl was slowly added from the top of the dryer through a separatory funnel, and the sterilization time was 6-7 hours. Seed germination: after sterilization, the seeds were blown in the clean bench, vertically inserted into the pre-prepared solid germination medium of SG4, and the medium was half of the seed navel. Bacteria: add 1-2 ml of small amount of bacteria liquid to the YEB liquid medium containing antibiotics Kan and Rif in the conical flask, shake at 28℃, 200 rpm to OD600=0.85-0.9. Agrobacterium infection: centrifuge the shaken bacteria liquid at 5000 rpm for 10 min at room temperature, discard the supernatant, then add co-culture liquid CCM to the two centrifuge tubes and shake to suspend, and adjust to OD600=0.5-0.6. After 5 days of soybean seed germination, part of the hypocotyl was removed and 5-10 mm was reserved, then the seed was cut along the cotyledon and hypocotyl, the true leaf was removed, and then a few cuts were made along the direction of the hypocotyl with a knife. The treated explants and suspended bacteria liquid were poured into a sterilized jar together, and co-cultured at 28℃, 120 rpm for 30-40 min. Finally, the explants were taken out, the cotyledon node was placed downward, and the solid co-culture medium CCM was placed on a layer of filter paper, 14 explants were placed in each petri dish, and cultured at 25℃ in the dark for 5 days. Induction of multiple shoots: after 5 days of co-culture, the explants were sterilized with sterile water and Wash-Liquid, the overgrown hypocotyl was cut off, about 5-10 mm was reserved, and the growth point was inserted into the SIM solid medium containing no glufosinate at 45°, 8 per dish, and cultured at 26℃ under light for 14-17 days. After 14-17 days, the large buds and part of the hypocotyl were removed, and the explants with multiple shoots were replaced into the SIM solid medium containing 6 mg / L glufosinate for screening, and cultured for 14-17 days. Elongation: the cotyledon, dead leaves and part of the hypocotyl of the explants that were not completely dead were removed, and replaced into the SEM solid medium containing 4 mg / L glufosinate and cultured for 14-17 days. Take 14-17 days as a cycle, remove the dead leaves and part of the hypocotyl, replace them into new SEM solid medium, and gradually reduce the concentration of glufosinate. Rooting: when the bud of the explant elongates to about 6 cm, the bottom is cut off, a cross-shaped wound is made at the bottom of the stem, and it is transferred to the rooting medium RM for culture. Roots can be induced after about 10 days.Seedling: Pour a certain amount of sterile water into the bottle, and cultivate at 26℃ for about 5 days. Transplant. When the number and length of roots are moderate, separate the tissue culture seedlings from the culture medium and transplant them into sterilized soil in an artificial incubator (16h light / 8h dark, 25℃).

[0058] The gene editing vector pSCM-GmAGO5 contains a selection marker gene bar. After the T0 generation seedlings are transplanted, bar rapid test strips are used to detect positive T0 generation soybean plants Figure 5 ). After the T0 generation seedlings grow new leaves, different node leaves are mixed and tested. After adding 500ul buffer, the leaves are crushed and ground into pulp and mixed. Then the test strip is inserted vertically into the mixed solution. When the mixed solution rises to a certain height of the test strip, the result is read. If there is only one band above, it is negative. If two bands are shown, the sample is positive, and the bar protein can be detected, indicating that the sample plant is a positive plant. The genomic DNA of the T1 generation of transgenic plants with bar resistance obtained by T0 screening is extracted, and gene-specific primers Bar-F: CGAGACAAGCACGGTCAACTT and Bar-R: AAACCCACGTCATGCCAGTTC are used for PCR identification. The positive transgenic soybean Figure 6 ) with a band of about 400bp is identified. Plants with positive PCR identification are selected, and real-time fluorescent quantitative PCR is performed with primers qRT-GmAGO5-F CAACCAGATTCACGCCATCC and qRT-GmAGO5-R GAGACGCGGCACGAACAG. The results show that the expression of GmAGO5 in the gene edited soybean is significantly reduced Figure 7

[0059] After the tissue culture experiment, a total of 3 gene editing lines were obtained. After propagation in the laboratory environment, T2 generation plants were planted in Lihe field and T3 generation seeds were harvested. The plant height, branch angle and seed protein of T2 generation transgenic plants were determined. The plant height and branch angle of single soybean were investigated. The harvested seeds were placed in a 28℃ oven and dried for 5 days. The protein content of the seeds was measured using a near-infrared spectrometer. Compared with the receptor Tianlong No. 1, the plant height of the three gene editing lines was reduced, and the plant height difference of the three lines reached a very significant level Figure 8 A,B); the branch angle of the three gene editing lines was reduced, and the branch angle difference of the three lines reached a very significant level Figure 8 B, Figure 9 ) compared with the receptor Tianlong No. 1. The seed protein content of KO-31 and KO-55 lines reached a very significant level Figure 10 ​). In summary, the genetic editing of GmAGO5 in soybean can reduce plant height and branch angle, and increase protein content of soybean seeds, which creates a gene resource for breeding of ideal plant type, high yield, high quality and good adaptability.

Claims

1. Suppressing the GmAGO5 protein-coding gene in cultivated soybean GmAGO5 The expression of the GmAGO5 protein-coding gene in cultivated soybean has been applied to reduce soybean plant height, decrease soybean branching angle, and increase soybean protein content. GmAGO5 The nucleotide sequence is shown in SEQ ID NO.

1.

2. A gene editing knockout vector for reducing plant height, reducing branch angle and increasing protein content of soybean, wherein the nucleotide sequence of a cultivated soybean GmAGO5 protein coding gene is shown as SEQ ID NO.

1. GmAGO5 The application relates to a gene editing knockout vector for reducing plant height, reducing branch angle and increasing protein content of soybean, wherein the nucleotide sequence of a cultivated soybean GmAGO5 protein coding gene is shown as SEQ ID NO.

1. GmAGO5 GmAGO5 ​

Images