A type of curly-shaped Bacillus and its applications

By spraying a suspension of curly-shaped Bacillus spores onto the larvae of the fall webworm, the problem of poor control efficacy against fall webworm larvae in existing technologies has been solved, achieving a highly efficient and environmentally friendly biological control effect.

CN120118750BActive Publication Date: 2026-05-26JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510338483.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2026-05-26
Estimated Expiration
2045-03-21

AI Technical Summary

Technical Problem

Existing technologies lack efficient and green microbial control methods for controlling the fall webworm, especially for controlling fall webworm larvae.

Method used

Spore suspensions of *Backusella circina* JSAFC 2057 were sprayed onto the larvae of the American white moth. The spore suspensions were prepared by filtering them in Tween-80 solution and adjusting the concentration to 10⁷/ml. The spore suspensions were prepared under dark culture conditions at 25°C and 75% humidity.

Benefits of technology

Bacillus curvatureii exhibits a high mortality rate of 100% against fall webworm larvae, providing an effective biological control method for the green control of fall webworm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118750B_ABST
    Figure CN120118750B_ABST
Patent Text Reader

Abstract

This invention discloses a strain of *Backusella circina* and its application. The strain number of *Backusella circina* is JSAFC 2057, which was deposited at the China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024, with accession number CGMCC No. 41522. This fungal agent can significantly inhibit the survival activity of the fall webworm (*Triplophysa fulvidraco*), reducing the survival activity of fall webworm larvae to zero after 7 days of treatment and culture. The fungus provided by this invention is a biocontrol fungus for the control of the major pest, the fall webworm. It is characterized by strong pathogenicity against fall webworm larvae, environmental safety, and low likelihood of inducing pesticide resistance in pests, and can be applied to the biological control of the fall webworm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a type of *Bacillus curvatureus* and its applications. Background Technology

[0002] The fall webworm (Hyphantria cunea), also known as the autumn white moth, is an internationally quarantined pest characterized by its omnivorous diet, high reproductive rate, strong adaptability, wide spread, and significant damage. The fall webworm has 2-3 generations per year, overwintering as pupae in fallen leaves, topsoil, and wall crevices. Shortly after hatching, the larvae spin webs and live in gregarious groups. Adults are weak fliers, exhibit weak phototaxis, remain dormant during the day, and are active at night, mating and laying eggs. Control of the fall webworm can be achieved through various methods, including physical control, chemical control, and biological control. Biological control is a crucial method, utilizing natural enemies and microorganisms. It is environmentally friendly and an important aspect of reducing chemical pesticide use. Currently, many bio-agents and biopesticides have been developed both domestically and internationally. Microbial pesticides primarily utilize bacteria, actinomycetes, and Streptomyces, while insecticidal fungi such as Metarhizium anisopliae and Beauveria bassiana are also being increasingly promoted. Therefore, exploring and screening highly targeted strains is a crucial step that must be overcome in the process of applying fungi for biological control.

[0003] In summary, current technologies lack a green and highly effective probiotic for controlling the fall webworm. Screening microbial resources can provide an effective way to achieve efficient, green, and sustainable control of the fall webworm. Summary of the Invention

[0004] Purpose of the invention: The purpose of this invention is to provide a *Backusella circina* and its application in the control of the fall webworm.

[0005] Technical solution: The present invention provides a Backusella circina strain, the strain number of which is JSAFC 2057, which was deposited at the China General Microbiological Culture Collection Center on September 23, 2024, with the accession number CGMCC No.41522.

[0006] Furthermore, the nucleotide sequence of the ITS gene of *Bacillus curvatureus* is shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol agent, wherein the active ingredient of the biocontrol agent is the aforementioned Backusella circina.

[0008] The present invention also provides the application of the above-mentioned Backusella circina and biocontrol agent in the control of fall webworm.

[0009] Furthermore, the application specifically involves spraying a suspension of spores of *Backusella circina* JSAFC2057 onto the larvae of the American white moth.

[0010] Further, the method for preparing the spore suspension is as follows: (1) inoculate the biocontrol fungus *Bacillus curvatureus* JSAFC 2057 onto PDA medium and culture it to prepare a culture; (2) place the culture obtained in step (1) into Tween-80 solution, shake well and filter out the spores.

[0011] Furthermore, the culture conditions described in step (1) are 25°C, 75% humidity, and dark culture.

[0012] Furthermore, the concentration of the Tween-80 solution in step (2) is 0.1%.

[0013] Furthermore, the concentration of the spore suspension is 10. 7 / ml.

[0014] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: This application obtained a strain of *Backusella circina* through isolation and purification of soil from Hangzhou, Zhejiang Province. This strain can be used as a biocontrol strain with a high mortality rate against the fall webworm, and is environmentally friendly and non-toxic. It exhibits strong pathogenicity against fall webworm larvae and is a biocontrol strain with potential value in the control of the fall webworm, which is of positive significance in preventing the spread of the fall webworm. Attached Figure Description

[0015] Figure 1 Colony morphology of Backusella circina JSAFC 2057.

[0016] Figure 2 Phylogenetic tree of Backusella circina JSAFC 2057.

[0017] Figure 3 The effects of Backusella circina JSAFC 2057 on the growth of American white moth larvae. Detailed Implementation

[0018] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0019] In this invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly including bacteria, fungi, and actinomycetes.

[0020] Example 1: Isolation and identification of Backusella circina JSAFC 2057

[0021] 1. Separation of Backusella circina JSAFC 2057

[0022] JSAFC 2057 was isolated from soil samples taken from Hangzhou, Zhejiang Province. Its colony characteristics are as follows: When cultured on PDA plates, the colonies grow rapidly and are cottony in appearance. Figure 1 ).

[0023] 2. Molecular biological identification of Backusella circina JSAFC 2057

[0024] (1) Genomic DNA of strain JSAFC 2057 was extracted using a kit from TIANGEN.

[0025] (2) Amplification of the ITS gene from genomic DNA. DNA amplification was performed using a 30 μL reaction volume, containing 15 μL of 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) each of primer pairs ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'), 2 μL of template DNA, and 11 μL of ddH2O. The PCR amplification program conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 45 s, 72℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0026] (3) After the amplified PCR products were subjected to 1% agarose gel electrophoresis, they were observed under ultraviolet light. The PCR products with the target band were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 2057 was SEQ ID NO.1 (ACTGTGAAAAGTTTTTTGTTTTTGACCCTGGGTGGTTGACGCAAGTCTTCTGCCC).

[0027] (4) Compare SEQ ID NO.1 with the data on the NCBI database website and construct a phylogenetic tree. See [link to relevant documentation]. Figure 2The comparison results are shown in Table 1. Based on the results in Table 1, the biocontrol bacterium JSAFC 2057 of the present invention can be identified as *Backusella circina*, named *Backusella circina* JSAFC 2057. This strain was deposited on September 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 41522, classified as *Backusella circina* JSAFC 2057, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen No. 1 Courtyard, Chaoyang District, Beijing.

[0028] Table 1. Sequence alignment results of SEQ ID NO.1

[0029]

[0030] Example 2: Determination of the pathogenicity of Backusella circina JSAFC 2057 against the larvae of the fall webworm.

[0031] 1. Preparation of spore suspension

[0032] (1) The biocontrol bacterium Pasteurella multocida JSAFC 2057 was inoculated onto PDA medium and cultured to prepare a culture. The culture conditions were: cultured at 25℃ in the dark for 5-7 days.

[0033] (2) Using an inoculation needle, pick up a piece of mycelium from the culture and place it in Tween-80 solution (0.1%). Shake thoroughly, filter out the spores, and adjust the concentration to prepare a biocontrol agent for the fall webworm. The spore concentration of the fall webworm biocontrol agent is 10. 7 per mL.

[0034] 2. Inoculation with test insects

[0035] The second and third instar larvae of the fall webworm were purchased from the Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. Larvae under the third instar were reared in an artificial climate chamber (temperature 25℃, humidity 80%, light-dark ratio 12:12), and were provided with surface-sterilized mulberry leaves daily. The fall webworm larvae were used for bioassays after reaching the third instar.

[0036] Insecticidal activity of *Bacillus curvularia* JSAFC 2057 against the fall webworm was determined: 10 ml of a 10% concentration was used. 7A conidial suspension of larvae / mL was placed in a petri dish. Third-instar fall webworms were immersed in the conidial suspension for 20 seconds before inoculation. The inoculated larvae were then transferred to a transparent plastic box and placed in an artificial climate chamber (25℃, 80% humidity, 12:12 light-dark ratio). They were fed sterilized mulberry leaves, with the leaves changed daily and larval mortality recorded. Initially, observations were conducted once daily for a total of 7 days. Each group consisted of 30 larvae of the tested insect source, with three replicates. Treatment with 0.1% Tween-80 solution served as a negative control.

[0037] Experimental results are as follows Figure 3 As shown in Table 2.

[0038] Table 2. Mortality rate (%) of American white moth larvae after inoculation with Backusella circina JSAFC 2057

[0039]

[0040] As shown in Table 2, the mortality rate of fall webworm larvae in the treatment group was significantly higher than that in the control group, indicating that the strain *Backusella circina* JSAFC 2057 of this invention has a good lethal effect on fall webworms at a concentration of 10... 7 A bacterial concentration of 1 spore / mL resulted in a 100% mortality rate for the fall webworm after 7 days, indicating that Backusella circina JSAFC 2057 has a control effect on fall webworm larvae. Figure 3 The control group and the treatment group were treated on day 7.

[0041] In summary, the Backusella circina JSAFC 2057 provided by this invention is a biocontrol fungus that can be used to control the larvae of the fall webworm, which will provide a basis for the green control of the fall webworm and has great potential for development and application.

Claims

1. A type of curled-backbone mold ( Backusella circina ), characterized in that, The strain number of the curled Buxtonia (Buxtonia curvula) Backusella circina is JSAFC 2057, which was preserved in the China General Microbiological Culture Collection Center on September 23, 2024, with the preservation number of CGMCC No. 41522.

2. A biocontrol agent, characterized in that, The active ingredient of the biocontrol agent is *Bacillus curvatureus* as described in claim 1. Backusella circina ).

3. The *Bacillus curlis* as described in claim 1 (… Backusella circina The application of the biocontrol agent according to claim 2 in the control of the fall webworm.

4. The application according to claim 3, characterized in that, The specific application involves using the *Bacillus curvatureus* as described in claim 1 (…). Backusella circina A spore suspension of JSAFC 2057 was sprayed onto the larvae of the American white moth.

5. The application according to claim 4, characterized in that, The method for preparing the spore suspension is as follows: (1) The biocontrol bacterium Pasteurella multocida JSAFC 2057 was inoculated onto PDA medium and cultured to prepare a culture; (2) Place the culture obtained in step (1) into Tween-80 solution, shake well and filter out the spores.

6. The application according to claim 5, characterized in that, The culture conditions described in step (1) are 25°C, 75% humidity, and dark culture.

7. The application according to claim 5, characterized in that, The concentration of the Tween-80 solution mentioned in step (2) is 0.1%.

8. The application according to claim 4, characterized in that, The concentration of the spore suspension is 10 7 / mL.

Citation Information

Patent Citations

  • Vaccine compositions and methods for treatment of mucormycosis and other fungal diseases

    CN102639557A

  • Glucoamylase and methods of use thereof

    CN115867651A