Trpa1b gene mutant and construction method of tilapia low-temperature-resistant strain

Abstract

The invention discloses a trpa1b gene mutant and a construction method of a tilapia low-temperature-resistant strain, and belongs to the technical field of biology. A tilapia mossambica model with a trpa1b gene knocked out is constructed based on a CRISPR / Cas9 gene editing technology, and the method comprises the following steps: determining a specific target sgRNA of the trpa1b gene, introducing the sgRNA and Cas9 protein with activity into a tilapia mossambica embryo through micro-injection, cultivating and screening F0-generation trpa1b knocked-out tilapia mossambica, and obtaining homozygote mutant tilapia mossambica through two-generation mating. The tilapia with the trpa1b gene knocked out shows higher low-temperature resistance, and particularly, the survival time of the tilapia under the low-temperature condition is prolonged. The invention provides an important model for low-temperature-resistant breeding of tilapia mossambica, and also provides a potential gene target for low-temperature-resistant strain breeding of other fishes in view of the conservative property of the function of the trpa1b gene.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a trpa1b gene mutant and a method for constructing a low-temperature tolerant strain of tilapia. Background Art

[0002] Tilapia belongs to the genus Tilapia of the family Cichlidae in the order Perciformes. It is a medium and small-sized freshwater fish with many scientific names and common names, including Vietnamese crucian carp, Vietnamese fish, Nanyang crucian carp, golden phoenix fish, and Wuguo fish. In Guangdong region, it is also called longevity fish. Tilapia is native to Africa. Its appearance is similar to that of the common freshwater fish crucian carp, so it is also called "African crucian carp". Tilapia has firm, plump and delicious meat, few spines and a high protein content. It is rich in essential amino acids for the human body and has high nutritional value, meeting the dietary preferences of Europe and America. As a freshwater aquaculture fish that is a key scientific research and cultivation focus in the world's aquaculture industry, tilapia is also one of the main sources of animal protein in the future. In recent years, it has become a hot spot for aquaculture, processing and export.

[0003] Tilapia is a tropical fish, mainly distributed in regions such as Guangdong, Hainan, Guangxi, and Fujian. In recent years, although its large-scale intensive aquaculture has gradually emerged, the global temperature has changed violently and cold weather occurs frequently, resulting in a significant decrease in the survival rate of tilapia and making it difficult to meet the market demand. Therefore, it is particularly urgent to cultivate low-temperature tolerant varieties of tilapia.

[0004] With the continuous development of fish genetics and genomics, current fish breeding technologies mainly include methods such as family and population selection, molecular marker-assisted selection, and whole-genome selection, and have been successfully applied to the breeding practices of various cultured fish. However, in fish low-temperature tolerance breeding, mainly selection breeding and cross-breeding methods are used. These methods may lead to a reduction in genetic diversity and an increase in the risk of inbreeding, thus affecting the adaptability of the population. Therefore, developing an efficient and stable breeding technology is of crucial significance for the cultivation of low-temperature tolerant varieties of cultured fish in China.

[0005] In recent years, the CRISPR / Cas genome site-directed editing technology has developed rapidly and has the following prominent features: It can directly block DNA transcription, with higher and more precise blocking efficiency; it can edit multiple targets simultaneously; it can achieve reversible gene silencing; it has high silencing efficiency and simple vector construction, only requiring the design of sgRNA targeting the target gene. These significant advantages make this technology a powerful tool in the fields of human medicine, animal research, and plant improvement and breeding, especially playing an important role in gene function research. In recent years, the CRISPR / Cas technology has been widely applied in the model animal zebrafish to study related scientific issues. However, due to the relatively long maturation cycle and complex operation of cultured fish, the application of gene editing technology in this field is relatively less. Nevertheless, the CRISPR / Cas gene editing technology has opened up a new direction for fish breeding.

[0006] Trpa1b (transient receptor potential cation channel, ankyrin 1 type) is a multimodal non-selective cation channel that can respond to different physical and chemical stimuli. In terms of temperature perception, the role of trpa1b has been widely studied, but its specific temperature perception function remains controversial. Although trpa1b is widely distributed in invertebrates and vertebrates and is considered to play a crucial role in temperature perception, there are significant differences in its temperature sensitivity among different species. The temperature perception characteristics of the trpa1b channel vary greatly among species. For example, in mammals, trpa1b is generally considered to be sensitive to cold stimuli, especially in certain neurons (such as dorsal root ganglion neurons) with strong cold perception ability. However, studies have shown that in the trpa1b isoforms of humans and mice, trpa1b is not sensitive to cold but shows sensitivity to heat stimuli. The temperature perception function of trpa1b in different species may be closely related to its molecular structure, cellular environment, and its role in physiological processes, and its bidirectional role in temperature perception has also been confirmed in some species. For example, in some invertebrates such as Drosophila and mosquitoes, trpa1b can not only sense cold temperature but also respond to warm temperature. Other studies on snakes and certain amphibians have revealed the unique role of trpa1b in infrared radiation detection. Especially in some reptiles and fish, the temperature sensing properties of trpa1b are refined to adapt to different environmental temperatures, showing significant species specificity. Although trpa1b has an important function in temperature perception, there is still controversy about whether trpa1b serves as the main molecular mechanism for cold perception. These findings suggest that the temperature perception function of trpa1b in different species may vary due to the needs of evolutionary adaptation. Whether the Trpa1b gene has a certain correlation with the cold tolerance of fish and whether it is an important target gene for cold tolerance breeding in fish have not been studied. Summary of the Invention

[0007] The first object of the present invention is to provide the application of the trpa1b gene in constructing a cold-tolerant strain of tilapia. By knocking out and editing the trpa1b gene, a strain of tilapia with cold tolerance ability is obtained, and the survival time of tilapia at low temperature is extended.

[0008] Another object of the present invention is to provide a method for constructing a cold-tolerant strain of tilapia with the trpa1b gene knocked out. By using the CRISPR / Cas9 technology to obtain sgRNA and Cas9 protein, a tilapia model (mutant) with the trpa1b gene stably knocked out is constructed, and the tilapia with the trpa1b gene stably knocked out shows good cold tolerance ability.

[0009] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0010] In the first aspect of the present invention, the application of the trpa1b gene in constructing a cold-tolerant strain of tilapia is provided.

[0011] In the second aspect of the present invention, a specific target site sgRNA of the trpa1b gene is further provided, which targets the sequences shown in SEQ ID NO:1 and SEQ ID NO:2 in exon 1 and exon 2 of the trpa1b gene, and includes sgRNA1 and sgRNA2;

[0012] SEQ ID NO:1: GTGATAGAGGATGACGATCC;

[0013] SEQ ID NO:2: GAAGGGTGACCTAGCTCTCC;

[0014] The sgRNA1 contains the nucleotide sequence shown in SEQ ID NO:3, specifically:

[0015] GUGAUAGAGGAUGACGAUCCGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUU(SEQ ID NO:3);

[0016] The sgRNA2 contains the nucleotide sequence shown in SEQ ID NO:4, specifically: GAAGGGUGACCUAGCUCUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAA AUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC UUUU(SEQ ID NO:4).

[0017] In the third aspect of the present invention, there is also provided the application of the trpa1b gene or the specific target site sgRNA of the trpa1b gene in constructing a low-temperature tolerant strain of tilapia.

[0018] In the fourth aspect of the present invention, there is also provided a tilapia trpa1b gene mutant, in which gene editing occurs at the 41st nucleotide at the exon 1 position to the 89th nucleotide at the exon 2 position.

[0019] Preferably, 515 nucleotides (including 61 exon nucleotide sequences) are deleted from the 41st nucleotide at the exon 1 position to the 89th nucleotide at the exon 2 position of the tilapia trpa1b gene mutant.

[0020] Preferably, the sequences of exon 1 and exon 2 of the tilapia trpa1b gene mutant are as shown in SEQ ID NO:5, specifically:

[0021]

[0022] (The wavy line is exon 1, the underline is exon 2, and the bold font is the target sequence).

[0023] The above tilapia trpa1b gene mutant can be used to cultivate a low-temperature tolerant strain of tilapia. Tilapia with the trpa1b gene knocked out, especially those with mutations in exon 1 and exon 2 of the trpa1b gene, have better low-temperature tolerance. Specifically, tilapia in which 515 nucleotides (including 61 exon nucleotide sequences) are deleted from the 41st nucleotide at the exon 1 position to the 89th nucleotide at the exon 2 position of the trpa1b gene (i.e., the sequences of exon 1 and exon 2 of the trpa1b gene are as shown in SEQ ID NO:5) have low-temperature tolerance, and not only the side-turning rate is significantly reduced under low-temperature conditions, but also the final mortality rate is significantly reduced.

[0024] In the fifth aspect of the present invention, there is also provided a method for constructing a low-temperature tolerant strain of tilapia, including the following steps:

[0025] (1) Based on the CRISPR / Cas9 gene knockout technology, the specific target site sgRNA1, sgRNA2 of the trpa1b gene and Cas9 protein are microinjected into tilapia embryos to edit the 41st nucleotide at the exon 1 position to the 89th nucleotide at the exon 2 position of the trpa1b gene. After embryo cultivation, positive tilapia are screened to obtain F0 generation positive tilapia;

[0026] (2) The F0 generation positive tilapia are mated with wild-type tilapia to obtain F1 generation knockout individual tilapia;

[0027] (3) Hybridize the F1 generation of knockout tilapia to obtain F2 generation tilapia, and screen the F2 generation of homozygous tilapia to obtain the cold-tolerant strain of tilapia.

[0028] Preferably, in steps (1)-(3), PCR amplification and sequencing are used to screen the F0 generation of positive tilapia, the F1 generation of knockout tilapia, and the F2 generation of homozygous tilapia.

[0029] More preferably, the upstream and downstream sequences used for the PCR amplification and sequencing screening are as shown in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:9:

[0030] trpa1b-seq1-F: AGACAATGTCCTGTGCCCAT (SEQ ID NO:6);

[0031] trpa1b-seq1-R: ACATGTTGCGTCGCGTCTT (SEQ ID NO:7);

[0032] trpa1b-seq2-F: TCTAGCACAGTGTGTTCTTTGG (SEQ ID NO:8);

[0033] trpa1b-seq2-R: AAACATGTTGCGTCGCGTCT (SEQ ID NO:9).

[0034] Preferably, in step (1), the trpa1b gene editing of the F0 generation of positive tilapia is located at the 41st nucleotide in exon 1 to the 89th nucleotide in exon 2, deleting a total of 515 nucleotides (including 61 exon nucleotide sequences).

[0035] Preferably, the genome sequencing result of the F2 generation of homozygous tilapia is as shown in SEQ ID NO:5.

[0036] Preferably, in step (1), two bands appear at the positions of 502bp and 328bp in the PCR product of the F0 generation of positive tilapia; the wild type has a single band at 328bp; and the homozygous type has a single band at 502bp.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] Based on the CRISPR / Cas9 gene knockout technology, first, the specific target sgRNA of the trpa1b gene is determined; second, the active sgRNA and Cas9 protein are introduced into tilapia embryos by microinjection, and the F0 generation of trpa1b knockout tilapia is cultivated and screened; subsequently, homozygous mutant tilapia are obtained through two generations of mating. Compared with wild-type tilapia, the trpa1b gene knockout tilapia shows stronger cold tolerance, specifically manifested as an extended survival time under low-temperature conditions. The present invention provides an important model for cold tolerance breeding of tilapia. In addition, due to the conservation of the trpa1b gene function, it also provides potential gene targets for the cultivation of cold tolerance strains of other fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a schematic flow chart of the construction method of the cold tolerance strain of tilapia in the embodiment.

[0040] Figure 2 It is the partial gene sequencing result of the tilapia mutant in the embodiment.

[0041] Figure 3 It is the electrophoresis result of the PCR amplification product of the F0 generation tilapia in the embodiment.

[0042] Figure 4 It is the gradient cooling experiment procedure of the F2 generation homozygous and wild-type tilapia in the embodiment.

[0043] Figure 5 It is the experimental result that the F2 generation homozygous and wild-type tilapia still maintain swimming ability under low-temperature conditions in the embodiment.

[0044] Figure 6 It is the experimental result of the survival rate of the F2 generation homozygous and wild-type tilapia under low-temperature conditions in the embodiment. DETAILED DESCRIPTION OF THE INVENTION

[0045] In the following embodiments, the tilapia mutant strain is obtained by double-target knockout. The specific implementation manners provided by the present invention will be described in detail below with reference to the accompanying drawings.

[0046] Materials required for the experiment:

[0047] 1) Enzymes used in PCR: 2×Accurate taq master Mix (for sgRNA synthesis, abclone company);

[0048] 2) Purification of PCR products: QIAquick@PCR Purification Kit (QIAGEN company);

[0049] 3) In vitro transcription: MAXIscript TMSP6 / T7 Transcription Kit (Thermo);

[0050] 4) Cas9 Protein: GenCrispr NLS-Cas9-NLS Nuclease (GenScript).

[0051] The construction method and steps of trpa1b gene knockout tilapia are as Figure 1 shown, including constructing sgRNA and injecting it with Cas protein into tilapia embryos, cultivating and screening to obtain F0 generation positive tilapia; crossing F0 generation positive tilapia with wild-type tilapia to obtain F1 generation knockout individual tilapia; crossing female and male F1 generation knockout individual tilapia, screening F2 generation homozygous tilapia, and conducting low-temperature tolerance verification.

[0052] Example 1 trpa1b Gene Knockout Tilapia

[0053] (1) Construct specific target sgRNA1 and sgRNA2 for the trpa1b gene.

[0054] The target sequences SEQ ID NO.1 and SEQ ID NO.2 of specific target sgRNA1 and sgRNA2 for the trpa1b gene are shown in Table 1, located at the 41st position of exon 1 of trpa1b and the 89th position of exon 2 of trpa1b, respectively.

[0055] Among them, the primer sequences SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12 of crRNA1, crRNA2, and tracrRNA are shown in Table 2. Linearize and purify the DNA and transcribe it in vitro with Cas9 protein.

[0056] Table 1

[0057] sgRNA Name Sequence (5’-3’) trpa1b-sgRNA1 GTGATAGAGGATGACGATCC(SEQ ID NO:1) trpa1b-sgRNA2 GAAGGGTGACCTAGCTCTCC(SEQ ID NO:2)

[0058] Table 2

[0059]

[0060]

[0061] Using the DNA fragment of SEQ ID NO:5 as a template, amplify in vitro and transcribe to obtain the DNA sequences for synthesizing sgRNA1 and sgRNA2, specifically as follows:

[0062] sgRNA1-scaffold:

[0063]

[0064] sgRNA2-scaffold:

[0065]

[0066] The template includes DNA fragments (SEQ ID NO: 10, 11 and SEQ ID NO: 12) for transcribing crRNA and tracerRNA.

[0067] The DNA fragment for transcribing crRNA is shown as SEQ ID NO: 10, including the T7 promoter sequence, the target sequence (SEQ ID NO: 1) and the sequence complementary to tracrRNA. The DNA fragment for transcribing tracrRNA is shown as SEQ ID NO: 12, which contains the sequence complementary to crRNA.

[0068] Using MAXIscript TM SP6 / T7 in vitro transcription kit for in vitro transcription and purification to obtain the sgRNA sequence:

[0069] sgRNA1:

[0070] GUGAUAGAGGAUGACGAUCCGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUU (SEQ ID NO: 3);

[0071] sgRNA2:

[0072] GAAGGGUGACCUAGCUCUCCGUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCUUUU (SEQ ID NO: 4).

[0073] (2) Carefully cultivate sexually mature tilapia until they lay eggs and are fertilized in vitro to obtain excellent embryonic cells at the cell stage. In vitro transcribe the purified sgRNA obtained in step (1) and Cas9 protein, and microinject them into tilapia embryos.

[0074] Take the surviving embryos after injection and carefully cultivate them until they break through the membrane and survive, which are the F0 generation tilapia.

[0075] Example 2 Identification method and results of positive F0 generation tilapia by PCR

[0076] After 20 - 30 days of the birth of F0 generation tilapia, cut the tail fin to extract DNA, perform PCR amplification and send the products for sequencing. The primer information, PCR reaction system and PCR reaction program are shown in Table 3 - 5.

[0077] Table 3: PCR Reaction Primers

[0078]

[0079] Table 4: Reaction System

[0080] Component Volume (μL) 2×Accurate Taq Master Mix 10 trpa1b-seq-F(10μmol / μL) 1 trpa1b-seq-R(10μmol / μL) 1 <![CDATA[ddH 2 O]]> 7 DNA Template 1 Total 20

[0081] Table 5: PCR Reaction Program

[0082]

[0083] The F0 generation of tilapia was subjected to PCR detection using primers trpa1b-seq1 and trpa1b-seq2 (SEQ ID NO: 6-9), and the amplified fragment sizes were 502 bp and 328 bp, respectively.

[0084] The product electrophoresis results are as Figure 3 shown. Lanes 2-4 show a single band at 328 bp for trpa1b + / + , lanes 5-7 show two bands at 502 bp and 328 bp for trpa1b + / - , lanes 8-10 show a single band at 502 bp for trpa1b - / - , Figure 2 The sequencing map also shows that trpa1b - / - deletes 515 nucleotides (including 61 exon nucleotide sequences) from the 41st nucleotide at the exon 1 position to the 89th nucleotide at the exon 2 position.

[0085] The above tilapia were subjected to gene sequencing, and partial gene sequencing results are as Figure 2 . The sequencing results were compared with those of wild-type tilapia (trpa1b), which proved that the trpa1b gene of the F0 generation mutant tilapia had base mutations near the exon 1 and exon 2 targets.

[0086] In the target sequence shown in SEQ ID NO: 5, the underlined sites are the mutated sites: ACATATGTGATAGAGGATGA CTG GAGAAC.

[0087] Example 3 Obtaining and Genotype Identification of F1 Generation Tilapia

[0088] Positive mutant tilapia of the F0 generation were selected and mated with wild-type tilapia to screen out F1 generation heterozygous individuals and wild-types. PCR electrophoresis identification was carried out according to the method of Example 2, and the results showed that two bands appeared at 328 bp and 502 bp, and the ratio of heterozygotes to wild-types was approximately 1:1.

[0089] Obtaining of Homozygous F2-generation Tilapia and Genotype Identification

[0090] The F1-generation knockout individual tilapia screened in Example 3 was hybridized, and the homozygous F2-generation tilapia was screened and obtained, which was the trpa1b gene knockout tilapia model.

[0091] The identification method of the homozygous F2-generation tilapia was as follows: Through PCR electrophoresis identification, two bands appeared at about 502 bp and 328 bp in the PCR products of the F2-generation positive tilapia; there was one band at 328 bp for the wild type; and there was one band at 502 bp for the homozygous type.

[0092] Example 5 Low Temperature Tolerance Detection of Homozygous F2-generation Tilapia

[0093] The homozygous F2-generation tilapia and wild-type tilapia were placed in a water tank, and a gradient cooling experiment was carried out according to the Figure 4 shown method. Starting from 28 °C, it was slowly cooled to 18 °C after 10 hours, and after maintaining for 12 hours, it was slowly cooled to 8 °C after another 10 hours. During this process, the swimming behavior and survival rate of the tilapia were continuously observed, and relevant data were recorded in detail.

[0094] As Figure 5 shown, compared with the wild-type tilapia, the overturning time of the homozygous F2-generation tilapia was significantly delayed under different temperature conditions, and the time to maintain a normal body posture in a low-temperature environment was significantly prolonged.

[0095] As Figure 6 shown, the survival rate of the homozygous F2-generation tilapia in a low-temperature environment was significantly higher than that of the wild-type tilapia.

[0096] The above experiments preliminarily showed that the homozygous F2-generation tilapia had the ability to tolerate low temperatures.

[0097] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, various changes and modifications can be made to the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of trpa1b gene in constructing low-temperature-resistant strains of tilapia.

2. A trpa1b gene-specific target site sgRNA, characterized in that: The method targets the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 in exon 1 and exon 2 of the trpa1b gene, and includes a specific target site sgRNA 1 and a specific target site sgRNA 2; wherein: The specific target site sgRNA1 contains the nucleotide sequence shown in SEQ ID NO: 3; The specific target site sgRNA2 contains the nucleotide sequence shown in SEQ ID NO:

4.

3. Use of the specific target site sgRNA of the trpa1b gene according to claim 2 in constructing a low-temperature-resistant strain of tilapia.

4. A tilapia trpa1b gene mutant, characterized in that: Gene editing occurs from the 41st nucleotide in exon 1 to the 89th nucleotide in exon 2.

5. The tilapia trpa1b gene mutant according to claim 4, characterized in that: The nucleotides from position 41 in exon 1 to position 89 in exon 2 are deleted.

6. A method for constructing a low-temperature resistant strain of tilapia, characterized in that: The steps include: (1) Based on CRISPR / Cas9 gene knockout technology, the specific target site sgRNA1, sgRNA2 and Cas9 protein of the trpa1b gene according to claim 2 are microinjected into tilapia embryos, and the 41st nucleotide on exon 1 to the 89th nucleotide on exon 2 of the trpa1b gene are edited, and positive tilapia are screened after embryo cultivation to obtain F0 generation positive tilapia; (2) mating the F0 generation positive tilapia with wild-type tilapia to obtain the F1 generation knockout individual tilapia; (3) The knockout individual tilapia of the F1 generation are hybridized to obtain the F2 generation tilapia, and the homozygous tilapia of the F2 generation are screened to obtain the low temperature resistant strain of tilapia.

7. The method for constructing a low temperature resistant strain of Tilapia according to claim 6, characterized in that: In steps (1)-(3), PCR amplification and sequencing are performed to screen the F0 generation positive tilapia, the F1 generation knockout individual tilapia and the F2 generation homozygous tilapia.

8. The method for constructing a low temperature resistant strain of Tilapia according to claim 7, characterized in that: The primer sequences trpa1b-seq1-F, trpa1b-seq1-R, trpa1b-seq2-F, and trpa1b-seq2-R used in the PCR amplification and sequencing screening are shown in SEQ ID NOs: 6-9, respectively.

9. The method for constructing a low temperature resistant strain of Tilapia according to claim 6, characterized in that: In step (1), the trpa1b gene editing of the F0 generation positive tilapia is to delete the nucleotide at position 41 on exon 1 to the nucleotide at position 89 on exon 2.

10. The method for constructing a low temperature resistant strain of Tilapia according to claim 6, characterized in that: The PCR product of F0 positive tilapia showed two bands at the positions of 502bp and 328bp; the wild type showed one band at 328bp; and the homozygous type showed one band at 502bp.

Images