Application of aglA gene in preparation of L-amino acid

Abstract

The invention discloses application of an aglA gene in preparation of L-amino acid, and belongs to the technical field of biology. The application is the application of alpha-glucosidase or a substance for regulating and controlling the activity and / or content of the alpha-glucosidase in preparation of L-amino acid, and experiments prove that the aglA gene can remarkably improve the yield of the L-amino acid such as L-glutamic acid, L-lysine and L-threonine in a recombinant strain.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the aglA gene in the preparation of L-amino acids. Background Art

[0002] L-amino acids have been used in the animal feed, pharmaceutical, and cosmetic industries, and are mainly produced by fermentation using genus Corynebacterium or genus Escherichia. Currently, there are two major problems in the production of L-amino acids: low acid production and low conversion. How to fully improve the substrate utilization efficiency to increase the yield of L-amino acids during fermentation remains one of the key problems to be solved. Summary of the Invention

[0003] The technical problem to be solved by the present invention is how to increase the yield of L-amino acids. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0004] To solve the above technical problems, the present invention provides the following technical solutions:

[0005] The present invention provides the following applications:

[0006] U1) The application of α-glucosidase in the preparation of L-amino acids;

[0007] U2) The application of a substance that regulates the activity of the α-glucosidase in the preparation of L-amino acids;

[0008] U3) The application of a substance that regulates the content of the α-glucosidase in the preparation of L-amino acids.

[0009] The above α-glucosidase is any one of the following:

[0010] A1) A protein with an amino acid sequence of SEQ ID No.5;

[0011] A2) A protein derived from A1) or having more than 45% identity with the protein shown in A1) that has the same function and is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No.5;

[0012] A3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The identity of more than 45% described above may specifically be an identity of 47% - 65%, and specifically may be an identity of 47%, 54%, 57% and 62%.

[0014] In this article, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and performing a search to calculate the identity of the amino acid sequence, and then the value of identity (%) can be obtained.

[0015] In the present invention, the regulation may be to up-regulate or enhance or increase the expression level of the aforementioned protein, or may be to down-regulate or inhibit or decrease the expression level of the aforementioned protein.

[0016] In the present invention, the substance may be a substance that performs at least one of the following six types of regulations: 1) regulation at the gene transcription level; 2) regulation after gene transcription (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the gene).

[0017] The L-amino acids in the above application include polar neutral amino acids, acidic amino acids, basic amino acids and / or non-polar hydrophobic amino acids.

[0018] The basic amino acids include lysine, arginine and / or histidine.

[0019] The non-polar hydrophobic amino acids may be glycine, alanine, valine, leucine, isoleucine, phenylalanine and / or proline.

[0020] The polar neutral amino acids include tryptophan, tyrosine, serine, threonine, cysteine, methionine, glutamine or asparagine.

[0021] The acidic amino acids include glutamic acid or aspartic acid.

[0022] In the above application, the protein described in A2) is a protein with an amino acid sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, or SEQ ID No. 4.

[0023] In the above application, the substance described is a biological material related to the above protein, and the biological material is any one of the following:

[0024] B1) A nucleic acid molecule encoding the protein;

[0025] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0026] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0027] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0028] B5) A whole-cell catalyst containing the nucleic acid molecule described in B1), or a whole-cell catalyst containing the expression cassette described in B2), or a whole-cell catalyst containing the recombinant vector described in B3), or a whole-cell catalyst containing the recombinant microorganism described in B4).

[0029] The expression cassette described in the above-mentioned biological material refers to DNA that can express the protein described above in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all the regulatory sequences necessary for the nucleic acid molecule expressing any one of the above proteins. Under its compatible conditions, the regulatory sequences can direct the coding sequence to express any one of the above proteins in a suitable host cell. The regulatory sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences should include a promoter and transcription and translation termination signals. To introduce specific restriction enzyme sites into the vector for ligating the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, regulatory sequences with linkers can be provided. The regulatory sequence can be a suitable promoter sequence, i.e., a nucleic acid sequence recognizable by the host cell expressing the nucleic acid sequence. The promoter sequence contains transcriptional regulatory sequences mediating protein expression. The promoter can be any nucleic acid sequence having transcriptional activity in the selected host cell, including mutant, truncated, and hybrid promoters, and can be derived from genes encoding extracellular or intracellular proteins homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence is operably linked to the 3'-end of the nucleic acid sequence encoding the protein. Any terminator functional in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the nucleic acid sequence encoding the protein. Any leader sequence functional in the selected host cell can be used in the present invention. It may also be necessary to add regulatory sequences that can regulate protein expression according to the growth of the host cell. Examples of regulatory systems are those that can respond to chemical or physical stimulants (including in the presence of regulatory compounds) to turn on or off gene expression. Other examples of regulatory sequences are those that can amplify genes. In these examples, the nucleic acid sequence encoding the protein should be operably linked to the regulatory sequence.

[0030] The recombinant vector may comprise a nucleic acid molecule encoding the above-mentioned protein, a promoter, and transcription and translation termination signals. When preparing the recombinant vector, the nucleic acid molecule encoding the above-mentioned protein may be positioned in the vector so as to be operably linked to appropriate expression control sequences. The recombinant vector may be any vector that facilitates recombinant DNA manipulation and expression of the nucleic acid sequence (such as a plasmid or a virus). The choice of vector usually depends on the compatibility of the vector with the host cell into which it is to be introduced. The vector may be a linear or closed circular plasmid. The vector may be an autonomously replicating vector (i.e., a complete structure existing outside the chromosome and capable of replicating independently of the chromosome), such as a plasmid, an episome, a minichromosome, or an artificial chromosome. The vector may contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into the host cell, will integrate into the genome and replicate with the chromosome into which it has integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids, or a transposon that collectively contain all the DNA to be introduced into the host cell genome may be applied. The vector contains one or more selectable markers that facilitate the selection of transformed cells. A selectable marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or prototrophy to auxotrophs, etc. Examples of bacterial selectable markers are the dal gene of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. The vector contains elements that enable the vector to be stably integrated into the host cell genome or ensure autonomous replication of the vector in the cell independently of the cell genome. In the case of autonomous replication, the vector may also contain an origin of replication that enables the vector to replicate autonomously in the target host cell. The origin of replication may carry a mutation that renders it temperature-sensitive in the host cell (see, for example, fEhrlich, 1978, Proceedings of the National Academy of Sciences of the United States of America 75: 1433). One or more copies of the nucleic acid molecule encoding any of the above-mentioned proteins of the present invention may be inserted into the host cell to increase the yield of the gene product. The increase in the copy number of the nucleic acid molecule may be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome or by inserting an amplifiable selectable marker together with the nucleic acid molecule, and then culturing the cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selectable marker gene and thus containing an additional copy of the nucleic acid molecule. The operations for ligating the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0031] The term "operably linked" is defined herein as a conformation in which a regulatory sequence is positioned at an appropriate position relative to the coding sequence of a DNA sequence such that the regulatory sequence directs the expression of a protein.

[0032] The whole-cell catalyst described in B5) above may be a cell, which may be a microbial cell, a plant cell or an animal cell. The animal cell does not include human germ cells, fertilized eggs, embryos and individuals. The animal cell may be a somatic cell or a cell line of an animal.

[0033] The nucleic acid molecule described in B1) above is any one of C1), C2) or C3):

[0034] C1) A cDNA molecule or a DNA molecule whose coding sequence contains the cDNA molecule of SEQ ID No. 6;

[0035] C2) A cDNA molecule or a DNA molecule whose coding sequence contains the coding gene with the amino acid sequence of SEQ ID No. 1;

[0036] C3) A cDNA molecule or a DNA molecule whose coding sequence contains the coding gene with the amino acid sequence of SEQ ID No. 2;

[0037] C4) A cDNA molecule or a DNA molecule whose coding sequence contains the coding gene with the amino acid sequence of SEQ ID No. 3;

[0038] C5) A cDNA molecule or a DNA molecule whose coding sequence contains the coding gene with the amino acid sequence of SEQ ID No. 4;

[0039] C6) A cDNA molecule or a DNA molecule that hybridizes with the cDNA or DNA molecule defined in C1) or C2) or C3) or C4) or C5) and encodes a protein with the same function.

[0040] The above-mentioned protein also belongs to the protection scope of the present invention.

[0041] The above-mentioned biological material also belongs to the protection scope of the present invention.

[0042] The present invention also provides a method for producing L-amino acid, which includes fermenting and preparing L-amino acid by using the aforementioned protein or the aforementioned biological material.

[0043] The L-amino acid in the above method includes L-glutamic acid, L-lysine or L-threonine.

[0044] The application of the above-mentioned protein or the above-mentioned biological material in the preparation of foods, feeds, medicines, fertilizers or daily chemical products containing L-amino acid also belongs to the protection scope of the present invention.

[0045] The present invention is demonstrated by experiments that, compared with the target microorganism wild-type Corynebacterium glutamicum ATCC13032 and the L-lysine producing strain YP097158, the L-lysine yields of the recombinant Corynebacterium glutamicum YPL-aglA-1, YPL-aglA-2, YPL-aglA-3 and YPL-aglA-4 overexpressing the aglA-5 gene are significantly increased. Compared with the target microorganism wild-type Escherichia coli W3110 and Escherichia coli CGMCC No.25404, the L-threonine yields of the recombinant Corynebacterium glutamicum YPT-aglA-1, YPT-aglA-2, YPT-aglA-3 and YPT-aglA-4 overexpressing the aglA-5 gene are significantly increased. Compared with the target microorganism wild-type Corynebacterium glutamicum ATCC13869 and the L-lysine producing strain CGMCC No.21220, the L-glutamic acid yields of the recombinant Corynebacterium glutamicum YPG-aglA-1, YPG-aglA-2, YPG-aglA-3 and YPG-aglA-4 overexpressing the aglA-5 gene are significantly increased. Detailed Description of the Invention

[0046] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0047] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0048] Wild-type Corynebacterium glutamicum ATCC13032 strain: a product of the American Type Culture Collection (ATCC).

[0049] Corynebacterium glutamicum YP097158 in the following examples is described in the Chinese patent document with the authorization number "CN110607313B" and the name "A recombinant strain with high yield of L-lysine and its construction method and application". The strain number is YP097158 and it was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on August 16, 2016, with the deposit number CGMCC No. 12856. Hereinafter, it is referred to as Corynebacterium glutamicum CGMCC No. YP097158.

[0050] Corynebacterium glutamicum CGMCC No. 21220 in the following examples is described in the Chinese patent document with the authorization number "CN112725253B" and the name "A recombinant strain for modifying gene BBD29_14900 and its construction method and application". The strain number is YPGLU001 and it was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on November 23, 2020, with the deposit number CGMCC No. 21220. Hereinafter, it is referred to as Corynebacterium glutamicum CGMCC No. 21220.

[0051] The following examples used GraphPad Prism 8 statistical software to process the data. The experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used. P < 0.01 indicates extremely significant difference.

[0052] Example 1: Construction of an engineering strain containing the aglA vector

[0053] I. Construction of the aglA gene vector

[0054] To study the utilization effect of aglA on isomaltose, first, based on the aglA gene sequence in the genome of Bifidobacterium adolescentis published by NCBI, its protein function and structure were analyzed, and five aglA genes were designed and synthesized: aglA-1 (the nucleotide sequence is the ORF (CDS) sequence of the aglA-1 gene (1770 bp), encoding the amino acid shown in SEQ ID No.1), aglA-2 (the nucleotide sequence is the ORF (CDS) sequence of the aglA-2 gene (1821 bp), encoding the amino acid shown in SEQ ID No.2), aglA-3 (the nucleotide sequence is the ORF (CDS) sequence of the aglA-3 gene (1740 bp), encoding the amino acid shown in SEQ ID No.3), aglA-4 (the nucleotide sequence is the ORF (CDS) sequence of the aglA-4 gene (1815 bp), encoding the amino acid shown in SEQ ID No.4), and aglA-5 (the nucleotide sequence is as shown in SEQ ID No.6, encoding the amino acid shown in SEQ ID No.5).

[0055] The above five synthesized aglA genes (with the H36 promoter during synthesis) and the expression vector pXMJ19 (purchased from Biovector, catalog number Biovector pXMJ19, containing chloramphenicol resistance) digested and recovered with Xbal I and BamH I were ligated at 50°C for 30 min using NEBuilder enzyme (purchased from NEB). The ligation product was transformed into DH5α competent cells and spread on 2-YT agar plates containing chloramphenicol (34 mg / L) and cultured at 37°C for 12 h. The monoclonal colonies grown were identified by PCR using primers MJ19-F (5'-GCGGATAACAATTTCACACAG-3') / MJ19-R (5'-CTCTCATCCGCCAAAACAG-3'). The PCR amplification system: 2×Premix rTaq 12.5 μL, each primer (10 pM) 1 μL, supplemented with ddH 2 O to a total volume of 25 μL. The PCR amplification program: pre-denaturation at 94°C for 15 min, denaturation at 94°C for 30 s; annealing at 58°C for 30 s; extension at 72°C for 2 min (30 cycles), and over-extension at 72°C for 10 min.

[0056] The identified positive strains were used to extract plasmids for sequencing respectively. The plasmids with correct sequencing results were named pXMJ19-aglA-1 (containing the ORF (CDS) sequence of aglA-1 gene (1770 bp)), pXMJ19-aglA-2 (containing the ORF (CDS) sequence of aglA-2 gene (1821 bp)), pXMJ19-aglA-3 (containing the ORF (CDS) sequence of aglA-3 gene (1740 bp)), pXMJ19-aglA-4 (containing the ORF (CDS) sequence of aglA-4 gene (1815 bp)), and pXMJ19-aglA-5 (containing the gene sequence shown in SEQ ID No. 6).

[0057] pXMJ19-aglA-1 is a recombinant expression vector obtained by replacing the sequence between the Xbal I and BamH I restriction enzyme recognition sites of pXMJ19 with the ORF (CDS) sequence of aglA-1 gene (1770 bp), and the other nucleotide sequences remain unchanged. The protein expressed by this vector has the amino acid sequence of SEQ ID No. 1.

[0058] pXMJ19-aglA-2 is a recombinant expression vector obtained by replacing the sequence between the Xbal I and BamH I restriction enzyme recognition sites of pXMJ19 with the ORF (CDS) sequence of aglA-2 gene (1821 bp), and the other nucleotide sequences remain unchanged. The protein expressed by this vector has the amino acid sequence of SEQ ID No. 2.

[0059] pXMJ19-aglA-3 is a recombinant expression vector obtained by replacing the sequence between the Xbal I and BamH I restriction enzyme recognition sites of pXMJ19 with the ORF (CDS) sequence of aglA-3 gene (1740 bp), and the other nucleotide sequences remain unchanged. The protein expressed by this vector has the amino acid sequence of SEQ ID No. 3.

[0060] pXMJ19-aglA-4 is a recombinant expression vector obtained by replacing the sequence between the Xbal I and BamH I restriction enzyme recognition sites of pXMJ19 with the ORF (CDS) sequence of aglA-4 gene (1815 bp), and the other nucleotide sequences remain unchanged. The protein expressed by this vector has the amino acid sequence of SEQ ID No. 4.

[0061] pXMJ19-aglA-5 is a recombinant expression vector obtained by replacing the sequence between the Xbal I and BamHI restriction enzyme recognition sites of pXMJ19 with SEQ ID No. 6, and the other nucleotide sequences remain unchanged. The protein expressed by this vector has the amino acid sequence of SEQ ID No. 5.

[0062] II. Construction of ATCC13032 strain with aglA gene vector

[0063] Culture plate containing chloramphenicol (34 mg / L): The solvent is water, and the solute and its concentration are sucrose 10 g / L, polypeptone 10 g / L, beef extract 10 g / L, yeast powder 5 g / L, urea 2 g / L, sodium chloride 2.5 g / L, agar powder 18 g / L, pH 7.0.

[0064] Rich medium: The solvent is water, and the solute and its concentration are glucose 25 g / L, isomaltose 5 g / L, (NH4) 2 SO 4 2 g / L, H 3 PO 4 0.5 g / L, KCl 0.8 g / L, MgSO 4 ·7H 2 O 0.8 g / L, FeSO 4 ·7H 2 O 0.05 g / L, MnSO 4 ·H 2 O 0.05 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, VH 20 mg / L, VB 1 1.5 mg / L, VB 3 1.5 mg / L, VB 12 1.5 g / L, adjusted to pH 7.0 with sodium hydroxide.

[0065] To identify the utilization effect of the 5 vectors pXMJ19-aglA constructed in Step 1 on isomaltose, the 5 vectors were transformed into the wild-type Corynebacterium glutamicum ATCC13032 strain by electroporation (the specific transformation method can be referred to WO2014121669A1), and positive transformants were obtained by PCR identification with primers MJ19-F / MJ19-R, namely Corynebacterium glutamicum ATCC13032-pXMJ19-aglA-1, ATCC13032-pXMJ19-aglA-2, ATCC13032-pXMJ19-aglA-3, ATCC13032-pXMJ19-aglA-4, and ATCC13032-pXMJ19-aglA-5.

[0066] The above 5 positive transformants were cultured on a culture plate containing chloramphenicol (34 mg / L) at 32 °C for 12 h, which was defined as one generation. After continuous subculture for three generations, they were inoculated into a 500 mL Erlenmeyer flask containing 30 mL of rich medium and fermented by shaking at 30 °C for 48 h. After the fermentation culture was completed, the concentration of isomaltose was detected by high performance liquid chromatography (HPLC).

[0067] Table 1 Detection of isomaltose content in ATCC13032-pXMJ19-aglA by high performance liquid chromatography

[0068]

[0069] As shown in Table 1, all 5 Corynebacterium glutamicum ATCC13032-pXMJ19-aglA strains had the ability to decompose isomaltose. Among them, ATCC13032-pXMJ19-aglA-5 had the best ability to decompose isomaltose, indicating that the aglA-5 gene had the highest activity in degrading isomaltose.

[0070] III. Construction of ATCC13869 strain containing aglA gene vector

[0071] To identify the utilization effect of the 5 vectors pXMJ19-aglA constructed in step I on isomaltose, the 5 vectors were transformed into the wild-type Corynebacterium glutamicum ATCC13869 strain (CICC, catalog number 20216) by electroporation and identified by PCR using primers MJ19-F / MJ19-R to obtain positive transformants ATCC13869-pXMJ19-aglA-1, ATCC13869-pXMJ19-aglA-2, ATCC13869-pXMJ19-aglA-3, ATCC13869-pXMJ19-aglA-4 and ATCC13869-pXMJ19-aglA-5. The 5 positive transformants were cultured on a chloramphenicol (34 mg / L) culture plate at 32 °C for 12 h, and then single colonies were picked for streak culture. After continuous subculture for three generations, they were inoculated into a 500 mL Erlenmeyer flask containing 30 mL of rich medium and fermented by shaking at 30 °C for 48 h. After the fermentation culture was completed, the concentration of isomaltose was detected by high performance liquid chromatography (HPLC).

[0072] Table 2 Detection of isomaltose content in ATCC13869-pXMJ19-aglA by high performance liquid chromatography

[0073]

[0074] The results are shown in Table 2. All 5 Corynebacterium glutamicum ATCC13869-pXMJ19-aglA strains have the ability to decompose isomaltose. Among them, ATCC13869-pXMJ19-aglA-5 has the best ability to decompose isomaltose, indicating that the aglA-5 gene has the highest activity in degrading isomaltose.

[0075] IV. Construction of W3110 Strains Carrying the aglA Gene Vector

[0076] To identify the utilization effect of the 5 vectors pXMJ19-aglA constructed in Step 1 on isomaltose, the 5 vectors were transformed into the wild-type Escherichia coli W3110 strain (ATCC, catalog number 27325) by electroporation and identified by PCR using primers MJ19-F / MJ19-R to obtain positive transformants W3110-pXMJ19-aglA-1, W3110-pXMJ19-aglA-2, W3110-pXMJ19-aglA-3, W3110-pXMJ19-aglA-4, and W3110-pXMJ19-aglA-5. After the 5 positive transformants were subcultured three times on 2YT culture plates (chloramphenicol 34 mg / L), they were inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich medium and cultured by shaking at 37 °C for 24 h. After the fermentation culture was completed, the concentration of isomaltose was detected by high performance liquid chromatography (HPLC).

[0077] Table 3 Detection of Isomaltose Content in W3110-pXMJ19-aglA by High Performance Liquid Chromatography

[0078]

[0079] The results are shown in Table 3. All 5 Escherichia coli W3110-pXMJ19-aglA strains have the ability to decompose isomaltose. Among them, W3110-pXMJ19-aglA-5 has the best ability to decompose isomaltose, indicating that the aglA-5 gene has the highest activity in degrading isomaltose. Combining the data in Table 1, Table 2, and Table 3, it shows that the aglA-5 gene has the ability to degrade isomaltose in Corynebacterium glutamicum ATCC13032, ATCC13869, and Escherichia coli W3110, and has the highest activity.

[0080] Example 2. Application of the aglA-5 Gene in the Preparation of L-Lysine-Producing Bacteria

[0081] I. Construction of Engineering Strains Expressing the aglA-5 Gene on Plasmids

[0082] The successfully constructed pXMJ19-aglA-5 plasmid in Example 1 was electrotransformed into wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum YP097158 (a L-lysine producing strain, deposit number: CGMCC No. 12856, deposit date: August 16, 2016, depository: China General Microbiological Culture Collection Center, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355). The cultures were incubated on culture plates containing chloramphenicol (34 mg / L) for 30 h. The single colonies generated from the cultures were identified by PCR using primers MJ19-F / MJ19-R (MJ19-F is located at positions 6570-6590 bp in the pXMJ19 vector, and MJ19-R is located at positions 69-87 bp in the pXMJ19 vector). The positive strains were those for which a 2014-bp fragment was amplified by PCR (where the 1st to 141st bases are the upstream sequence of the amplification fragment of the MJ19-F / MJ19-R identification primers, the 142nd to 1962nd bases are the aglA-5 gene with the nucleotide sequence shown in SEQ ID No. 6, and the 1963rd to 2014th bases are the downstream sequence of the amplification fragment of the MJ19-F / MJ19-R identification primers).

[0083] The strains obtained using wild-type Corynebacterium glutamicum ATCC13032 and L-lysine producing strain YP097158 as starting strains were named YPL-aglA-1 and YPL-aglA-2, respectively. The recombinant strain YPL-aglA-1 contains the plasmid with the aglA gene shown in SEQ ID No. 6, which can significantly and stably increase the expression level of the aglA gene in wild-type Corynebacterium glutamicum ATCC13032; the recombinant strain YPL-aglA-2 contains the plasmid with the aglA gene shown in SEQ ID No. 6, which can significantly and stably increase the expression level of the aglA gene in L-lysine producing strain YP097158.

[0084] II. Construction of engineering strains expressing the aglA-5 gene on the genome

[0085] Based on the Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, 3 pairs of primers for amplifying the upstream and downstream homologous arm fragments, the coding region, and the promoter region of the aglA-5 gene were designed and synthesized, and the aglA-5 gene copy was inserted into L-lysine producing strain YP097158 and wild-type Corynebacterium glutamicum ATCC13032 by homologous recombination.

[0086] The primer design is as follows (synthesized by Invitrogen, Shanghai):

[0087] P1: 5'-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAATGCGTTCTGGACTGAGG-3' (The underlined nucleotide sequence is the sequence on pK18);

[0088] P2: 5'-CGTTTAGGGCACCAGATAGAgtgcaccgagaacagatg-3';

[0089] P3 5'-catctgttctcggtgcacTCTATCTGGTGCCCTAAACG-3';

[0090] P4: 5'-cttgatttaattgcgccatctgTTACAGCTGCACTGCTGCTGCTTC-3';

[0091] P5: 5'-GAAGCAGCAGCAGTGCAGCTGTAAcagatggcgcaattaaatcaag-3';

[0092] P6: 5'-CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCTATGACACCTTCAACGGATC-3'.

[0093] Among the above primers, the underlined nucleotide sequence is the homologous sequence on the pK18mobsacB plasmid, which is used to integrate the DNA fragment (upstream homologous arm, promoter - aglA - 5 gene, downstream homologous arm) into the pK18mobsacB plasmid (from Addgene) through homologous recombination. The bases shown in lowercase letters on P2 and P3 are used to ligate the upstream homologous arm and the promoter - aglA - 5 gene by homologous recombination, and the lowercase letters on P4 and P5 are used to ligate the promoter - aglA - 5 gene and the downstream homologous arm by homologous recombination.

[0094] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplifications were carried out with primers P1 / P2 and P5 / P6 respectively to obtain an upstream homologous arm fragment of 763 bp (corresponding to positions 1,928,220 to 1,928,982 of the Corynebacterium glutamicum ATCC13032 genome sequence (GenBank: CP025533.1, 27-DEC-2017), i.e., the partial coding region of NCgl1740 and the NCgl1741 gene and its promoter region (763 bp)) and a downstream homologous arm fragment of 596 bp (corresponding to positions 1,929,024 to 1,929,619 of the Corynebacterium glutamicum ATCC13032 genome sequence (GenBank: CP025533.1, 27-DEC-2017), i.e., the partial coding region of the NCgl1742 gene (596 bp)). Using plasmid pXMJ19-aglA-5 as a template, PCR amplification was carried out with primers P3 / P4 to obtain an aglA-5 gene and its promoter fragment (i.e., promoter - aglA-5 gene) of 1,901 bp (where positions 1 - 80 are the H36 promoter sequence (80 bp), and positions 81 - 1,901 are the aglA-5 gene (SEQ ID No.6)). After the PCR reaction, the three amplified fragments were electrophoretically recovered respectively using a column DNA gel recovery kit. The three recovered fragments and the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I and BamHI were ligated at 50 °C for 30 min using NEBuilder enzyme (NEB). The monoclonal colonies grown after transformation of the ligation product were identified by PCR with primers M13F (5′-TGTAAAACGACGGCCAGT-3′) / M13R (5′-CAGGAAACAGCTATGACC-3′) to obtain a positive integration plasmid (recombinant vector). The obtained recombinant vector was pK18-aglA(L). This positive integration plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated into the genome can be obtained by screening with kanamycin. The pK18-aglA(L) plasmid is a recombinant expression vector in which the sequence between the Xbal I and BamHI digestion recognition sites of the pK18mobsacB plasmid is replaced by a DNA fragment while keeping other sequences unchanged. The DNA fragment is formed by homologous recombination of the upstream homologous arm (the partial coding region of NCgl1740 and the NCgl1741 gene and its promoter region, 763 bp), the aglA-5 gene (SEQ ID No.6) and its promoter fragment (H36 promoter sequence, 80 bp), and the downstream homologous arm (the partial coding region of the NCgl1742 gene, 596 bp) in the 5'-3' direction sequence.

[0095] PCR amplification system: 5×HiFi with Mg 2+Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, each primer (10 pM) 1.6 μL, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH 2 O to a total volume of 50 μL.

[0096] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0097] The correctly sequenced integration plasmid pK18-aglA(L) was electrotransformed into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 respectively. The cells were cultured on a culture plate containing chloramphenicol (34 mg / L) for 30 h. The single colonies formed were identified by PCR using primers P7 / P8. The positive strains were those that amplified a fragment of 1488 bp (the sequence was the amplified fragment of the identification primers P7 and P8), and the original strains were those that did not amplify the fragment. The positive strains were streaked on a solid culture plate containing 15% sucrose and cultured for 30 h. The single colonies formed were further identified by PCR using primers P9 / P10. The bacteria that amplified a fragment of 1537 bp (the sequence was the amplified fragment of the identification primers P9 and P10) were the positive strains in which the aglA-5 gene and its promoter were integrated into the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 of the Corynebacterium glutamicum genome. The strains obtained using wild-type Corynebacterium glutamicum ATCC13032 and lysine-producing strain YP097158 as the starting strains were named YPL-aglA-3 and YPL-aglA-4 respectively.

[0098] The recombinant bacteria YPL-aglA-3 and YPL-aglA-4 contain the aglA gene shown in SEQ ID No.6; specifically, the recombinant bacterium YPL-aglA-3 replaces the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of wild-type Corynebacterium glutamicum ATCC13032 with the aglA-5 gene and its promoter (the sequence is composed of the H36 promoter sequence (80bp) and SEQ ID No.6 connected in the 5'-3' direction), that is, the nucleotide sequence at positions 1928983 to 1929023 of the Corynebacterium glutamicum ATCC13032 genome sequence (GenBank: CP025533.1, 27-DEC-2017) is replaced with the DNA fragment composed of the H36 promoter sequence (80bp) and SEQ ID No.6 connected in the 5'-3' direction, and the other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 remain unchanged to obtain the recombinant bacterium. The recombinant bacterium YPL-aglA-4 replaces the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 (i.e., the nucleotide sequence at positions 1928983 - 1929023 corresponding to the Corynebacterium glutamicum ATCC13032 genome sequence (GenBank: CP025533.1, 27-DEC-2017)) with the aglA-5 gene and its promoter (the sequence is the DNA fragment composed of the H36 promoter sequence (80bp) and SEQ ID No.6 connected in the 5'-3' direction), and the other nucleotides in the genome of Corynebacterium glutamicum YP097158 remain unchanged to obtain the recombinant bacterium.

[0099] The PCR identification primers are as follows:

[0100] P7: 5'-TCCAAGGAAGATACACGCC-3' (corresponding to the outside of the upstream homologous arm NCgl1740, located at positions 1928088 - 1928106bp of the Corynebacterium glutamicum ATCC13032 genome);

[0101] P8: 5'-GCTACCACCAAAGTAAGAGCC-3' (corresponding to the inside of the aglA gene, located at positions 493 - 513bp of the coding region);

[0102] P9: 5'-TTGTGATGGCGTGAAGTG-3' (corresponding to the inside of the aglA gene, located at positions 972 - 989bp of the coding region);

[0103] P10: 5'-TGGTCGTTGGAATCTTGC-3' (corresponding to the outside of the homologous arm NCgl1742, at positions 1929693-1929710 bp of the Corynebacterium glutamicum ATCC13032 genome).

[0104] III. L-lysine fermentation experiment

[0105] Ferment the YPL-aglA-1 and YPL-aglA-2 constructed in step one, YPL-aglA-3 and YPL-aglA-4 constructed in step two, the L-lysine producing strain YP097158, and the wild-type Corynebacterium glutamicum ATCC13032 in a fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) with the following medium and L-lysine fermentation process. After fermentation, use an SBA biosensor (purchased from the Institute of Biology, Shandong Academy of Sciences) to detect the L-lysine content. Each strain is repeated three times, and the results are shown in Table 4. Fermentation medium formula (the rest is water): starch hydrolyzate 30 g / L, ammonium sulfate 12 g / L, magnesium sulfate 0.87 g / L, molasses 20 g / L, acidified corn steep liquor 3 mL / L, phosphoric acid 0.4 mL / L, potassium chloride 0.53 g / L, antifoaming agent (2% antifoam) 4 mL / L, ferrous sulfate 120 mg / L, manganese sulfate 120 mg / L, nicotinamide 42 mg / L, calcium pantothenate 6.3 mg / L, vitamin B1 6.3 mg / L, copper and zinc salt solution 0.6 g / L, biotin 0.88 mg / L.

[0106] L-lysine fermentation process:

[0107] Fermentation conditions: temperature 37°C, time 48 h, pH 6.9 ± 0.05, dissolved oxygen DO 10-30%, inoculation amount 10% (volume ratio);

[0108] Initial control conditions: temperature 37°C, pH 6.9, tank pressure 0 Mpa, air volume 3 L / min, rotation speed 550 rpm;

[0109] Dissolved oxygen control: when the dissolved oxygen < 30%, successively increase the rotation speed to 750 rpm → 800 rpm → 850 rpm → 950 rpm, and the air volume is 4 L / min;

[0110] Tank pressure control: increase the tank pressure by 0.01 Mpa at 6 h of fermentation; increase the tank pressure to 0.02 Mpa → 0.03 Mpa → 0.04 Mpa → 0.05 Mpa at 12 h;

[0111] Residual sugar control: 0.1-0.2% before 12 h of fermentation; control the residual sugar at 0.1-0.05% after 12 h of fermentation in combination with the DO requirement;

[0112] Ammonia nitrogen control: 0.1 - 0.15 before 12 h of fermentation; 0.15 - 0.25 from 12 h to 32 h of fermentation; 0.1 - 0.15 after 32 h of fermentation;

[0113] Fed-batch materials: 25% ammonia water, 70% concentrated sugar, 50% ammonium sulfate, 10% antifoam agent (foam inhibitor);

[0114] Table 4 L-lysine fermentation data of aglA engineered strains

[0115]

[0116] The results are shown in Table 4. Overexpression of the aglA gene in the wild-type Corynebacterium glutamicum ATCC13032 and the L-lysine producing strain YP097158 both contributed to the increase in L-lysine production.

[0117] Example 3. Application of the aglA-5 gene in the preparation of L-threonine producing bacteria

[0118] I. Construction of an engineered strain expressing the aglA-5 gene on a plasmid

[0119] 2YT agar plate formula: yeast 10 g / L, peptone 16 g / L, sodium chloride 5 g / L, agarose 18 g / L, adjust the pH to 7.0 with NaOH, autoclave at 121 °C for 15 min.

[0120] The successfully constructed pXMJ19-aglA-5 plasmid in Example 1 was electrotransformed into wild-type Escherichia coli W3110 (ATCC, catalog number 27325) and Escherichia coli CGMCC25404 (i.e., Escherichia coli, preservation number: CGMCC No. 25404, preservation date: July 25, 2022, preservation unit: China General Microbiological Culture Collection Center, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807288), and cultured on 2YT agar plates for 18 h. The single colonies produced by the culture were identified by PCR using primers MJ19-F / MJ19-R. The positive strains were those with a PCR amplification product containing a 2014-bp fragment (where the 1st to 141st bases were the upstream sequence of the MJ19-F / MJ19-R identification primer amplification fragment, the 142nd to 1962nd bases were the aglA-5 gene with the nucleotide sequence shown in SEQ ID No. 6, and the 1963rd to 2014th bases were the downstream sequence of the MJ19-F / MJ19-R identification primer amplification fragment). The strains obtained using wild-type Escherichia coli W3110 and L-threonine-producing strain CGMCC25404 as the starting strains were named YPT-aglA-1 and YPT-aglA-2, respectively; the recombinant strain YPT-aglA-1 containing the plasmid with the aglA gene shown in SEQ ID No. 6 could significantly and stably increase the expression level of the aglA gene in wild-type Escherichia coli W3110; the recombinant strain YPT-aglA-2 containing the plasmid with the aglA gene shown in SEQ ID No. 6 could significantly and stably increase the expression level of the aglA gene in L-threonine-producing strain CGMCC25404.

[0121] II. Construction of an engineered strain expressing the aglA-5 gene on the genome

[0122] Based on the Escherichia coli W3110 genome sequence published by NCBI, the aglA-5 gene was integrated into the coding region of the yaiT gene in L-threonine-producing strain CGMCC25404 and wild-type Escherichia coli W3110 using the CRISPR / Cas9 gene editing technology to further study the effect of the aglA-5 gene on the synthesis amount of L-threonine.

[0123] (1) Construction of sgRNA

[0124] According to the genome sequence of Escherichia coli W3110 published by NCBI (genbank accession number: AP009048.1), the sgRNA target sequence was designed using CRISPR RGEN Tools (http: / / www.rgenome.net / cas-designer / ). After selecting the appropriate sgRNA target sequence, the terminal sequences of the linearized pGRB cloning vector were added to the 5' and 3' ends of the target sequence to form a complete sgRNA plasmid by recombination.

[0125] The sgRNA fragment was amplified without a template, and only the PCR annealing process was required. The reaction system and procedure are as follows. PCR reaction system: sgRNA-2F 10 μL, sgRNA-2R 10 μL; PCR reaction procedure: denaturation at 95 °C for 5 min, annealing at 50 °C for 1 min. After annealing, the target fragment was recovered using a DNA purification kit, its DNA concentration was measured, and the concentration was diluted to 100 ng / μL.

[0126] The pGRB plasmid was extracted and digested with Spe I and dephosphorylated to prevent self-ligation of the pGRB plasmid. Digestion system: 10xBuffer 5 μL, SpeⅠ 2.5 μL, pGRB plasmid DNA 3000 - 5000 ng, supplemented with ddH 2 O to 50 μL. After digestion at 37 °C for 3 h, the gel was cut and recovered by agarose gel electrophoresis, and then the dephosphorylation reaction was carried out. Dephosphorylation system: 10xBuffer 5 μL, pGRB plasmid DNA 1000 - 2000 ng, CIAP 2.5 μL, supplemented with ddH 2 O to 50 μL. After treatment at 37 °C for 1 h, the linear pGRB plasmid was recovered using a DNA purification kit. Then, the recombination of sgRNA and pGRB plasmid was carried out using the Gibson Assembly kit (New England). Recombination system: NEB assembly enzyme 2.5 μL, linearized cloning vector 2 μL, sgRNA 0.5 μL. After assembly at 50 °C for 30 min, the product was transformed into DH5α competent cells, the plasmid was extracted, and sequenced and identified using the sequencing primers sgRNA-PF / sgRNA-PR. The plasmid with correct sequencing was named pGRB-sgRNA-1.

[0127] The primers used in this experiment were designed as follows (synthesized by Shanghai invitrogen). The underlined bases are the homologous arm sequences of the pGRB cloning vector, and the lowercase and bold bases are the sgRNA sequences, targeting positions 389640 to 389659 of the W3110 genome sequence (genbank accession number: AP009048.1):

[0128] sgRNA-2F: 5'-TGACAGCTAGCTCAGTCCTAGGTATAATACTAGTggcaactatgtaaactatagGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG-3'

[0129] sgRNA-2R: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACctatagtttacatagttgccACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3'’

[0130] sgRNA-PF: 5'-GTCTCATGAGCGGATACATATTTG-3'

[0131] sgRNA-PR: 5'-ACTGGCACTGCTGTGCGCCG-3'

[0132] (2) PCR amplification of homologous DNA fragments

[0133] Based on the genomic sequence of Escherichia coli W3110 published by NCBI, three pairs of primers for amplifying upstream and downstream homologous arms, the coding region and promoter region of the aglA-5 gene were designed and synthesized, and the aglA-5 gene was introduced into the coding regions of the L-threonine-producing bacterium CGMCC25404 and Escherichia coli W3110 yaiT by CRISPR / Cas9 gene editing method.

[0134] The primer design is as follows (synthesized by Invitrogen, Shanghai):

[0135] P11: 5'-AAGAGAATGGAAGAGAGGCC-3',

[0136] P12: 5'-CGTTTAGGGCACCAGATAGAcccaatcaagtgctgtaacg-3',

[0137] P13: 5'-cgttacagcacttgattgggTCTATCTGGTGCCCTAAACG-3',

[0138] P14: 5'-cggtagtgtaggtttcgttgTTACAGCTGCACTGCTGCTGCTTC-3',

[0139] P15: 5'-GAAGCAGCAGCAGTGCAGCTGTAAcaacgaaacctacactaccg-3',

[0140] P16: 5'-CGACCTGTAG TATCCCATTC-3'.

[0141] Using the W3110 genomic DNA as a template, PCR amplifications were performed with primers P11 / P12 and P15 / P16 respectively. The enzyme used was KAPAHiFi HotStart (KAPA, product number KR1501), and an upper homologous arm fragment of 570 bp (the upper homologous arm fragment amplified by P11 / P12, i.e., positions 389041 to 389610 of the W3110 genome) and a lower homologous arm fragment of 585 bp (the lower homologous arm fragment amplified by P15 / P16, i.e., positions 390148 to 390733 of the W3110 genome) were obtained; using the plasmid pXMJ19-aglA-5 as a template, PCR amplification was performed with primers P13 / P14, and an aglA-5 gene and its promoter fragment of 1901 bp were obtained (where positions 1-80 are the H36 promoter (80 bp), and positions 81-1901 are the aglA-5 gene (SEQ ID No.6)). After the PCR reaction, agarose gel electrophoresis recovery was performed using a column DNA gel recovery kit respectively. The three recovered DNA fragments were subjected to overlap PCR with primers P11 and P16 to obtain a genomic overexpression DNA recombinant fragment Up-aglA-Down (its sequence is composed of the upper homologous arm fragment (570 bp) amplified by P11 / P12, the H36 promoter sequence (80 bp), SEQ ID No.6 (1821 bp), and the lower homologous arm fragment (585 bp) amplified by P15 / P16 in the 5'-3' direction), with a size of 3056 bp.

[0142] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTPMixture (10 mM) 1.5 μL, each primer (10 pM) 1.6 μL, KAPAHiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH 2 O to a total volume of 50 μL.

[0143] PCR amplification program: Pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0144] (3) Preparation and transformation of competent cells

[0145] 2-YT agar plate containing spectinomycin (100 mg / L): 10 g / L yeast, 16 g / L peptone, 5 g / L sodium chloride, 18 g / L agarose, pH adjusted to 7.0 with NaOH, autoclaved at 121 °C for 15 min.

[0146] Extract the pREDCas9 plasmid (containing the spectinomycin resistance gene) (addgene, catalog number 71541), and transform it into the competent cells of L-threonine producing bacterium CGMCC25404 and Escherichia coli W3110 respectively. Spread them on a 2-YT agar plate containing spectinomycin (100 mg / L) and culture at 32 °C. Select the single colonies resistant to spectinomycin (100 mg / L) and perform PCR identification with primers pRedC as9-PF (5'-GCAGTGGCGGTT TTCATG-3') / pRedCas9-PR (5'-CCTTGGTGATCTCGCCTTTC-3'). Those with the PCR amplification sequence (943 bp) of the identification primers pRedCas9-F / pRedCas9-R are the CGMCC25404-Cas9 and W3110-Cas9 transformants containing the pREDCas9 plasmid.

[0147] Prepare the competent cells of L-threonine producing bacterium CGMCC25404-Cas9 and W3110-Cas9. When the cell density reaches OD 600nm = 0.1, add IPTG with a final concentration of 0.1 mM to induce λ-Red mediated homologous recombination. When OD 600nm = 0.4, collect the cells to prepare competent cells, and transform the pGRB-sgRNA-1 plasmid and the genomic recombination fragment Up-aglA-Down respectively. Spread them on a 2-YT agar plate containing spectinomycin (100 mg / L) and ampicillin (100 mg / L) and culture at 32 °C for 12 h. After subculturing the single colonies produced by the culture, perform PCR identification with primers P11 / P16. The positive transformants are those with a PCR amplified fragment containing 3056 bp (the sequence is composed of the upstream homologous arm fragment (570 bp) amplified by P11 / P12, the H36 promoter sequence (80 bp), SEQ ID No.6 (1821 bp) and the downstream homologous arm fragment (585 bp) amplified by P15 / P16 connected in the 5'-3' direction).

[0148] PCR amplification system: 2×Premix r Taq 12.5 μL, each primer (10 pM) 1 μL, supplemented with ddH 2 O to a total volume of 25 μL.

[0149] PCR amplification program: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s; annealing at 56°C for 30 s; extension at 72°C for 3 min (30 cycles), over-extension at 72°C for 10 min.

[0150] Inoculate the positive transformants into 2-YT medium containing spectinomycin (100 mg / L) and arabinose with a final concentration of 0.2% to eliminate plasmid pGRB-sgRNA-1. Select the colonies that grow on spectinomycin (100 mg / L) but not on ampicillin (100 mg / L), and then transfer these colonies to 2-YT medium for culturing at 42°C to eliminate the pREDCas9 plasmid. Select the colonies that do not grow on spectinomycin (100 mg / L) but grow on antibiotic-free 2-YT, and perform PCR identification again with primers P11 / P16. The positive clones that can amplify a fragment of 3056 bp in size are sent for sequencing. The strains with correct sequencing results are named YPT-aglA-3 (the starting strain is Escherichia coli W3110) and YPT-aglA-4 (the starting strain is L-threonine-producing strain CGMCC25404), respectively.

[0151] The recombinant strains YPT-aglA-3 and YPT-aglA-4 contain the aglA-5 gene shown in SEQ ID No. 6; specifically, in recombinant strain YPT-aglA-3, the partial coding region of yaiT on the genome of wild-type Escherichia coli W3110 (i.e., positions 389611 to 390147 of the W3110 genome sequence (genbank accession number AP009048.1)) is replaced with the aglA-5 gene and its promoter (where positions 1 to 80 are the H36 promoter (80 bp), and positions 81 to 1901 are the aglA-5 gene (SEQ ID No. 6)), and the other nucleotides in its genome remain unchanged; in recombinant strain YPT-aglA-4, the partial coding region of yaiT on the genome of L-threonine-producing strain CGMCC25404 (corresponding to positions 389611 to 390147 of the W3110 genome sequence (genbank accession number AP009048.1)) is replaced with the aglA-5 gene and its promoter (where positions 1 to 80 are the H36 promoter (80 bp), and positions 81 to 1901 are the aglA-5 gene (SEQ ID No. 6)), and the other nucleotides in its genome remain unchanged. The recombinant strains containing the aglA-5 gene can significantly and stably increase the expression level of the aglA gene.

[0152] III. L-threonine fermentation experiment

[0153] The YPT-aglA-1 and YPT-aglA-2 constructed in Step 1, the YPT-aglA-3 and YPT-aglA-4 constructed in Step 2, the wild-type Escherichia coli W3110, and the L-threonine-producing strain CGMCC25404 were respectively inoculated into a 5L fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) for fermentation experiments with an L-threonine fermentation medium and culture conditions, and each strain was repeated three times.

[0154] L-threonine fermentation medium: The solvent is water, and the solutes and their concentrations are 13 g / L of glucose, 1 g / L of (NH4)2SO4, 0.5 g / L of H3PO4, 0.8 g / L of KCl, 0.8 g / L of MgSO4·7H2O, 0.01 g / L of FeSO4·7H2O, 0.01 g / L of MnSO4·H2O, 0.05 g / L of ZnSO4, 1.5 g / L of FM902 yeast powder, 5 g / L of corn steep liquor, 17 g / L of molasses, and the pH is adjusted to 7.0 by introducing ammonia. 2 SO 4 1g / L,H 3 PO 4 0.5g / L,KCl 0.8g / L,MgSO 4 ·7H 2 O 0.8g / L,FeSO 4 ·7H 2 O 0.01g / L,MnSO 4 ·H 2 O 0.01g / L,ZnSO 4 0.05g / L,FM902 yeast powder 1.5g / L, corn steep liquor 5g / L, molasses 17g / L, and the pH is adjusted to 7.0 by introducing ammonia.

[0155] L-threonine fermentation culture conditions:

[0156] Calibrate DO to 100%: Temperature 37°C, air volume 5 L / min, rotation speed 800 rpm, tank pressure 0 Mpa, and calibrate after 5 min;

[0157] Inoculation amount 10%;

[0158] Initial conditions: pH 7.0, culture temperature 37°C, tank pressure 0 Mpa, air volume 0.5 L / min, rotation speed 400 rpm;

[0159] Full-process control: 1. When the dissolved oxygen < 30%, successively increase the rotation speed to 500 rpm → 600 rpm → air volume 1 L / min → 700 rpm → 800 rpm; 2. Increase the tank pressure by 0.01 Mpa at 8 h of fermentation; increase the tank pressure to 0.02 Mpa → 0.03 Mpa → 0.04 Mpa → 0.05 Mpa at 12 h;

[0160] Residual sugar control: Before 12 h of fermentation, it is 0.1 - 0.5%; after 12 h of fermentation, control the residual sugar at 0.1 - 0.3% in combination with the DO requirement;

[0161] Feed materials: 25% ammonia water, 55% concentrated sugar, 10% antifoaming agent;

[0162] Fermentation cycle: about 30 h. During the control process, the standard for increasing and decreasing the air volume is based on the dissolved oxygen of 20-30%.

[0163] Table 5 L-threonine fermentation data of aglA engineering strains

[0164]

[0165] The results are shown in Table 5. Overexpression of the aglA-5 gene in wild-type Escherichia coli W3110 and L-threonine-producing strain CGMCC25404 both contributed to the increase in L-threonine production.

[0166] Example 4. Application of the aglA-5 gene in the preparation of L-glutamate-producing bacteria

[0167] I. Construction of an engineering strain expressing the aglA-5 gene on a plasmid

[0168] The successfully constructed pXMJ19-aglA-5 plasmid in Example 1 was electrotransformed into wild-type Corynebacterium glutamicum ATCC13869 and Corynebacterium glutamicum CGMCC No. 21220 (L-glutamate-producing bacterium, preservation number: CGMCC No. 21220, preservation date: November 23, 2020, preservation unit: General Microbiology Center of China Microbial Culture Collection Management Committee, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807288) respectively. They were cultured on a culture plate containing chloramphenicol (34 mg / L) for 30 h. The single colonies produced by the culture were identified by PCR with primers MJ19-F / MJ19-R. The positive strain was the one with a PCR amplification product containing a 2014-bp fragment (where the 1st - 141st bases are the upstream sequence of the fragment amplified by the MJ19-F / MJ19-R identification primers, the 142nd - 1962nd bases are the aglA-5 gene with the nucleotide sequence shown in SEQ ID No. 6, and the 1963rd - 2014th bases are the downstream sequence of the fragment amplified by the MJ19-F / MJ19-R identification primers). The strains obtained using wild-type Corynebacterium glutamicum ATCC13869 and L-glutamate-producing bacterium CGMCC No. 21220 as the starting bacteria were named YPG-aglA-1 and YPG-aglA-2 respectively.

[0169] The recombinant bacterium YPG-aglA-1 contains a plasmid with the aglA gene shown in SEQ ID No.6, which can significantly and stably increase the expression level of the aglA gene in the wild-type Corynebacterium glutamicum ATCC13869; the recombinant bacterium YPG-aglA-2 contains a plasmid with the aglA gene shown in SEQ ID No.6, which can significantly and stably increase the expression level of the aglA gene in the glutamate-producing bacterium CGMCC No.21220.

[0170] II. Construction of an engineered strain expressing the aglA-5 gene on the genome

[0171] Based on the genomic sequence of Corynebacterium glutamicum ATCC13869 published by NCBI, 3 pairs of primers for amplifying the upstream and downstream homologous arm fragments, the coding region and the promoter region of the aglA-5 gene were designed and synthesized, and the aglA-5 gene copy was inserted into the glutamate-producing bacterium CGMCC No.21220 and the wild-type Corynebacterium glutamicum ATCC13869 by homologous recombination.

[0172] The primer design is as follows (synthesized by Invitrogen, Shanghai):

[0173] P17: 5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGGACCCGCTTGCCATACGAAG3';

[0174] P18: 5'CGTTTAGGGCACCAGATAGAatctactcatctgaagaatc 3';

[0175] P19: 5'gattcttcagatgagtagatTCTATCTGGTGCCCTAAACG 3';

[0176] P20: 5'caaaccagagtgcccacgaaTTACAGCTGCACTGCTGCTGCTTC3';

[0177] P21: 5'GAAGCAGCAGCAGTGCAGCTGTAAttcgtgggcactctggtttg 3';

[0178] P22: 5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGCATAAGAAACAACCACTTCC 3'.

[0179] Among the above primers, the underlined nucleotide sequences are homologous sequences on pK18, which are used to integrate DNA fragments (upstream homologous arm, promoter - aglA - 5 gene, downstream homologous arm) into the pK18mobsacB plasmid (Addgene) through homologous recombination. The bases shown in lowercase letters on P18 and P19 are used to ligate the upstream homologous arm and the promoter - aglA - 5 gene by homologous recombination, and the lowercase letters on P20 and P21 are used to ligate the promoter - aglA - 5 gene and the downstream homologous arm by homologous recombination.

[0180] Construction method: Using the genome of Corynebacterium glutamicum CGMCC No. 21220 as a template, PCR amplifications were performed with primers P17 / P18 and P21 / P22 respectively to obtain an upstream homologous arm fragment of 750 bp (corresponding to positions 731131 to 731880 of the Corynebacterium glutamicum ATCC13869 genome sequence (genbank accession number CP016335.1), i.e., the BBD29_03485 gene, and its sequence is the homologous arm sequence on P17 / P18 integrated into the genome) and a downstream homologous arm fragment of 731 bp (corresponding to positions 732071 to 732801 of the Corynebacterium glutamicum ATCC13869 genome sequence (genbank accession number CP016335.1), i.e., the BBD29_03490 gene, and its sequence is the homologous arm sequence on P21 / P22 integrated into the genome). Using plasmid pXMJ19-aglA-5 as a template, PCR amplification was performed with primers P19 / P20 to obtain the aglA-5 gene and its promoter fragment (i.e., promoter-aglA-5 gene) of 1901 bp (where positions 1 - 80 are the H36 promoter (80 bp), and positions 81 - 1901 are the aglA-5 gene (SEQ ID No. 6)). After the PCR reaction, the three amplified fragments were electrophoretically recovered respectively using a column DNA gel recovery kit. The three recovered fragments and the pK18mobsacB plasmid (from Addgene) purified after digestion with Xbal I and BamHI were ligated at 50 °C for 30 min using NEBuilder enzyme (from NEB). The monoclonal colonies grown after transformation of the ligation product were identified by PCR with primers M13F (5′-TGTAAAACGACGGCCAGT-3′) / M13R (5′-CAGGAAACAGCTATGACC-3′) to obtain a positive integration plasmid (recombinant vector). The resulting recombinant vector is pK18-aglA(G). This positive integration plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated into the genome can be obtained by screening with kanamycin. The pK18-aglA(G) plasmid is a recombinant expression vector in which the sequence between the Xbal I and BamHI restriction enzyme recognition sites of the pK18mobsacB plasmid is replaced by a DNA fragment while keeping other sequences unchanged. The DNA fragment is composed of the homologous arm sequence on P17 / P18 integrated into the genome (750 bp), the aglA-5 gene and its promoter fragment (1901 bp), and the homologous arm sequence on P21 / P22 integrated into the genome (731 bp) that are homologous recombinated in the 5'-3' direction in the order shown.

[0181] PCR amplification system: 5×HiFi with Mg 2+Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, each primer (10 pM) 1.6 μL, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH 2 O to a total volume of 50 μL.

[0182] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 56°C for 15 s; extension at 72°C for 60 s; 30 cycles), over-extension at 72°C for 5 min.

[0183] The correctly sequenced integration plasmid pK18-aglA(G) was electrotransformed into Corynebacterium glutamicum CGMCC No. 21220 and wild-type Corynebacterium glutamicum ATCC 13869 respectively. The cultures were incubated on culture plates containing chloramphenicol (34 mg / L) for 30 h. The single colonies formed were identified by PCR using primers P23 / P8. Strains that amplified a fragment of 1423 bp (amplification fragment of identification primers P23 and P8) were positive strains, and those that did not amplify a fragment were the original bacteria. The positive strains were streaked on solid culture plates containing 15% sucrose and incubated for 30 h. The single colonies formed were further identified by PCR using primers P9 / P24. Strains that amplified a fragment of 1640 bp (sequence as shown in the amplification fragment of identification primers P9 and P24) were positive strains with the aglA-5 gene and its promoter integrated into the spacer region between the upstream homologous arm BBD29_03485 and the downstream homologous arm BBD29_03490 of the Corynebacterium glutamicum genome. The strains obtained using wild-type Corynebacterium glutamicum ATCC 13869 and glutamate-producing bacterium CGMCC No. 21220 as the starting bacteria were named YPG-aglA-3 and YPG-aglA-4 respectively.

[0184] The recombinant bacteria YPG-aglA-3 and YPG-aglA-4 contain the aglA gene shown in SEQ ID No.6; specifically, the recombinant bacterium YPG-aglA-3 is obtained by replacing the spacer region between the upstream homologous arm BBD29_03485 and the downstream homologous arm BBD29_03490 in the genome of wild-type Corynebacterium glutamicum ATCC13869 with the aglA-5 gene and its promoter (where positions 1-80 are the H36 promoter (80bp), and positions 81-1901 are the aglA-5 gene (the ORF (CDS) sequence of the aglA-3 gene (1740bp))), that is, replacing the nucleotide sequence from positions 731881 to 732070 in the genome sequence of Corynebacterium glutamicum ATCC13869 (genbank accession number CP016335.1) with a DNA molecule formed by connecting the H36 promoter and SEQ ID No.6 in the 5'-3' direction, and keeping the other nucleotides in the genome of Corynebacterium glutamicum ATCC13869 unchanged. The recombinant bacterium YPG-aglA-4 is obtained by replacing the spacer region between the upstream homologous arm BBD29_03485 and the downstream homologous arm BBD29_03490 in the genome of Corynebacterium glutamicum CGMCC No.21220 (corresponding to positions 731881 to 732070 in the genome sequence of Corynebacterium glutamicum ATCC13869) with the aglA-5 gene and its promoter (where positions 1-80 are the H36 promoter (80bp), and positions 81-1901 are the aglA-5 gene (the ORF (CDS) sequence of the aglA-3 gene (1740bp))), and keeping the other nucleotides in the genome of Corynebacterium glutamicum CGMCC No.21220 unchanged. The recombinant bacteria with overexpressed aglA-5 gene in the genome can significantly and stably increase the expression level of the aglA gene.

[0185] The PCR identification primers are as follows:

[0186] P23: 5'GTCCAAGGTGACGGCCGCAC 3' (corresponding to the outside of the upstream homologous arm BBD29_03485),

[0187] P8: 5'GCTACCACCAAAGTAAGAGCC 3' (corresponding to the inside of the aglA gene),

[0188] P9: 5'TTGTGATGGCGTGAAGTG 3' (corresponding to the inside of the aglA gene),

[0189] P24: 5'ATATTCGGCCCAGCAGCAGC 3' (corresponding to the outside of the downstream homologous arm BBD29_03490).

[0190] III. L-Glutamic Acid Fermentation Experiment

[0191] The YPG-aglA-1 and YPG-aglA-2 constructed in Step 1, YPG-aglA-3 and YPG-aglA-4 constructed in Step 2, wild-type Corynebacterium glutamicum ATCC13869, and glutamic acid-producing bacterium CGMCC No. 21220 were subjected to fermentation experiments in a fermenter of model BLBIO-5GC-4-H (purchased from Shanghai Bailun Biotechnology Co., Ltd.) with the following medium and the control process shown in Table 6. Each strain was repeated three times. Fermentation medium formulation (the rest is water): glucose 5.0 g / L, phosphoric acid 0.38 g / L, magnesium sulfate 1.85 g / L, potassium chloride 1.6 g / L, biotin 550 μg / L, vitamin B1 300 μg / L, ferrous sulfate 10 mg / L, manganese sulfate 10 g / dl, KH2PO4 2.8 g / L, vitamin C 0.75 mg / L, vitamin B12 2.5 μg / L, p-aminobenzoic acid 0.75 mg / L, antifoaming agent 0.0015 ml / dl, betaine 1.5 g / L, cane molasses 7 ml / L, corn steep liquor 77 ml / L, aspartic acid 1.7 g / L, hair powder 2 g / L.

[0192] Table 6 Fermentation Control Process

[0193]

[0194] Table 7 L-Glutamic Acid Fermentation Data of aglA Engineered Strains

[0195]

[0196]

[0197] As shown in Table 7, overexpression of the aglA gene in wild-type Corynebacterium glutamicum ATCC13869 and L-glutamic acid-producing bacterium strain CGMCC No. 21220 contributed to the increase in L-glutamic acid production.

[0198] aglA-1 gene ORF (CDS) sequence (1770 bp)

[0199]

[0200] aglA-2 gene ORF (CDS) sequence (1821bp)

[0201]

[0202] aglA-3 gene ORF (CDS) sequence (1740bp)

[0203]

[0204] aglA-4 gene ORF (CDS) sequence (1815bp)

[0205]

[0206] Upstream sequence (141bp) of the amplified fragment of the MJ19-F / MJ19-R identification primer

[0207] GCGGATAACAATTTCACACAGGAAACAGAATTAATTAAGCTTGCATGCCTGCAGGTCGACTTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCC

[0208] Upstream sequence (52p) of the amplified fragment of the MJ19-F / MJ19-R identification primer

[0209] GATCCCCGGGTACCGAGCTCGAATTCAGCTTGGCTGTTTTGGCGGATGAGAG

[0210] Partial coding region of NCgl1740 and NCgl1741 gene and its promoter region (763bp)

[0211] AATGCGTTCTGGACTGAGGTGACCACCATGCAAGACGAGGTGGACCTAGTGATCACCAACCCGCCGTTTTCTCTGTTCCGTGAGTTCCTGAGTTGGCTATTACACGGTGACGTGTTGTTTTCTATCATCGGTAACGCGAACGTAATCACATATCTAGGTGCCTGAATCTAGATTAAAACTATAAACATTATTTAAAACCATTGCCTTATTGGAGCATGCTGCAAGCTTTTCGCGGTGGGCTTGCAACATCTTACATCAGAATGAATGATGTTAAACACCTAATAAGTTCAAGTAGTTAAAAGGAAATATCAACAATGTTACGAAAAGCATCTATCACGCTAATGATATCCGTTACGCTCTTAACATGTGCCTCTCCAGCACAGGCACTGTCATCACAAGCACTCTCGTCAGAAAGCTCCACTTCGCAGAGTGATTCTCCTACGCAATTTGTTGCGAGTATAGCTGCGCCCTTCAATAAGAACTTAACCTATGAGCAGCGCAAAGCCATTCGTTTCGGACCTACGACAGAACAAGAAGCAGAACAATGCTTGGCAAAGTATGGTCGCGATGGCGAGGGGCCATGGCCTGCTATTGCTATCTATCCTGACTGCTCCTTCGATACTATCGAACAAGATTTCTATGATCAAGCAATATCCAAAGCCCTCTCAGTAATCAGTCTGGGAAGCTCCTAGAAGACTCGTAACGACCAAAAGCACCGAGAACAGATGCAACTCAAGCCCATTTACATCTGTTCTCGGTGCAC

[0212] H36 promoter sequence (80bp)

[0213] TCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCC

[0214] Partial coding region of NCgl1742 gene (596bp)

[0215] CAGATGGCGCAATTAAATCAAGATCTCAGAACTCATTTTTCAATCTCTTCTTTTAGGGCACCCGTCATCAATTGAGCTATCGGCCATTCATTAAAAACTGCGCGTCGATCAACCGAAAGCTGAGTAAGCAAAAAATTCGCCTCTTCTCTATCGTCAAGAAGCAAAGCGCAACCAATCATAATCTCGCTATAGTTGTCTGGGTGCATTGTTTGATCAAGATTATGCCTAAAAGATCGAATTTCTGTTCTTTGTGAATCCAGTAATCCAGTTTGGCGATACAAAATTTGCCAACCATTAAGCCTGTAAATTGGCGACTCTTCTCGATCTCGTTCCACGAGCCAATCATTGAGAGCTTGAGCTGCTATAAGAAATGCAGTTTTCCTGCTCTGCTCAGAATCAGCTGCCTTAATTAGGCGAAGCACCATCCATGTGGCGAGATTATCAACATCAACAGTTTCTTCAAGCGCTGAATAGAAATCAACAAGCTTATCCAAATGCAGATTCAATACTGATGGAAGCCATCGATTATCAATGAGCTCGTACGGCGTCACTCGCTCGATTGAGGAGTCGCTCCGATCCGTTGAAGGTGTCATAGC

[0216] Amplified fragment (1488bp) of identification primers P7 and P8

[0217]

[0218] Amplified fragment of identification primers P9 and P10 (size 1537bp)

[0219]

[0220] P11 / P12 amplified upper homologous arm fragment (size 570bp)

[0221] AAGAGAATGGAAGAGAGGCCAGGACATCTTTTTAATAGAAACAGCAATAATTTTATATTCACTGAAAATATTTTTAATCTTTATTTATAGCTGTTGGTTATTATTTTTTGGAGTTTGGTTGCGCTGCTATAAATTGAATAATTAAAACTTTGTTGCATATTCATAGGATATTTATCTGGTTTGTGTTTGTGATATTTATTATGCGTATGCTTCAAAAACAAAATTATCTGCAACATGTTGAAATACTGTGCTTTTATGAATTTGATGCGTGTTTTTCTCCATAAATTATATATGTCCACATTCGGACTTAGGGGAAAGAATAATTGAACCATTCGTCTGTAACGCAGCATAATCGTTAGCGCGAAACATAATATGTTTTCTATGCATTGATAATTGATGGATCAACTTATTACGTCCCTGAGGAGGGATGACAAATGCACTCCTGGAAAAAGAAACTTGTAGTATCACAATTAGCATTGGCTTGCACTCTGGCTATCACCTCTCAGGCTAATGCAGCAAACTATGATACCTGGACTTATATCGATAATCCCGTTACAGCACTTGATTGGG

[0222] P15 / P16 amplified lower homologous arm fragment (size 585bp)

[0223] CAACGAAACCTACACTACCGAATCTCATACTTGGGATAACAATATCTCTGTAAAAGATTCCACAGTGACTTCGGGTTCAAATTATATCCTGGATAGCAATACTTATGGCAAAACTGGTCACTTTGGCAATTCTGATGAACCGAGTGATTATGCTGGCCCGGGTGATGTTGCAATGTCCTTTACTGCTTCAGGTTCCGACTATGCGATGAAGAACAATGTATTCCTCAGCAATTCAACGCTGATGGGTGATGTTGCCTTTACCAGCACCTGGAATAGTAATTTTGATCCGAATGGTCATGATTCCAACGGTGACGGGGTGAAAGATACCAACGGGGGTTGGACTGATGATAGCCTCAACGTTGATGAACTAAATCTCACTCTCGATAACGGAAGCAAGTGGGTTGGTCAGGCAATTTATAACGTTGCTGAAACGTCAGCAATGTATGATGTTGCTACAAACAGCCTTACTCCTGATGCAACATATGAAAACAATGACTGGAAACGTGTTGTTGATGACAAGGTCTTCCAGAGCGGTGTATTTAACGTAGCGTTGAATAACGGTTCTGAATGGGATACTACAGGTCG

[0224] Identification primer pRedCas9-F / pRedCas9-R PCR amplification sequence (943bp)

[0225] GCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGGGGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATGAGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATCGAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGCGGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAAACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGCGAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGTTATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGTATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAACATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAGGATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCTGGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGCAAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTATCAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCCTCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGG

[0226] Homologous arm sequence (750bp) on genomically integrated P17 / P18

[0227] GACCCGCTTGCCATACGAAGTCCTGGAGAAGATCTCCACCCGCATCACCAACGAAGTTCCAGACGTAAACCGCGTGGTTTTGGACGTAACCTCCAAGCCACCAGGAACCATCGAATGGGAGTAGGCCTTAAATGAGCCTTCGTTAAGCGGCAATCACCTTATCGGTGATTGCCGCTTTCCCATTTCTCCGGGTTTTCTGGAACTTTTTGGGCGTATGCTGGGAATGATCTTATTATTTTGATTTCAGAAAGCAGGAGAGACCAGATGAGCGAAATCCTTGAAACCTACTGGGCACCCCACTTCGGAAACACCGATGAAGCCGCAGCACTCGTTTCATACTTGGCACAAGCTTCCGGTGATCCTATTGAGGTTCACACCCTGTTCGGGGATTTAGGTTTAGACGGACTCTCTGGAAACTACACCGACACTGAGATCGACGGCTACGGCGACGCATTCCTGCTGGTTGCAGCACTAGCAGTGTTGATGGCTGAAAACAAAGCATCCGGCGGCGTGAATCTGGGTGAAGTTGGGGGAGCTGATAAATCGATCCGGCTGCATGTTGAATCCAAGGAAAACACCCAGATCAACACCGCATTGAAGTACTTTGCGCTTTCCCCAGAAGACCACGCAGCGGCAGATCGCTTCGATGAGGATGACCTGTCTGAGCTTGCCAACTTGAGTGAAGAGCTGCGCGGACAGCTGGACTAATTGCTGCCCGTTTAAGGAGTCCGATTCTTCAGATGAGTAGAT

[0228] Genomic integration P21 / P22 downstream homologous arm sequence (731bp)

[0229] TTCGTGGGCACTCTGGTTTGGTTACCAGGATGGGTTAGTCATTCTGATCAGCGAATTCCACGTTCACATCGCCAATTCCAGAGTTCACAACCAGATTCAGCATTGGACCTTCTAGATCAGCATTGTGGGCGGTGAGATCTCCAACATCACAGCGCGCTGTGCCCACACCGGCGGTACAACTTAGGCTCACGGGCACATCATCGGGCAGGGTGACCATGACTTCGCCGATCCCTGAGGTGATTTGGATGTTTTGTTCCTGATCCAATTGGGTGAGGTGGCTGAAATCGAGGTTCATTTCACCCACGCCAGAGGTGTAGCTGCTGAGGAGTTCATCGTTGGTGGGGATGAGATTGACATCGCCGATTCCAGGGTCGTCTTCAAAGTAGATGGGATCGATATTTGAAATAAACAGGCCTGCGAGGGCGCTCATGACAACTCCGGTACCAACTACACCGCCGACAATCCATGGCCACACATGGCGCTTTTTCTGAGGCTTTTGTGGAGGGACTTGTACATCCCAGGTGTTGTATTGGTTTTGGGCAAGTGGATCCCAATGAGGCGCTTCGGGGGTTTGTTGCGCGAAGGGTGCATAGTAGCCCTCAACGGGGGTGATAGTGCTTAGATCTGGTTGGGGTTGTGGGTAGAGATCTTCGTTTTTCATGGTGGCATCCTCAGAAACAGTGAATTCAGTGGTGAGTAGTCCGCGGGGTGGAAGTGGTTGTTTCTTATGC

[0230] Identification primers P23 and P8 amplified fragment (size 1423bp)

[0231]

[0232] Amplified fragments of identification primers P9 and P24 (size 1640bp)

[0233]

[0234] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made with conventional techniques known in the art.

Claims

1. Application Characterized in that The application includes any of the following: U1) Application of α-glucosidase in the preparation of L-amino acids; U2) Application of a substance that regulates the activity of the α-glucosidase in the preparation of L-amino acids; U3) Application of a substance that regulates the content of the α-glucosidase in the preparation of L-amino acids.

2. The application according to claim 1 Characterized in that The α-glucosidase is any of the following: A1) A protein with an amino acid sequence of SEQ ID No. 5; A2) A protein derived from A1) or having more than 45% identity with the protein shown in A1) that has the same function and is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No. 5; A3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2); Specifically, the L-amino acids include polar neutral amino acids, acidic amino acids, basic amino acids, and / or non-polar hydrophobic amino acids; Specifically, the basic amino acids include lysine, arginine, and / or histidine, or the polar neutral amino acids include tryptophan, tyrosine, serine, threonine, cysteine, methionine, glutamine, or asparagine, or the acidic amino acids include glutamic acid or aspartic acid.

3. The application according to claim 2 Characterized in that A2) The protein contains a protein with an amino acid sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, or SEQ ID No.

4.

4. Protein Characterized in that The protein includes any of the following: A1) A protein with an amino acid sequence of SEQ ID No. 5; A2) A protein derived from A1) or having more than 45% identity with the protein shown in A1) that has the same function and is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No. 5; A3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

5. The protein according to claim 4 Characterized in that A2) The protein contains a protein with an amino acid sequence of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, or SEQ ID No.

4.

6. Biomaterial Characterized in that It is a biomaterial related to the protein according to claim 4 or 5, and the biomaterial is any of the following: B1) A nucleic acid molecule encoding the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); A whole-cell catalyst containing the nucleic acid molecule described in B1), or a whole-cell catalyst containing the expression cassette described in B2), or a whole-cell catalyst containing the recombinant vector described in B3), or a whole-cell catalyst containing the recombinant microorganism described in B4).

7. The biological material according to claim 6, wherein, B1) The nucleic acid molecule comprises any one of the following: C1) A cDNA molecule or DNA molecule whose coding sequence comprises SEQ ID No. 6; C2) A cDNA molecule or DNA molecule whose coding sequence comprises a coding gene with an amino acid sequence of SEQ ID No. 1; C3) A cDNA molecule or DNA molecule whose coding sequence comprises a coding gene with an amino acid sequence of SEQ ID No. 3; C4) A cDNA molecule or DNA molecule whose coding sequence comprises a coding gene with an amino acid sequence of SEQ ID No. 4; C5) A cDNA molecule or DNA molecule whose coding sequence comprises a coding gene with an amino acid sequence of SEQ ID No. 5; C6) A cDNA molecule or DNA molecule that hybridizes with the cDNA or DNA molecule defined in C1) or C2) or C3) or C4) or C5) and encodes a protein with the same function.

8. A method for producing an L-amino acid, wherein, it comprises fermenting to prepare the L-amino acid by using the protein according to claim 4 or 5 or the biological material according to claim 6 or 7.

9. The method according to claim 8, wherein, the L-amino acid comprises L-glutamic acid, L-lysine or L-threonine.

10. Use of the protein according to claim 4 or 5 or the biological material according to claim 6 or 7 in the preparation of a food, feed, medicine, fertilizer or / and daily chemical product containing an L-amino acid.

Images