Use of voclosporin in the manufacture of a formulation for inhibiting influenza virus
By combining pharmaceutical salts or prodrugs of vorselotto and epalrestat, a pharmaceutical composition for inhibiting influenza virus was prepared, which solved the problems of limitations in the application of influenza virus vaccines and drug resistance, and achieved effective inhibition of influenza virus and improvement of health status.
Patent Information
- Application Number
- CN202510351285.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-24
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2045-03-24
AI Technical Summary
The limitations of existing influenza virus vaccines and the rapid emergence of drug resistance have increased the difficulty of controlling human influenza viruses, and there is a lack of effective new small molecule inhibitors for influenza viruses.
Pharmaceutical compositions for inhibiting influenza viruses are prepared by using pharmaceutical salts or prodrugs of vorselotto and epalrestat in specific molar ratios. These compositions are then combined with excipients to prepare products for improving health conditions, including the prevention and treatment of influenza and the inhibition of influenza virus proliferation, reducing lung damage caused by influenza virus, and inhibiting the damage of influenza virus RNA-dependent RNA polymerase and neuraminidase.
It significantly inhibits the proliferation of influenza virus, reduces viral damage to the lungs, and reduces harm to the body by inhibiting RNA polymerase and neuraminidase, providing an effective means of influenza virus prevention and control.
Smart Images

Figure CN120131649B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical science and relates to the use of vocerotropin in the preparation of formulations that inhibit influenza viruses. Background Technology
[0002] Influenza virus is a representative virus of the Orthomyxoviridae family, divided into four genera: A, B, C, and D. Types A, B, and C can all infect humans. According to WHO statistics, an estimated 5% to 10% of adults and 20% to 30% of children contract influenza each year, resulting in 3 to 5 million severe cases and approximately 1 million deaths globally.
[0003] Influenza A virus (IAV) is a respiratory pathogen of great economic and public health significance due to its high rates of severe illness and mortality. Its viral genome consists of eight segmented single-stranded negative-sense RNAs encoding ten essential proteins, including PB2, PB1, PA, HA, NP, NA, M1, M2, NS1, NEP / NS2, and various non-essential accessory proteins such as PB1-F2 and PA-X. Seasonal influenza A viruses typically exist in two subtypes, H1N1 and H3N2, causing recurring epidemics of varying severity for decades. In the United States, influenza causes more than 200,000 hospitalizations annually and 3,000 to 49,000 deaths annually during the off-season. Frequent antigenic drift and antigenic shifts allow novel strains from other species to cause human influenza pandemics, such as the 2009 H1N1 swine flu and H5N1 avian influenza. Because humans have virtually no immunity to these viruses, they can spread rapidly worldwide, posing a significant threat to global health.
[0004] Influenza viruses are one of the major threats to global public health security. Vaccines have achieved good results in the prevention and control of influenza in animals, but the prevention and control of influenza in humans has not been very effective due to problems such as low vaccination rates, rapid virus mutation rates, and inconsistent vaccine protection.
[0005] Drugs are another important tool for controlling human influenza. Currently, drugs used clinically to treat influenza virus infections can be divided into first-generation M2 ion channel inhibitors, second-generation neuraminidase inhibitors (NAIs), and third-generation cap-dependent endonuclease inhibitors. As an RNA virus with a high mutation rate, influenza viruses have rapidly evolved into various drug-resistant strains under intense drug selection since the advent of first-generation anti-influenza drugs over the past fifty years. Among circulating strains, those resistant to existing drugs already account for a considerable proportion. Given the limitations of human influenza virus vaccines and the rapid emergence of drug resistance, the necessity of screening novel small-molecule inhibitors of influenza viruses is increasingly prominent.
[0006] Triptonide, also known as PG 492, NSC 165677, CAS number 38647-11-9, is commonly used as a Wnt signaling inhibitor. Its molecular structure is as follows:
[0007]
[0008] Brequinar, also known as Bipenquinate, NSC 368390, DUP785, CAS number 96187-53-0, is a potent inhibitor of dihydroorotate dehydrogenase and exhibits strong activity against a broad spectrum of viruses. Its molecular structure is as follows:
[0009]
[0010] Voxelotor, also known as GBT 440, is a sickle hemoglobin (HbS) polymerization inhibitor. Its molecular structure is as follows:
[0011]
[0012] Mizoribine, also known as Bredinin (NSC 289637, HE 69), is a commonly used immunosuppressant. Its molecular structure is as follows:
[0013]
[0014] Epalrestat, also known as ONO2235, is a conventionally used aldose reductase inhibitor. It is effective in improving symptoms of diabetic neuropathy and slowing disease progression. Its molecular structure is as follows:
[0015]
[0016] There are no reports of the aforementioned drugs being used to treat influenza. Summary of the Invention
[0017] To address the problems existing in the prior art, the first aspect of the present invention provides a pharmaceutical composition, wherein the pharmaceutical active ingredients of the pharmaceutical composition include active substance a and active substance b;
[0018] The active substance a is vocerol, a pharmaceutical salt of vocerol, and any one, any combination of two or three of the prodrugs of vocerol.
[0019] The active substance b is epalrestat, any one of the pharmaceutical salts of epalrestat and any combination of two or three of the prodrugs of epalrestat.
[0020] The structural formula of the Vucelot is:
[0021] ;
[0022] The structural formula of epalostat is:
[0023] .
[0024] In some embodiments, the molar ratio of active substance a to active substance b is 1:0.04-4 (e.g., any ratio or range between any two ratios of 1:0.04, 0.05, 0.06, 0.07, 0.80, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4).
[0025] In some embodiments, the molar ratio of active substance a to active substance b is 1:0.3-0.5.
[0026] In some embodiments, the pharmaceutical salts of vocerotrope are selected from hydrochloride, sulfate, citrate, benzenesulfonate, hydrobromide, hydrofluoric acid, phosphate, acetate, propionate, succinate, oxalate, malate, succinate, fumarate, maleate, tartrate, trifluoroacetate, aspartate, taurine, gluconate, fructose, salicylate, nitrate, p-toluenesulfonate, methanesulfonate, benzoate, citrate, lactate, citric acid, fumarate, and ascorbate.
[0027] The medicinal salts of epalrestat are selected from aluminum, zinc, amine, ammonium, sodium, calcium, potassium, magnesium, silver, and lithium salts of epalrestat.
[0028] In some embodiments, the composition also contains excipients.
[0029] A second aspect of the present invention provides the use of a biomaterial in the preparation of a product for use alone or in combination with other formulations to improve health conditions;
[0030] The biomaterial is the pharmaceutical composition or active substance a described in the first aspect of this invention;
[0031] The active substance a is vocerol, a pharmaceutical salt of vocerol, and any one, any combination of two or three of the prodrugs of vocerol.
[0032] The active substance b is epalrestat, any one of the pharmaceutical salts of epalrestat and any combination of two or three of the prodrugs of epalrestat.
[0033] The structural formula of the Vucelot is:
[0034] ;
[0035] The intended use is selected from any one or a combination of the following U1, U2, U3 and U4;
[0036] U1: The improvement of health status refers to preventing influenza, treating influenza, slowing down influenza, or inhibiting the proliferation of influenza virus;
[0037] U2: The improvement in health status refers to reducing the damage of the influenza virus to the lungs;
[0038] U3: The improvement in health status is achieved by reducing the damage of influenza virus to the body by inhibiting influenza virus RNA-dependent RNA polymerase;
[0039] U4: The improvement in health status is achieved by inhibiting influenza virus neuraminidase to reduce the damage of influenza virus to the body.
[0040] In some embodiments, the product is selected from pharmaceuticals.
[0041] In some embodiments, the influenza virus is an influenza A virus, and the influenza is influenza A.
[0042] In some embodiments, the influenza virus is an H1N1 influenza virus, and the influenza is influenza caused by an H1N1 influenza virus.
[0043] In some implementations, the influenza is selected from human influenza, avian influenza, and swine influenza. Attached Figure Description
[0044] Figure 1 The results show the relationship between MOI inoculation, drug concentration, and OD. 450 Statistical analysis of the relationships between them.
[0045] Figure 2 The statistics of viral infection titers under five drug interventions are shown.
[0046] Figure 3 Five drugs CC were shown. 50 The fitted curve.
[0047] Figure 4 Five drugs EC were shown. 50 The fitted curve.
[0048] Figure 5 The results of viral challenge protection experiments under three drug interventions are shown.
[0049] Figure 6 The effects of four drugs on the polymerase activity of influenza A virus are shown.
[0050] Figure 7 The results show the effect of epastrastat on the neuraminidase activity of influenza virus.
[0051] Figure 8 The results of hydrogen bond analysis using the molecular docking model are shown.
[0052] Figure 9 The results of molecular docking of epalrestat with influenza virus neuraminidase N1 are shown.
[0053] Figure 10 The results show the effects of five drugs on the inhibition of viral protein expression.
[0054] Figure 11 The effect of siRNA interfering with drug target genes on influenza virus replication is shown.
[0055] Figure 12 The data shows the viral load statistics under the intervention of five drug combinations. Detailed Implementation
[0056] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.
[0057] Example 1: Protective Experiment Against Influenza Virus Infection
[0058] I. Establishment of Positive Control Method
[0059] A method for indirectly screening anti-influenza virus small molecule compounds using CCK-8 cell viability was established using oseltamivir phosphate (purchased from MCE, the same below) as a positive control drug.
[0060] First, fill each well of a clear 96-well cell culture plate with 100 μL of PBS around the perimeter to prevent edge effects. Then, inoculate MDCK cells at a rate of 1 × 10⁶ cells / well. 4 Cells were seeded at a density of 100 μL per well in DMEM medium (purchased from Sigma-Aldrich) containing 10 v / v % fetal bovine serum (purchased from WISENT). Cells were cultured at 37°C and 5% CO2 until the cell density reached 90%, at which point viral infection was performed.
[0061] Discard the culture medium in the wells using a multichannel pipette. Wash the cells twice with PBS to remove residual serum and prevent it from affecting viral infection. After rinsing once with Opti-MEM medium (purchased from Gibco) supplemented with TPCK trypsin (final concentration 0.5 μg / mL), infect the cells with influenza virus WSN strain (H1N1) (NCBI Taxonomy ID: 382835) at MOI 0, MOI 0.01, MOI 0.1, MOI 1, MOI 5, and MOI 10, respectively. Add 100 μL of Opti-MEM medium containing 0.5 μg / mL TPCK trypsin to each well. Allow the virus to adsorb at 37°C and 5% CO2 for one hour, then discard the virus solution. Then, Opti-MEM medium (containing 0.1 v / v% DMSO and 0.5 μg / mL TPCK trypsin) with concentrations of 400 μg / mL, 200 μg / mL, 100 μg / mL, 50 μg / mL and 25 μg / mL oseltamivir phosphate were added to the wells with different MOIs. Opti-MEM medium (containing 0.5 μg / mL TPCK trypsin) with 0.1 v / v% DMSO was used as a negative control. After culturing at 37℃ and 5% CO2 for 24 h, the cell viability in each well was detected.
[0062] Discard the liquid in the well plate and replace it with 100 μL / well DMEM medium. Then add 10 μL of CCK-8 solution (from Cell Counting Kit-8, purchased from MCE) to each well. Incubate at 37°C and 5% CO2 for 1 h, then immediately place on ice and use a microplate reader to detect the OD of each well. 450 Each combination of MOI and each concentration of oseltamivir was repeated in 3 wells. The absorbance of each well was measured 3 times and the average value was taken. The data were analyzed using GraphPad Prism 8.0.2.
[0063] CCK-8 test results are as follows Figure 1 As shown, different concentrations of oseltamivir exhibit a good gradient of cell activity at the same MOI infection level. Cell activity increases with increasing oseltamivir concentration, indicating improved viral inhibition. Simultaneously, a clear gradient of cell activity also exists among different MOI infection groups at the same drug concentration. Cell viability decreases significantly with increasing MOI. Under the same drug inhibitory capacity, higher viral loads result in lower cell viability, demonstrating the good sensitivity of this method. This method can use OD values to reflect the drug's viral inhibitory capacity.
[0064] II. Initial Screening, Secondary Screening, and Data Analysis
[0065] Based on the experimental results in Section 1, an MOI of 0.01 was selected for screening experiments. Cell plating and virus infection methods were the same as in Section 1. After virus infection, the cells were replaced with 2697 compounds from the FDA-approved drug library (the test compounds, small molecule library FDA L1300-Z417864, purchased from Selleck) at a final concentration of 30 μM. Opti-MEM medium (containing 0.5 μg / mL TPCK trypsin) containing 0.1 v / v% DMSO was used as the solvent. Each compound was tested in triplicate. Oseltamivir was used as a positive control, 0.1 v / v% DMSO aqueous solution as a negative control, and uninfected cells served as a blank control group. Other steps and parameters were performed in parallel. After culturing at 37℃ and 5% CO2 for 24 h, cell viability was assessed using the method in Section 1. The absorbance of each well was measured three times and the average value was taken. Compared with the control group, 67 compounds with known strong viral activity (larger OD values) in each plate showed protective effects on cells after viral infection. The same method was then used to re-screen the aforementioned 67 compounds, and 26 of them showed strong cytoprotective activity.
[0066] Example 2: Virus titer determination experiment
[0067] I. Identification of the antiviral ability of compounds
[0068] A549 cells were fed at a rate of 1×10 5Cells were seeded at a density of 1 mL per well in 12-well cell culture plates. The culture medium was F12K medium (purchased from Multicell, hereinafter the same) containing 10 v / v % fetal bovine serum, 1 mL per well. The cells were cultured at 37°C and 5% CO2. After the cell density in the well plate reached 90%, the cells were infected with WSN (H1N1) virus with an MOI of 0.01. One hour after virus adsorption, the cells were washed with PBS and each well was replaced with 1 mL of Opti-MEM medium (containing 0.125 μg / mL TPCK trypsin and 0.1 v / v % DMSO) containing 30 μM of the test compound (19 of the 26 compounds obtained in Example 1). A 0.1 v / v % DMSO aqueous solution was set as a negative control. After 24 h, 50 μL of culture supernatant was collected in a 1.5 mL EP tube and stored at -80°C for later use. Then, plaque titration experiments were performed.
[0069] II. Spot Titration Experiment
[0070] MDCK cells were seeded into 12-well cell culture plates in 1×DMEM medium containing 0.5 μg / mL TPCK trypsin. After the cells reached confluence, they were washed twice with PBS to remove residual culture medium and serum. The cells were then rinsed once with 1×DMEM medium containing 0.5 μg / mL TPCK trypsin for later use.
[0071] In Section 1, the culture supernatant from each well was thawed on ice and serially diluted 2-fold with 1×DMEM medium containing 0.5 μg / mL TPCK trypsin. 100 μL of virus solution was added to each well to allow adsorption, and the plate was incubated at 37°C and 5% CO2, with the plate shaken evenly every 10 min to ensure uniform viral coverage. Low-melting-point agarose was dissolved in ddH2O to prepare a 2 w / w agarose solution, which was then heated to dissolve and incubated in a 50°C water bath. Simultaneously, an equal volume of 2×DMEM medium was incubated in a 37°C water bath. An equal volume of the 2 w / w agarose solution and 2×DMEM medium was mixed to prepare a 1×DMEM 1% agarose solution. After viral infection, the virus solution was aspirated from the wells, and 1 mL of 1×DMEM 1w / w agarose solution was added to each well. The plate was placed in a biosafety cabinet for 20 min to allow the agarose to solidify, then inverted and placed in a cell culture incubator. After incubation at 37℃ and 5% CO2 for 48 h, 1 mL of formalin fixative was added to each well. After fixation overnight, the fixative and agarose were discarded, and the number of plaques was counted and the virus titer was calculated. Titer refers to the number of biologically active virus particles per unit volume of liquid. The titer is quantitatively expressed as the highest serial dilution of 2-fold that allows the appearance of plaques, in units of Log2pfu / mL.
[0072] Compared with the DMSO control, five compounds showed a significant decrease in titer. These five compounds were triptolide (code: T18-9), buquina (code: B18-5), vocerotropin (code: V15-24), imidazolidinedione (code: M9-26), and epalrestat (code: E16-1). These five compounds reduced viral titers by 99.99% (P < 0.001), 99.22% (P < 0.001), 99.84% (P < 0.001), 79.25% (P < 0.01), and 95.00% (P < 0.001), respectively. See the titer statistics chart. Figure 2 .
[0073] Example 3: Half-maximal toxic concentration (CC) of compound 50 Measurement
[0074] To prevent edge effects, fill each well of a clear 96-well cell culture plate with 100 μL of PBS around the perimeter. Then, inoculate A549 cells at a rate of 1 × 10⁻⁶ cells / well. 4 Cells were seeded at a density of 100 μL per well in Opti-MEM medium and cultured at 37°C with 5% CO2. Once the cell density reached 90%, the medium was discarded. The test compounds triptolide, buquina, vorselotor, imidazolidinedin, and epalrestat were dissolved in Opti-MEM medium at gradient concentrations of 0.1 μM, 1 μM, 10 μM, 100 μM, 500 μM, 1000 μM, 5000 μM, and 10000 μM, respectively. Each concentration was added to different wells at a rate of 100 μL per well, with each concentration repeated in triplicate. Cell viability was then assessed after 24 h of culture at 37°C with 5% CO2. Replace 100 μL of DMEM medium containing 10 v / v% fetal bovine serum in each well, then add 10 μL of LCK-8 solution to each well. Incubate at 37°C and 5% CO2 for 1 h, then immediately place on ice and use a microplate reader to detect the OD of each well. 450 Absorbance was measured three times per well and the average value was taken. Wells containing 0.1 v / v % DMSO aqueous solution served as negative controls, with their absorbance set to 100%. Cell viability was calculated for different concentration experimental groups. Data were analyzed using GraphPad Prism 8.0.2, and the CCC of the compounds was calculated using nonlinear regression and Nonlin fitting. 50 .
[0075] See the results of the fitted curve. Figure 3 Tripterygium wilfordii lactone, buquina, vocerotropin, mizoribine, and epalrestat are all C-cell inhibitors. 50 The values were 1.304 mM, 558.4 μM, 344.2 μM, >10 mM, and 310.4 μM, respectively.
[0076] Example 4: Compound half-maximal effective concentration (EC50) 50 Measurement
[0077] A549 cells were fed at a rate of 1×10 4 Cells were seeded at a density of 500 μL per well in F12K medium containing 10 v / v % fetal bovine serum. After reaching 90% confluence, cells were infected with influenza A virus (WSN) at an MOI of 0.01 and cultured at 37°C and 5% CO2 for one hour to allow virus adsorption. The medium was then replaced with 500 μL per well in Opti-MEM medium (containing 0.125 μg / mL TPCK trypsin and 0.1 v / v % DMSO) containing different concentrations of the test compounds (triptolide, buquina, vorselotto, imidazolidinedin, and epalrestat). A gradient concentration of 0.01 μM, 0.1 μM, 1 μM, and 10 μM was established for each compound, with a 0.1 v / v % DMSO aqueous solution as a negative control. After culturing at 37°C and 5% CO2 for 24 hours, the supernatant was discarded from each well, and total RNA was extracted from the cells in each well.
[0078] After determining the RNA concentration, the procedure was performed according to the instructions of the HiscriptR RII Q RT SuperMix for qPCR reverse transcription kit (Vazyme, R223-01). Genomic DNA was removed from the total RNA in each well. Using 1 μg of RNA as a template, and with 5 Seg_vRNA-RT (SEQ ID NO.1) in Table 1 as a primer, the mRNA was reverse transcribed into cDNA.
[0079] Based on the reference gene sequence of WSN strains in NCBI, real-time PCR primers were designed using Primer Premier 5. The forward and reverse primers are shown in Table 1 as 5 Seg_NP qPCR-F (SEQ ID NO.2) and 5 Seg_NP qPCR-R (SEQ ID NO.3). Each reaction used 5 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 1 μL of cDNA template, 0.4 μL each of forward and reverse primers, and 3.2 μL of ddH2O. Each reaction was repeated three times. The real-time PCR reaction program was: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s; 60℃ annealing for 1 min, for a total of 40 cycles. Melting curve: 95℃, 15 s; 60℃, 1 min; 95℃, 10 s. The hGAPDH gene was used as an internal control, and the primers for the internal control gene are shown in Table 1 as qPCR-hGAPDH-F (SEQ ID NO. 4) and qPCR-hGAPDH-R (SEQ ID NO. 5). A 0.1 v / v% DMSO aqueous solution was used as a negative control. The viral RNA content of the viral NP segment was calculated using the formula 2^-{ΔΔCt=[Ct(EG_vNP)-Ct(EG_hGAPDH)]-Ct(DMSO_vNP)-Ct(DMSO_hGAPDH)}. Data were analyzed using GraphPad Prism 8.0.2, and the EC50 of the compounds was calculated using nonlinear regression and Nonlin fitting. 50 .
[0080] See the results of the fitted curve. Figure 4 EC of triptolide, buquina, vocerotropin, mizoribine, and epalrestat 50 The values were 0.6564 μM, 0.1323 μM, 2.213 μM, 5.003 μM and 0.8847 μM, respectively.
[0081] Table 1. Primer sequences
[0082] Primers Sequence (5'→3') 5 Seg_NP qPCR-F AGCATTGTTCCAACTCCTTT 5 Seg_NP qPCR-R GACGATGCAACGGCTGGTCTG 5 Seg_vRNA-RT GACGATGCAACGGCTGGTCTG qPCR-hGAPDH-F GGAGCGAGATCCCTCCAAAAT qPCR-hGAPDH-R GGCTGTTGTCATACTTCTCATGG
[0083] Example 5: Organ plaque titration
[0084] Mice were divided into four groups: vorselotor, imidazolidin, epalrestat, and 5% DMSO, with eight mice in each group. After weighing, mice were anesthetized with isoflurane inhalation at a dose of 1.5 × 10⁻⁶ mg / mL. 4The influenza A virus WSN of PFU was administered via nasal inhalation. The three drugs were anesthetized and administered via nasal inhalation daily. The dosages of the three drugs were 1.52 mg / kg body weight, 3 mg / kg body weight, and 0.24 mg / kg body weight, respectively. The control group was given 5 v / v % DMSO aqueous solution at a dose of 25 μL per animal.
[0085] On day 3 post-infection, three mice from each group were euthanized by cervical dislocation after isoflurane inhalation anesthesia. Intact lung tissue was collected in 2 mL EP tubes and cryopreserved at -80°C. After thawing, 1 mL of PBS buffer containing 1% penicillin and streptomycin was added to each tube, along with a grinding ball. The tubes were ground at 4°C and 30 Hz for 5 min. Then, the tubes were centrifuged at 9000 r / min and 4°C for 5 min. The supernatant was then used for plaque titration as described in Example 2.
[0086] See results Figure 5 Compared with the control group, the viral titers in the lungs of vorselotto, imidazolidin and epalrestat decreased by 71.74% (P<0.01), 76.74% (P<0.001) and 84.13% (P<0.001), respectively.
[0087] Example 6: Assay of Influenza Virus Polymerase Activity
[0088] I. Synthesis and Sources of Plasmids
[0089] (1) Renalis luciferase control reporter gene vector pRL-TK
[0090] The pRL series vectors are Renin luciferase reporter vectors developed by Promega (catalog number: E2241), with the TK promoter driving Renin luciferase.
[0091] (2) RNA polymerase component plasmid
[0092] Using the pCAGGS plasmid as a backbone, the coding sequences of the alkaline polymerase 1 (PB1) gene (see GenBank No. LC333183.1), alkaline polymerase 2 (PB2) gene (see GenBank No. LC333182.1), PA protein gene (see GenBank No. LC333184.1), and nucleoprotein (NP) gene (see GenBank No. LC333186.1) of the influenza virus WSN strain (full name A / WSN / 1933 strain, H1N1 type) were respectively transformed into the gene expression cassette of the pCAGGS plasmid to form recombinant plasmids that can express PB1, PB2, PA protein, and NP of the influenza virus WSN strain, named pCAGGS-WSNPB1, pCAGGS-WSN PB2, pCAGGS-WSN PA, and pCAGGS-WSN NP, respectively.
[0093] (3) Firefly luciferase reporter gene vector pHH21-SC09NS F-Luc
[0094] A firefly luciferase reporter gene vector, pHH21-SC09NS F-Luc, was constructed to generate a negative sense RNA containing 176 bases at the 3' end of the NS vRNA derived from influenza virus strain SC09 (full name A / Sichuan / 1 / 2009 strain, H1N1 type), firefly luciferase, a stop codon (TAA), and 179 bases at the 5' end of the SC09NS vRNA. The influenza virus polymerase can recognize and bind to the non-coding sequence at the end of the NS vRNA on this vector, initiating the expression of firefly luciferase.
[0095] The methods for constructing plasmid vectors in (2) and (3) above can be found in the following literature:
[0096] Luo W, Zhang J, Liang L, et al., 2018. Phospholipid scramblase 1interacts with influenza A virus NP, impairing its nuclear import and therebysuppressing virus replication. PLoS pathogens, 14(1): e1006851.
[0097] II. Principle of Enzyme Activity Assay
[0098] Influenza virus RNA polymerase is composed of three subunits: PB2, PB1, and PA. It is an RNA-dependent RNA polymerase that works together with NP protein to perform an important function in viral genome transcription. To investigate the effect of drugs on influenza virus polymerase activity, a dual-luciferase reporter assay was used.
[0099] Dual-Luciferase reporter system ® In the Reporter System (purchased from Promega, catalog number: E1960), firefly luciferase serves as the reporter gene for gene expression, while Renilla luciferase serves as the internal control gene. 1. The target gene transcriptional regulator is constructed into an expression vector containing luciferase, creating a reporter gene plasmid. This sequence regulates the transcriptional expression of luciferase. 2. The reporter gene plasmid is transfected into cells, and after different treatments, the cells are lysed and the substrate luciferin is added. Luciferase catalyzes luciferin to emit fluorescence. 3. The fluorescence values obtained can be used to determine the effect of different treatments on the transcriptional regulator. 4. To avoid errors caused by differences in transfection efficiency, a Renilla luciferase reporter gene plasmid is usually used as an internal control to correct for transfection efficiency between different samples.
[0100] The expression of Renal luciferase is constitutive and can be used as a control. It is minimally affected by influenza virus inhibitors. The expression of firefly luciferase is affected by the content or activity of RNA polymerase, and thus by influenza virus inhibitory drugs. The ratio of fluorescence produced by the two luciferases can be used to quantitatively or semi-quantitatively determine the inhibitory effect of drugs on influenza virus RNA polymerase.
[0101] Four WSN (A / WSN / 33 (WSN, H1N1)) polymerase expression plasmids (pCAGGS-PA, pCAGGS-PB1, pCAGGS-PB2, pCAGGS-NP) were constructed to express and form influenza virus RNA polymerase complexes in cells.
[0102] Four polymerase expression plasmids, the firefly luciferase reporter gene vector pHH21-SC09NS F-Luc, and the Renal luciferase control reporter gene vector pRL-TK were co-transfected into HEK293T cells, and the drugs were added to the cells simultaneously. After transfection, the cells were lysed and loaded onto a GloMax 96-well microplate spectrophotometer (Promega). The luciferase activity of the transfected cells was measured using a dual-luciferase reporter gene assay system (firefly luciferase reacts with the substrate LARII to produce a fluorescent signal; after detection by the instrument, the firefly luciferase is quenched with Stop & Glo reagent, while Renal luciferase is activated to produce fluorescence). This allows for the analysis of the effect of the drugs on influenza virus polymerase activity.
[0103] Data processing: First, calculate the Firefly luciferase / Renilla luciferase ratio in each tube. Then, using the ratio of the control group as the unit, the relative luciferase activity of different treatment groups, which is the activity of influenza virus polymerase, can be obtained.
[0104] II. Determination of Activity
[0105] 12-well cell culture plates were coated with poly-L-lysine, and HEK293T cells were seeded in the plates in DMEM containing 10% FBS. After the cells reached 80% confluency, 500 ng pCAGGS-WSN PB2, 500 ng pCAGGS-WSN PB1, 500 ng pCAGGS-WSN PA, 500 ng pCAGGS-WSN NP plasmids, 200 ng pHH21-SC09NSF-Luc, and 10 ng pRL-TK plasmids were simultaneously transfected into the cells. 10 h after transfection, the culture medium containing plasmids and transfection reagents was discarded, and the medium was replaced with HEK293T cell culture medium containing 20 μM and 30 μM of the test compounds (triptolide, buquina, vorselotto, and imidazolidin), respectively, and cultured for another 26 h. After discarding the cell culture supernatant, wash once with PBS, lyse cells with 250 μL of Passive Lysis Buffer per well, centrifuge at 12000 r / min for 5 min, and take 20 μL of supernatant for Dual-Luciferase. ® The Reporter System is used to detect polymerase complex activity.
[0106] Under gradient concentrations of compounds, with the luciferase ratio of the 0.1 v / v% DMSO aqueous solution group as 100%, the polymerase activity of the five compounds that inhibited influenza virus replication in Example 2 was measured. The results are as follows: Figure 6As shown, triptolide, buquina, vocerotropin, and imidazoribine all significantly inhibited influenza virus polymerase activity, and the polymerase activity in the 30 μM group was lower than that in the 20 μM group, indicating that their inhibitory effect was dose-dependent. Compared with the control group, the polymerase activities in the 20 μM and 30 μM triptolide groups decreased by 99.51% and 99.57%, respectively (P < 0.001); the polymerase activities in the 20 μM and 30 μM buquina groups decreased by 98.96% and 99.19%, respectively (P < 0.001); the polymerase activities in the 20 μM and 30 μM vocerotropin groups decreased by 48.04% and 70.52%, respectively (P < 0.001); and the polymerase activities in the 20 μM and 30 μM imidazoribine groups decreased by 18.55% and 28.11%, respectively (P < 0.01).
[0107] Therefore, it can be seen that all four drugs can inhibit the activity of influenza virus RNA polymerase, which helps to suppress the influenza virus.
[0108] Example 7: Detection of influenza virus neuraminidase activity
[0109] I. Cell Detection Experiment
[0110] According to the instructions, a white, non-bottom-transparent 96-hole plate was used to reduce light loss and interference between holes. 3×10 7 Influenza A virus (WSN) at pfu / mL was diluted 1:100 (v / v) with NA-XTD™ Assay Buffer (purchased from Thermofisher), and 25 μL was added to each well. The test compound (epalrestat) was also diluted to 100 μM using the same Assay Buffer, and 25 μL was added to each well. This process was repeated for 3 wells, and the mixture was incubated at 37°C for 20 min (at which point the final compound concentration was 33.33 μM). Next, 25 μL of 1000×NA-XTD™ Substrate (purchased from Thermofisher) diluted 1:1000 (v / v) was added to each well, and the mixture was incubated at room temperature for 30 min. Finally, 60 μL of NA-XTD™ Accelerator (purchased from Thermofisher) was added to each well, and the luminescence value was immediately detected using a GLOMAX 96 microplate chemiluminescence analyzer. The detection time for each well was 1 s, and the average value was taken from 3 measurements.
[0111] See Neuraminidase activity. Figure 7 A. This demonstrates that epalrestat exhibits inhibitory activity against influenza A virus neuraminidase.
[0112] Then, the half-maximal inhibitory concentration (IC50) of epalrestat for neuraminidase was measured. 50 This refers to the concentration of a compound required to inhibit enzyme activity by half, evaluating the inhibitory activity of the compound on the enzyme. (3 × 10⁻⁶) 7 Influenza A virus (WSN) at pfu / mL was diluted 1:100 with NA-XTD™ Assay Buffer, and 25 μL was added to each well. The analyte was then serially diluted using the Assay Buffer at concentrations of 1,000,000 nM, 200,000 nM, 100,000 nM, 40,000 nM, 20,000 nM, 8,000 nM, 1600 nM, 320 nM, 64 nM, 12.8 nM, 2.56 nM, 0.512 nM, and 0.1024 nM. Each concentration was repeated in triplicate, resulting in final detection concentrations of 333,333.33 nM, 66,666.67 nM, 33,333.33 nM, 13,333.33 nM, 6,666.67 nM, 2666.67 nM, 533.33 nM, and 106.67 nM. After incubating at 37°C for 20 min at nM, 21.33 nM, 4.27 nM, 0.85 nM, 0.17 nM, and 0.03 nM, 25 μL of NA-XTD™ Substrate was added to each well, followed by incubation at room temperature for 30 min. Finally, 60 μL of NA-XTD™ Accelerator was added to each well, and the luminescence values were detected using a GLOMAX 96 microplate chemiluminescence analyzer. The detection time per well was 1 s, and three measurements were taken, with the average value taken. The data were analyzed using GraphPad Prism 8.0.2 software, and the IC50 of the compounds was calculated using nonlinear regression and Nonlin fitting. 50 .
[0113] See fitted curve Figure 7 B. Therefore, epalrestat exhibits concentration-dependent inhibitory activity against neuraminidase. Curve fitting revealed the drug concentration required to inhibit neuraminidase to the extent that it does so, i.e., the IC50 concentration. 50 It is 17.36 μM.
[0114] II. Molecular docking experiments
[0115] The protein ligand structure was downloaded from the RCSB website (https: / / www.rcsb.org / ), PBD ID: 6D96. This protein is the X-ray diffraction structure of the neuraminidase (NA) of influenza virus A / BrevigMission / 1 / 1918 (H1N1) expressed in HEK-293E cells. The structure of ligand E16-1 was obtained from the Pubchem website (https: / / pubchem.ncbi.nlm.nih.gov / ). Ligand pretreatment was performed using PyMOL software to remove water molecules, calcium ions, and residual ligands from the model, while also removing repeating peptide chains.
[0116] Then, using AutoDockTools-1.5.7 software, the protein model was hydrogenated, the docking box was set, and the data was saved. The stiffness and flexibility of the ligand chemical bonds were set and saved as a pdbqt file. Molecular docking was performed using the AutoDock vina command with the parameters "eceptor = 6d96 pymol. pdbqt; ligand = E16-1 . pdbqt;center_x = 17.652;center_y = -9.22; center_z = 15.293; size_x = 15.0; size_y = 15.0; size_z = 15.0; out = 6d96-E16-1 _out. pdbqt". The docking results were visualized, and binding energy and hydrogen bond analysis were performed using AutoDockTools-1.5.7 and PyMOL 2.5.
[0117] Using AutoDock vina software and E16-1 as the ligand, nine docking models were output by targeting the active pocket of influenza virus N1 subtype neuraminidase. Figure 8 (A) Hydrogen bond analysis was performed using AutoDockTool software, and the results are as follows: Figure 8 As shown in (B~F), in models 1, 2, 3, 6, and 7, E16-1 forms two hydrogen bonds with the neuraminidase binding pocket. The docking results were visualized and analyzed using PyMOL software, as shown below. Figure 9 As shown, A represents the binding pocket, and B through F represent the binding forms of models 1, 2, 3, 6, and 7, respectively. Among them, model 1 has the lowest binding energy, as shown... Figure 8 As shown in (A), it is -6.5 kcal / mol.
[0118] The docking sites of Model 1 were analyzed, and the results are as follows: Figure 9As shown in (G), the E16-1 molecule binds to the Arg292 and Arg371 sites of the influenza virus N1 subtype neuraminidase via hydrogen bonds (yellow dashed lines). Additionally, Arg118 is a binding site that appears multiple times in other docking models.
[0119] Example 8: Detection of Compound Inhibition of Influenza Virus Protein Expression
[0120] A549 cells were fed at a rate of 1×10 5 Cells were seeded at a density of 1 / 2 wells in F12K medium containing 10 v / v % fetal bovine serum and cultured at 37°C and 5% CO2. Once the cell density in the wells reached 90%, the cells were infected with WSN (H1N1) virus at an MOI of 0.01. One hour after virus adsorption, three wells of each test compound were replaced with 1 mL of Opti-MEM medium (containing 0.125 μg / mL TPCK trypsin and 0.1 v / v % DMSO) containing 5 μM, 10 μM, and 20 μM of the test compounds (triptolide, buquina, vorselotor, imidazolidin, and epalrestat). A 0.1 v / v % DMSO aqueous solution was set up as a negative control, and oseltamivir phosphate was used as a positive control. After 24 h, 50 μL of culture supernatant was collected in 1.5 mL EP tubes and stored at -80°C.
[0121] After discarding the cell culture supernatant, wash the cells once with PBS, and add 100 μL of 1×SDS lysis buffer, 1 μL of PMSF solution, and 0.1 μL of ribozyme to each well. After lysis at room temperature for 5 min, collect the lysis buffer into a 1.5 mL EP tube and denature at 95 °C for 10 min for Western blotting.
[0122] The protein samples were added at 15 μL / well to the wells of a 10% SDS-PAGE gel and electrophoresed at 80 V. Once the protein samples began to separate through the stacking gel, the electrophoresis was increased to 120 V until the electrophoresis was complete. A 0.45 μm nitrocellulose membrane (NC membrane) was placed in NC membrane equilibration buffer and allowed to stand for 30 s, then transferred using an eblot L1 rapid wet transfer apparatus. After blocking with 5% skim milk solution at room temperature for 1 h, residual blocking solution was washed with PBS. The primary antibody was diluted 1:1000 with PBS and incubated on a shaker at low speed at room temperature for 1 h. After incubation, the membrane was washed with PBST solution at high speed on a shaker at room temperature for 10 min, repeated 3 times to remove unbound primary antibody. Secondary antibody was prepared at a 1:5000 (v / v) dilution with PBS, and incubated at room temperature in the dark for 1 h. The membrane was then washed 3 times in the dark for 10 min each time. The results were imaged and analyzed using an Odyssey CLX near-infrared scanner.
[0123] For the internal control GAPDH, the primary antibody was a rabbit-derived GAPDH polyclonal antibody (Proteintech, catalog number 10494-1-AP), and the secondary antibody was Dylight 680-labeled goat anti-rabbit IgG (Li-COR Bioscience, catalog number 926-68071). For the influenza polymerase protein PB1, the primary antibody was a mouse-derived PB1 monoclonal antibody (prepared in our laboratory), and the secondary antibody was Dylight 680-labeled goat anti-mouse IgG (Li-COR Bioscience, catalog number 926-68070).
[0124] For influenza virus nucleoprotein NP, the primary antibody is a mouse-derived NP monoclonal antibody prepared in the applicant's laboratory, and the secondary antibody is Dylight 680-labeled goat anti-mouse IgG (Li-COR Bioscience, catalog number 926-68070).
[0125] See the WB results and viral titers for each group. Figure 10 Therefore, based on grayscale analysis, viral proteins were undetectable in the triptolide group; both NP and PB1 proteins showed a significant gradient decrease in the buquina group; both NP and PB1 proteins decreased in the vocerotropin group; NP protein showed no significant decrease in the imidazolidin group, while PB1 protein showed a gradient decrease; similarly, NP protein showed no significant decrease in the epalrestat group, while PB1 protein expression showed a gradient decrease. In the positive control oseltamivir group, the NP protein content did not decrease significantly, but the viral titer decreased significantly.
[0126] Example 9: The effect of siRNA interfering with drug target genes on influenza virus replication
[0127] siRNAs were designed based on the human gene sequence of buquina target gene (gene name DHODH, Gene ID: 231, GenBank No. NM_001361.5), the human gene sequence of imidazoribine target gene (gene name IMPDH2, GenBank No. NM_001410759.1, Gene ID: 1723), and the human gene sequence of epalrestat target gene (gene name AKR1B1, GenBank No. NM_001628.4, Gene ID: 3615). The RNA sequences complementary to the target sequences in each siRNA are shown in Table 2 as si_231 (SEQ ID NO. 6), si_1723 (SEQ ID NO. 7), and si_3615 (SEQ ID NO. 8), respectively. The sequence shown in si_NC (SEQ ID NO. 9) is used as a negative control. The siRNA and negative control si_NC were transfected into A549 cells using the reverse transfection method described in the Lipofectamine™ RNAiMAX (purchased from Thermo Fisher Scientific, catalog number 13778030) instructions to interfere with the expression of related genes. One group of cells was sampled 36 h post-infection and Western blotting was performed to determine the interference efficiency at protein levels. The other group of cells was infected 36 h post-infection with influenza A virus (WSN) at an MOI of 0.01. One h after infection, the medium was replaced with Opti-MEM medium containing 0.125 μg / mL TPCK trypsin at 1 mL / well. Cell culture supernatants were collected at 24 h and 48 h post-infection, and plaque titers were performed according to the method described in Example 2 to determine the viral titer.
[0128] For the internal control GAPDH, the primary antibody was a rabbit-derived GAPDH polyclonal antibody (Proteintech, catalog number 10494-1-AP), and the secondary antibody was Dylight 680-labeled goat anti-rabbit IgG (Li-COR Bioscience, catalog number 926-68071). For the target gene protein of buquina, the primary antibody was a mouse-derived DHODH monoclonal antibody (Proteintech, catalog number 67977-1-Ig), and the secondary antibody was Dylight 680-labeled goat anti-mouse IgG (Li-COR Bioscience, catalog number 926-68070). For the target gene protein of imidazoribine, the primary antibody was a mouse-derived IMPDH2 monoclonal antibody (Proteintech, catalog number 67663-1-Ig), and the secondary antibody was Dylight 680-labeled goat anti-mouse IgG (Li-COR Bioscience, catalog number 926-68070). For the target gene protein of epalrestat, the primary antibody was a rabbit-derived AKR1B1 polyclonal antibody (Invitrogen, catalog number PA5-29718), and the secondary antibody was Dylight 680-labeled goat anti-rabbit IgG (Li-COR Bioscience, catalog number 926-68071).
[0129] Table 2. siRNA sequences (sequences of RNA strands complementary to the target sequence)
[0130] siRNA Sense 5'→3' si_231-DHODH GCAGUUAACCAGAUUGAGUUU si_1723-IMPDH2 GCAAGGACAUUGAAUAUUAUU si_3615-AKR1B1 CAAGUACAUCAAAGACAAAUU si_NC UUCUUCGAACGUGUCACGTUU
[0131] After 36 h of siRNA interference, the expression levels of the bukena target, imidazolidin target, and epalrestat target genes all decreased. Figure 11 Based on this, viral titers increased slightly at 24 h and 48 h after infection. Buquina Target showed a 1.86-fold and 4.18-fold increase in viral titers at 24 h and 48 h post-infection, respectively; imidazolidin Target showed a 3.03-fold and 6.87-fold increase at 24 h and 48 h post-infection, respectively; and epalrestat Target showed a 3.39-fold and 4.53-fold increase at 24 h and 48 h post-infection, respectively. Figure 11 B).
[0132] After inhibiting the target proteins in cells treated with these three drugs using siRNA, the viral titer increased, indicating that the aforementioned three target proteins were involved in the drug's inhibitory effect on the virus.
[0133] Example 10: Test of the antiviral effect of drug combination
[0134] I. Drug Preparation
[0135] Prepare drug solutions of triptolide, buquina, vorselotor, mizoribine, and epalrestat in 0.1 v / v DMSO. The concentrations are shown in Table 3, numbers 1-5 below (all EC values calculated in Example 4). 50 (Corresponding concentration).
[0136] Any two of the aforementioned five drugs can be combined (a total of ten combinations), using twice the EC50 of the single drug. 50 A composition solution is prepared by mixing equal volumes of stock solutions of corresponding concentrations. The concentrations of the two drugs in the composition are both EC. 50 Corresponding concentrations. The solvent is 0.1 v / v% DMSO. The stock solution concentrations in the preparation method are shown in items 6-15 of Table 3 below.
[0137] The following negative control was set up, as shown in Table 3, number 16.
[0138] Using solutions 1-15 in Table 3 as test compounds and solution 16 as a negative control, each sample was repeated 12 times. Other methods and procedures were the same as in Example 4. The content of influenza virus NP gene vRNA in the corresponding wells of each test solution was determined. See column 3 of Table 3 for specific vRNA content. For statistics on the influenza virus NP gene vRNA content in the negative control, two single drugs, and combinations of these two single drugs, see [link to table]. Figure 12 .
[0139] Therefore, it is evident that the viral loads of the two drugs in most combinations were the lowest, significantly better than those of the single drugs, and some showed significant synergistic effects. No cases were found where the viral loads of the combination drugs were higher than those of the single drugs, and there were no antagonistic interactions among these drugs. Therefore, the combination of five drugs shows better application prospects.
[0140] Table 3. Statistics on Drug Preparation and Virus Content
[0141] serial number Drug preparation plan vRNA content % 1 0.1323 μM buquina. 37.4 2 5.003 μM imidazoline. 32.59 3 0.6564 μM Tripterygium wilfordii lactone. 17.18 4 2.213 μM Voselotto. 78.85 5 0.8847 μM epastag. 18.77 6 0.2646 μM buquina + 10.006 μM imidazolidin 13.05 7 1.3128 μM Tripterygium wilfordii lactone + 10.006 μM imidazolidin 1.51 8 0.2646 μM buquina + 1.3128 μM triptolide 1.765 9 0.2646 μM buquina + 4.426 μM vocerotropine 3.65 10 1.3128 μM Tripterygium wilfordii lactone + 1.7694 μM epastag 16.72 11 4.426 μM Voselotto + 1.3128 μM Tripterygium wilfordii 17.69 12 4.426 μM vorselotor + 10.006 μM imidazolidin 7.62 13 4.426 μM Vorseloto + 1.7694 μM Ipatal 29.46 14 1.7694 μM epasatol + 0.2646 μM buquina 4.87 15 1.7694 μM epastastat + 10.006 μM imidazolidin 2.56 16 0.01% DMSO 100
[0142] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or its equivalents are included in this invention.
Claims
1. A pharmaceutical composition for inhibiting influenza virus, wherein the pharmaceutical active ingredients of the pharmaceutical composition comprise active substance a and active substance b; The active substance a is any one or a combination of two of vocerotrope and vocerotrope medicinal salts. The active substance b is any one or a combination of two of epalrestat and epalrestat pharmaceutical salts; The structural formula of the Vucelot is: ; The structural formula of epalostat is: ; The molar ratio of active substance a to active substance b is 1:0.3-0.
5.
2. The pharmaceutical composition according to claim 1, characterized in that, The composition also contains excipients.
3. Use of a biomaterial in the preparation of a medicine for improving health conditions; The biomaterial is the pharmaceutical composition or active substance a according to claim 1 or 2; The active substance a is any one or a combination of two of Voselotto or Voselotto pharmaceutical salts. The structural formula of the Vucelot is: ; The intended use is selected from any one or a combination of the following U1, U2, U3 and U4; U1: The improvement of health status refers to preventing influenza, treating influenza, slowing down influenza, or inhibiting the proliferation of influenza virus; U2: The improvement in health status refers to reducing the damage of the influenza virus to the lungs; U3: The improvement in health status is achieved by reducing the damage of influenza virus to the body by inhibiting influenza virus RNA-dependent RNA polymerase; U4: The improvement in health status is achieved by inhibiting influenza virus neuraminidase to reduce the damage of influenza virus to the body.
4. The use as described in claim 3, characterized in that, The influenza virus is a type A influenza virus, and the influenza is type A influenza.
5. The use as described in claim 3, characterized in that, The influenza virus is the H1N1 influenza virus, and the influenza is influenza caused by the H1N1 influenza virus.
6. The use as described in claim 3, characterized in that, The influenza strains mentioned are human influenza, avian influenza, and swine influenza.
Citation Information
Patent Citations
Methods of treating sickle cell disease using vocerotropine
CN118678956A
Aldose reductase inhibitors for the treatment of acute respiratory distress syndrome, acute lung inflammation / injury, cardiac injury and Anti-viral therapy
US20230058134A1