Application of plant lactobacillus BD7807 in preparation of product for treating intestinal barrier dysfunction

Abstract

The invention relates to the technical field of microorganisms, in particular to application of plant lactobacillus BD7807 in preparation of a product for treating intestinal barrier dysfunction. The product for treating intestinal barrier dysfunction can significantly improve Caco2 cell monolayer barrier injury induced by excessive fatty acid, alleviate body oxidative stress injury and whole body chronic low-degree inflammation caused by high fat diet, significantly enhance expression of tight junction genes and activity of proteins, enhance integrity of intestinal epithelial barrier, and improve the intestinal barrier dysfunction. And the market prospect is wide.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly to the use of Lactiplantibacillus plantarum BD7807 in the preparation of products for treating intestinal barrier dysfunction. Background Art

[0002] With the transformation of modern lifestyles, the prevalence of high-fat diets (HFD) has led to a sharp increase in obesity rates. High-fat diets not only directly affect body weight but also disrupt intestinal barrier function, leading to increased intestinal permeability and subsequent intestinal inflammation and systemic inflammatory responses. Intestinal barrier dysfunction is closely associated with various diseases, including inflammatory bowel disease (IBD), colorectal cancer (CRC), etc.

[0003] Currently, the clinical treatment of intestinal inflammation mainly relies on drugs such as statins and anti-inflammatory drugs. However, the long-term use of these drugs may cause side effects such as muscle pain and abnormal liver function, limiting their widespread application. Therefore, there is an urgent need to find safe and effective alternative or adjuvant treatment methods. In recent years, probiotics have gradually become a research hotspot for treating intestinal barrier dysfunction due to their regulatory effects on the intestinal microenvironment. Probiotics show potential in treating intestinal barrier dysfunction through various mechanisms such as regulating the intestinal flora, enhancing intestinal barrier function, and inhibiting inflammatory responses. Summary of the Invention

[0004] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide the use of Lactiplantibacillus plantarum BD7807 in the preparation of products for treating intestinal barrier dysfunction, so as to solve the problems in the prior art.

[0005] To achieve the above purpose and other related purposes, the present invention provides the use of Lactiplantibacillus plantarum BD7807 in the preparation of products for treating intestinal barrier dysfunction.

[0006] The present invention also provides a product for treating intestinal barrier dysfunction, which necessarily includes the Lactiplantibacillus plantarum BD7807 and uses the Lactiplantibacillus plantarum BD7807 as an active ingredient for the above-mentioned efficacy.

[0007] As described above, the use of the Lactiplantibacillus plantarum BD7807 of the present invention in the preparation of products for treating intestinal barrier dysfunction has the following beneficial effects:

[0008] 1) It can significantly improve the monolayer barrier damage of Caco2 cells induced by excessive fatty acids;

[0009] 2) It alleviates the oxidative stress damage and systemic chronic low-grade inflammation caused by a high-fat diet.

[0010] 3) Significantly enhanced the expression of tight junction genes and the activity of proteins, and enhanced the integrity of the intestinal epithelial barrier;

[0011] 4) Promoted goblet cells to secrete mucin 2, restored the damaged intestinal mucosa, and thus resisted intestinal pathogenic bacteria;

[0012] 5) Remodeled the intestinal microbiota and increased the abundance of the intestinal probiotic genus Lactobacillus.

[0013] Deposit number: CGMCC NO. 33630;

[0014] Taxonomic name: Lactiplantibacillus plantarum;

[0015] Depositary institution: China General Microbiological Culture Collection Center;

[0016] Address of the depositary institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0017] Deposit date: February 24, 2025. Brief description of the drawings

[0018] Figure 1 Shown are the Gram-stained cell morphology (A) and phylogenetic tree diagram (B) of the strain in Example 1 of the present invention.

[0019] Figure 2 Shown is a schematic diagram of the effect of Lactiplantibacillus plantarum BD7807 in Example 2 of the present invention on the cell viability of Caco-2.

[0020] Figure 3 Shown are schematic diagrams of the detection of cell permeability in different treatment groups in Example 2 of the present invention; Figure A shows a schematic diagram of the transepithelial electrical resistance value; Figure B shows a schematic diagram of the fluorescence intensity labeled with FITC-dextran; Figure C shows a schematic diagram of the activity results of alkaline phosphatase (ALP).

[0021] Figure 4 Shown are schematic diagrams of the detection of antioxidant indexes in different treatment groups in Example 3 of the present invention; Figure A shows a schematic diagram of the malondialdehyde (MDA) level; Figure B shows a schematic diagram of the glutathione (GSH) level; Figure C shows a schematic diagram of the catalase (CAT) level; Figure D shows a schematic diagram of the superoxide dismutase (SOD) level.

[0022] Figure 5 Shown are schematic diagrams of the detection of inflammatory factors in different treatment groups in Example 3 of the present invention.

[0023] Figure 6It shows the schematic diagram of the detection of intestinal permeability-related indicators in different treatment groups in Example 3 of the present invention; Figure A shows the schematic diagram of the content of D-lactic acid (D-LA); Figure B shows the schematic diagram of the content of lipopolysaccharide (LPS); Figure C shows the schematic diagram of the content of diamine oxidase (DAO).

[0024] Figure 7 It shows the H&E staining map of the mouse colon tissue in Example 3 of the present invention;

[0025] Figure 8 It shows the immunohistochemical (IHC) staining map of the mouse colon tissue in Example 4 of the present invention;

[0026] Figure 9 It shows the relative mRNA level map of real-time fluorescence quantitative PCR of the mouse colon tissue in Example 4 of the present invention;

[0027] Figure 10 It shows the Alcian blue staining map of the mouse colon tissue in Example 4 of the present invention;

[0028] Figure 11 It shows the composition map of the mouse intestinal microbiota in different treatment groups in Example 5 of the present invention; Figure A shows the result map of α-diversity in microbial diversity; Figure B shows the principal coordinate analysis (PCoA) score map of β-diversity.

[0029] Figure 12 shows the schematic diagram of the mouse intestinal flora level in different treatment groups in Example 5 of the present invention; Figure A shows the phylum level map of the mouse intestinal flora; Figure B shows the family level map of the mouse intestinal flora; Figure C shows the genus level map of the mouse intestinal flora. Detailed implementation manners

[0030] The present invention first provides the use of Lactiplantibacillus plantarum BD7807 with the preservation number of CGMCC NO. 33630 in the preparation of products for treating intestinal barrier dysfunction.

[0031] The Lactiplantibacillus plantarum BD7807 is isolated from pickles.

[0032] The Lactiplantibacillus plantarum BD7807 is a Gram-positive bacterium, and its cells are rod-shaped.

[0033] The "Intestinal barrier dysfunction" refers to intestinal mucosal injury, atrophy, increased intestinal permeability, intestinal flora dysbiosis, which leads to bacterial and / or endotoxin translocation, and can induce and / or exacerbate systemic inflammatory response and multiple organ dysfunction. Intestinal barrier function is a key factor in maintaining intestinal homeostasis, and its disruption or dysfunction is closely related to local and systemic consequences, which are largely related to the direct contact between bacteria / bacterial products and epithelial cells and the transfer of these products to the systemic circulation.

[0034] In the present invention, the "treatment" means a series of positive effects are exerted after the disease has already started to develop. Specifically, it can slow down the progression speed of the disease, control the originally rapid development trend; can interrupt the process of continuous deterioration of the disease, and prevent the disease from further evolving in a severe direction; effectively control the severity of the disease and avoid it exceeding the range that the body can bear; stop the adverse development trend of the disease and prevent it from deteriorating further; relieve various discomfort symptoms brought by the disease and alleviate the pain of the patient; and even reverse the progression direction or severity of a specific sign, symptom, disorder, disease to a certain extent. However, it should be clear that this treatment does not necessarily mean that it can involve the complete elimination of all signs, symptoms, diseases or disorders related to the disease, but rather improve the state of the disease and slow down the signs, symptoms, diseases or disorders related to the disease.

[0035] In certain embodiments of the present invention, the intestinal barrier dysfunction is the intestinal barrier dysfunction caused by a high-fat diet (HFD).

[0036] The "high-fat diet" refers to a dietary pattern in which the intake of fat is relatively high, especially the intake of saturated fatty acids and trans fatty acids exceeds the healthy recommended standards.

[0037] In certain embodiments of the present invention, the product for treating intestinal barrier dysfunction treats intestinal barrier dysfunction by any one or more of the following:

[0038] 1) Maintaining the balance of intestinal flora;

[0039] 2) Enhancing the intestinal barrier function;

[0040] 3) Repairing the intestinal barrier injury;

[0041] 4) Regulating the immune response;

[0042] 5) Improving the structure and function of the intestinal barrier.

[0043] In certain embodiments of the present invention, the product for treating lipid metabolism disorders has any one or more of the following effects:

[0044] 1) Maintain the balance of intestinal flora;

[0045] 2) Enhance the intestinal barrier function;

[0046] 3) Repair the damage of intestinal barrier;

[0047] 4) Regulate the immune response;

[0048] 5) Improve the structure and function of intestinal barrier.

[0049] In some embodiments of the present invention, the above-mentioned maintenance of the balance of intestinal flora includes, but is not limited to, increasing the intestinal microbial diversity, enhancing the abundance of intestinal beneficial bacteria and / or reducing the abundance of intestinal harmful bacteria.

[0050] Specifically, the increase in intestinal microbial diversity, the enhancement of the abundance of intestinal beneficial bacteria and / or the reduction of the abundance of intestinal harmful bacteria mean that the microbial diversity, the abundance of intestinal beneficial bacteria and / or the abundance of intestinal harmful bacteria in the object of action approach or reach the level of a healthy individual. For example, based on the microbial diversity, the abundance of intestinal beneficial bacteria and / or the abundance of intestinal harmful bacteria in a healthy individual, the product can restore the microbial diversity, the abundance of intestinal beneficial bacteria and / or the abundance of intestinal harmful bacteria of the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0051] In some embodiments of the present invention, the microbial diversity includes α-diversity and / or β-diversity. The microbial diversity is characterized by an intestinal microbial diversity index; the intestinal microbial diversity index is selected from the Chao1 index, the Ace index, the Shannon index and / or the Simpson index.

[0052] In some embodiments of the present invention, the above-mentioned enhancement of the intestinal barrier function includes, but is not limited to, reducing the intestinal cell permeability. The reduction of the intestinal cell permeability means that the intestinal cell permeability of the object of action approaches or reaches the level of a healthy individual. For example, based on the intestinal cell permeability in a healthy individual, the product can restore the intestinal cell permeability of the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0053] In some embodiments of the present invention, the reduction of the intestinal cell permeability includes inhibiting the increase in the levels of D-lactic acid (D-LA), diamine oxidase (DAO) and / or lipopolysaccharide (LPS) in the blood.

[0054] In certain embodiments of the present invention, the repair of intestinal barrier damage includes, but is not limited to, inhibiting the decrease in the transepithelial electrical resistance value of intestinal cells, inhibiting the increase in the influx of FITC-dextran in intestinal cells, and / or inhibiting the increase in the ALP activity in intestinal cells.

[0055] Specifically, the inhibition of the decrease in the transepithelial electrical resistance value of intestinal cells, the inhibition of the increase in the influx of FITC-dextran in intestinal cells, and / or the inhibition of the increase in the ALP activity in intestinal cells means making the transepithelial electrical resistance value, FITC-dextran, and / or ALP activity of the object of action approach or reach the level of a healthy individual. For example, based on the transepithelial electrical resistance value, FITC-dextran, and / or ALP activity in a healthy individual, the product can restore the transepithelial electrical resistance value, FITC-dextran, and / or ALP activity of the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0056] In certain embodiments of the present invention, the regulation of the immune response includes, but is not limited to, reducing the concentration of pro-inflammatory factors and / or increasing the concentration of anti-inflammatory factors.

[0057] Specifically, the reduction of the concentration of pro-inflammatory factors and / or the increase of the concentration of anti-inflammatory factors means making the concentration of pro-inflammatory factors and / or the concentration of anti-inflammatory factors in the body of the object of action approach or reach the content of a healthy individual. For example, based on the concentration of pro-inflammatory factors and / or the concentration of anti-inflammatory factors in a healthy individual, the product can restore the concentration of pro-inflammatory factors and / or the concentration of anti-inflammatory factors in the body of the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0058] In certain embodiments of the present invention, the pro-inflammatory factors are TNF-α, IL-6, and / or IL-1β.

[0059] In certain embodiments of the present invention, the anti-inflammatory factor is IL-10.

[0060] In certain embodiments of the present invention, the improvement of the structure and function of the intestinal barrier includes, but is not limited to, restoring the expression of genes related to intestinal tight junctions (TJ).

[0061] Specifically, the restoration of the expression of genes related to intestinal TJ means making the expression level of genes related to TJ in the body of the object of action approach or reach the level of a healthy individual. For example, based on the expression level of genes related to TJ in a healthy individual, the product can restore the expression level of genes related to TJ of the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0062] In certain embodiments of the present invention, the intestinal TJ-related genes are selected from one or more of ZO-1, Occludin, Claudin-1, Claudin-2, or Claudin-3.

[0063] In certain embodiments of the present invention, the improvement of the structure and function of the intestinal barrier further includes reducing oxidative stress.

[0064] Specifically, the reduction of oxidative stress includes, but is not limited to, reducing the content of superoxide dismutase (SOD), catalase (CAT), and / or glutathione (GSH) and / or increasing the content of malondialdehyde (MDA).

[0065] Specifically, the reduction of the content of SOD, CAT, and / or GSH means making the content of SOD, CAT, and / or GSH in the object of action close to or reach the content of a healthy individual. For example, based on the content of SOD, CAT, and / or GSH in a healthy individual, the product can restore the content of SOD, CAT, and / or GSH in the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, even more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0066] Specifically, the increase of the content of MDA means making the content of MDA in the object of action close to or reach the content of a healthy individual. For example, based on the content of MDA in a healthy individual, the product can restore the content of MDA in the object of action to at least 10%, preferably at least 30%, more preferably at least 50%, even more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0067] In certain embodiments of the present invention, the viable count of the product for treating intestinal barrier dysfunction is 1×10 8 ~1×10 10 cfu / mL.

[0068] The present invention also provides a product for treating intestinal barrier dysfunction, which necessarily includes Lactiplantibacillus plantarum BD7807, and uses Lactiplantibacillus plantarum BD7807 as the active ingredient for the foregoing efficacy.

[0069] In the product, the active ingredient that exerts the function may be only Lactiplantibacillus plantarum BD7807, or may also contain other substances.

[0070] That is, Lactiplantibacillus plantarum BD7807 is the sole active ingredient or one of the active ingredients of the product.

[0071] The product can be a single-component substance or a multi-component substance.

[0072] There is no special limitation on the dosage form of the product, which can be various forms such as solid, liquid, gel, semi-fluid, aerosol, powder, etc. In some embodiments of the present invention, the dosage form of the product for treating intestinal barrier dysfunction is powder, that is, bacterial powder, and the concentration of Lactiplantibacillus plantarum BD7807 in the bacterial powder is 1×10 8 ~1×10 10 cfu / mL.

[0073] The main target of the product is mammals. The mammals are preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The rodents are preferably mice. The primates are preferably monkeys, apes or humans.

[0074] The product includes but is not limited to drugs, health products, foods, etc.

[0075] In some embodiments of the present invention, the product is a drug, and the drug further includes a pharmaceutically acceptable carrier or excipient.

[0076] "Pharmaceutically acceptable" means that when the drugs are properly administered to animals or humans, they do not produce adverse, allergic or other adverse reactions.

[0077] "Pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, that is, it can be blended with it without significantly reducing the effect of the drug under normal circumstances. Specific examples of some substances that can be used as pharmaceutically acceptable carriers or excipients are sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; coloring agents; flavoring agents; tabletting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solutions; and phosphate buffer solutions, etc. These substances are used as needed to help the stability of the formulation or to improve the activity or its bioavailability or to produce an acceptable taste or odor in the case of oral administration.

[0078] The product in the present invention can also be used in combination with other methods for treating intestinal barrier dysfunction. The combined use can be simultaneous use or sequential use. Other methods for treating intestinal barrier dysfunction include but are not limited to other drug therapies or non-drug therapies, such as diet adjustment, weight control, regular exercise, smoking cessation and alcohol restriction, stress management, and sufficient sleep.

[0079] The following describes the embodiments of the present invention through specific examples. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0080] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments, rather than limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include plural forms.

[0081] When an embodiment gives a numerical range, it should be understood that unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials of the prior art similar to or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention.

[0082] Example 1 Isolation, Screening and Identification of Lactiplantibacillus plantarum BD7807

[0083] 1.1 Isolation and Screening of Strains

[0084] Samples were taken from fermented potherb mustard. Exactly 0.5 g of the sample was weighed and added to 4.5 mL of sterile physiological saline, and the sample was evenly dispersed by shaking. Then, 100 μL of the dispersed sample was taken for gradient dilution, and a suitable dilution gradient was selected. The diluted sample was evenly spread on an MRS agar plate. The plate was placed in an anaerobic environment and cultured at 37 °C for 42 hours. After culturing, single colonies were picked out, subjected to Gram staining, and the morphological characteristics of the colonies were observed under a microscope to preliminarily screen out strains suspected of being Lactobacillus ( Figure 1 A). Subsequently, these strains were repeatedly streaked and purified on an MRS solid medium, and finally purified Lactobacillus strains were obtained and stored in glycerol tubes at -80 °C.

[0085] The formula of the MRS medium is: peptone 10 g, beef extract powder 5 g, yeast powder 5 g, glucose 20 g, anhydrous sodium acetate 5 g, diammonium citrate 2 g, Tween 80 1 mL, dipotassium hydrogen phosphate (K 2HPO 4 ) 2 g, magnesium sulfate (MgSO 4 ) 0.2 g, manganese sulfate (MnSO 4 ) 0.05 g, add to 1000 mL of distilled water, adjust the pH value to 6.5, and then autoclave at 120 °C for 25 minutes. Add 1.5 g of agar powder to the solid MRS medium.

[0086] 1.2 Identification of strains

[0087] Using the single colony of BD7807 as a template, extract its genomic DNA for subsequent PCR amplification; use the universal bacterial primers 27F and 1492R to perform PCR amplification on 16S rDNA, and add an appropriate amount of 2×Taq PCR Mix;

[0088] The PCR reaction system is shown in Table 1:

[0089] Table 1 PCR reaction system

[0090] 10× buffer 10 μL 10 mM dNTP 2 μL Forward primer 1 μL Reverse primer 1 μL DNA template 2 μL Taq enzyme 0.5 μL <![CDATA[ddH 2 O]]> 34.5 μL

[0091] The PCR reaction conditions are shown in Table 2:

[0092] Table 2 PCR reaction conditions

[0093]

[0094] Then, verify the PCR products by agarose gel electrophoresis; finally, send the verified PCR products to Shanghai Bioengineering Co., Ltd. for sequence analysis, and perform BLAST alignment of the measured 16S rDNA sequence in the NCBI database to determine its similarity with known species. The 16S rDNA sequence is shown in Table 3:

[0095] Table 3 16S rDNA sequence

[0096]

[0097] Example 2 Protective effect of Lactiplantibacillus plantarum BD7807 on the monolayer barrier damage of Caco-2 cells

[0098] 2.1 Test cell culture and cell viability test

[0099] 1) Cell source and culture conditions:

[0100] Cell source: Human colon cancer Caco-2 cells were purchased from ATCC (Rockville, MD, USA).

[0101] Culture conditions: Cultured in a conventional culture dish, the culture medium consists of: DMEM medium supplemented with 10% fetal bovine serum (FBS); the cells are cultured in an atmosphere of 5% carbon dioxide at 37°C. The cells are cultured for 12 - 15 days, and the cell passage range is 30 - 40 generations until a completely confluent cell monolayer is formed.

[0102] 2) Cytotoxicity experiment

[0103] 2a) Cell seeding: Caco-2 cells are seeded at 2×10 4 cells / mL into a 96-well plate, and an appropriate amount of complete medium is added to each well. After culturing adherently in a cell incubator for 24 h.

[0104] 2b) Grouping and treatment: After the culture is completed, grouping is carried out as follows:

[0105] Experimental group: The culture medium is replaced with a culture medium containing different concentrations of Lactobacillus plantarum BD7807, and the gradient concentrations are 1×10 7 、1×10 8 、1×10 9 and 1×10 10 cfu / mL;

[0106] Solvent control group (SC): The culture medium is replaced with a culture medium containing 0.1% DMSO.

[0107] Blank control group (Con): Continue to use the complete medium without adding any treatment factors.

[0108] 2c) Continue culturing: After the culture medium is changed for each group, the cells are continued to be cultured in a cell incubator for 24 hours.

[0109] 2d) MTT assay: At the end of the culture, 20 μL of MTT solution (0.5 mg / mL, diluted with PBS buffer) is added to each well, and then the mixture is incubated in the dark at 37°C for 4 h; after the incubation is completed, the supernatant is discarded, 150 μL of DMSO is added to each well to dissolve the formazan crystals by shaking, and the absorbance of each well is immediately read at 490 nm with an enzyme-linked immunosorbent assay reader. The formula for calculating cell viability:

[0110]

[0111] The results are as Figure 1 shown. After treating Caco-2 cells with different concentrations (10 7 , 10 8 , 10 9 , 10 10 cfu / mL) of Lactobacillus plantarum BD7807, the cell viability did not change significantly. This indicates that 1×10 7 ~1×1010 Lactobacillus plantarum BD7807 within the cfu / mL dose range had no significant inhibitory effect on the proliferation of Caco-2 cells, and the survival rate of cells in each group was higher than 80%, showing good cell compatibility. Therefore, a dose of 1×10 10 cfu / mL was selected for subsequent experiments.

[0112] 2.2 Grouping of test cells and detection of Caco-2 cell permeability

[0113] 1) Trans-epithelial electrical resistance (TEER) value:

[0114] a) Cell seeding and culture: Caco-2 cells in the logarithmic growth phase were seeded in a 6-well plate (Transwell plate) at a density of 2×10 5 cell / mL; 1.5 mL of medium was added to the apical (AP) side, and 2.5 mL of medium was added to the basal (BL) side respectively, and cultured for about 21 days until the cells were fully differentiated; the medium was changed regularly to ensure good cell growth.

[0115] b) Determination of TEER value: The TEER value was measured using an epithelial resistance meter; ensure that the TEER value ≥500 Ω·cm 2 , indicating that the cell monolayer was fully differentiated and tightly connected.

[0116] c) Grouping: The above-mentioned cell monolayer cultured to full differentiation was grouped, and the following treatments were carried out after grouping:

[0117] Control (Con) group: Fatty acid-free bovine serum albumin was added to both the AP side and the BL side;

[0118] Palmitic acid (PA) group: Palmitic acid (PA) with a final concentration of 400 μΜ and fatty acid-free bovine serum albumin were added to both the AP side and the BL side;

[0119] Lactobacillus plantarum BD7807 intervention (PA+BD) group: A bacterial suspension of BD7807 at 1×10 10 cfu / mL and PA with a final concentration of 400 μΜ were added to both the AP side and the BL side.

[0120] d) Determination of TEER value: After the model was established (24 h), the epithelial resistance values of each group were measured using an epithelial resistance meter.

[0121] 2) Permeability of FITC-dextran 4 (FD4): The permeability of the Caco-2 cell monolayer was evaluated by measuring fluorescein isothiocyanate dextran (FITC-dextran 4 (FD4)) (Shanghai, China). The specific steps are as follows:

[0122] a) Cell seeding and culture: The seeding and culture methods are the same as those in 1.1a);

[0123] b) Group and process the cells that have completed culture in step 1.2a), and the grouping and processing conditions are the same as those in 1.1c);

[0124] c) Dissolve FITC-dextran 4 (Macklin, MS0901-0050MG) with a culture medium to prepare a 1 mg / ml solution;

[0125] d) After 24 hours of treatment, add the prepared FITC-dextran 4 solution (100 μl) to the AP side of different groups, and add an equal volume of culture medium to the BL side; Place the Transwell in an incubator at 37 °C and 5% CO 2 and incubate for 2 hours;

[0126] c. After the incubation is completed, collect the culture medium from the AP side and the BL side respectively, and use a fluorescence spectrometer to measure the fluorescence intensity of FITC-dextran 4 in the AP side and the BL side at an excitation wavelength of 490 nm and an emission wavelength of 520 nm. The fluorescence intensity can be determined by measuring the ratio of the absorbance values at 495 nm and 280 nm. The calculation formula is as follows:

[0127] PA group: Relative fluorescence intensity = A PA / A Con

[0128] PA + BD group: Relative fluorescence intensity = A PA+BD / A Con

[0129] In the formula, A PA is the absorbance of the PA group; A Con is Con the absorbance of the PA+BD group; A

[0130] 3) Alkaline phosphatase (ALP) activity:

[0131] a) Cell seeding and culture: The seeding and culture methods are the same as those in 1.1a);

[0132] b) Group and process the cells that have completed culture in step 1.3a), and the grouping and processing conditions are the same as those in 1.1c);

[0133] c) After 24 hours of treatment, measure the absorbance of each group according to the steps in the ALP detection kit (Sangon Biotech; product number: D799818-0100) instruction manual, and calculate the ALP activity in the cells of each group according to the activity calculation method in the instruction manual.

[0134] The results are asFigure 3 As shown in A, Lactiplantibacillus plantarum BD7807 intervention effectively inhibited the decrease in TEER value of Caco-2 cells induced by PA; the results are as follows Figure 3 As shown in B, Lactiplantibacillus plantarum BD7807 intervention significantly inhibited the increase in FITC-dextran influx in Caco-2 cells induced by PA; the results are as follows Figure 3 As shown in C, fatty acid treatment led to a significant increase in the ALP level of Caco-2 cells. However, Lactiplantibacillus plantarum BD7807 significantly inhibited the significant increase in ALP activity in Caco-2 cells induced by fatty acids (palmitic acid).

[0135] From the above results, it can be seen that Lactiplantibacillus plantarum BD7807 maintained the barrier function of the Caco-2 cell monolayer and reduced the permeability of Caco-2 cells. Surface Lactiplantibacillus plantarum BD7807 showed significant potential in maintaining intestinal health.

[0136] Example 3 Lactiplantibacillus plantarum BD7807 improves chronic inflammation and colon injury in HFD-induced mice

[0137] 3.1 Experimental animal grouping and model establishment

[0138] 1) Male C57BL / 6J mice (5 weeks old, n = 24) were purchased from Beijing Spey Foster Biotechnology Co., Ltd. (License number: SCXK 2019-0010). The light / dark cycle of all mice was 12 hours at 22 °C. Food and water were obtained according to the requirements of standard rodents and the mice were housed under specific pathogen-free (SPF) conditions. All experiments were approved by the Animal Care and Use Committee of Shenyang Agricultural University (Number: 2023070601) and were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health.

[0139] 2) After a one-week adaptation period, the mice were randomly divided into three groups (n = 6 mice / group): (1) Normal diet group

[0140] (ND): Fed a standard diet (10 kcal% fat); (2) High-fat diet group (HFD): Fed a high-fat diet (60 kcal% fat); (3) High-fat diet + Lactiplantibacillus plantarum BD7807 (HFD+BD) group:

[0141] Fed a high-fat diet and given a Lactiplantibacillus plantarum BD7807 suspension (0.2 mL / day) by oral gavage.

[0142] The ND group and the HFD group received an equal amount of normal saline (0.2 mL / day).

[0143]

[0144] 3.2 Sample collection​

[0145] At the end of the experimental period, the mice were fasted for 12 hours, then anesthetized with isoflurane for euthanasia, blood was collected from the eyeballs, and the blood was immediately placed in an empty enzyme-free centrifuge tube. After the centrifuge tube containing the blood was left standing at 4 °C for several hours, the centrifuge tube was centrifuged at a speed of 4000 r / min for 1 min to separate the upper-layer serum. The separated serum was collected and stored at -80 °C.

[0146] Colon tissues were collected, and part of them was fixed with 4% paraformaldehyde. The remaining tissues, serum, fresh feces and intestinal samples were stored at -80 °C for subsequent research.

[0147] 3.3 Determination of biochemical indexes

[0148] 1) Detection of antioxidant indexes: The operations were carried out according to the instructions of the kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and the contents of MDA, SOD, CAT and GSH in the serum of mice were analyzed and detected.

[0149] 2) Detection of inflammatory indexes: The operations were carried out according to the instructions of the ELISA kit, and the levels of TNF-α, IL-6, IL-10 and IL-1β in the serum of mice were analyzed and detected. The above kits for detecting inflammatory factors and antioxidant indexes were all purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd.

[0150] The results are as Figure 4 shown in A. The serum MDA level of the mice fed with high-fat diet was significantly higher than that of the ND group, indicating that HFD increased the degree of lipid peroxidation; in the HFD+BD group treated with Lactiplantibacillus plantarum BD7807, the MDA level was significantly lower than that of the HFD group, indicating that Lactiplantibacillus plantarum BD7807 could effectively inhibit the lipid peroxidation caused by HFD.

[0151] The results are as Figure 4 shown in B, 4C and 4D. The levels of antioxidant enzymes (such as SOD, CAT, GSH) in the HFD group were significantly lower than those in the ND group, indicating that HFD might damage the body's antioxidant system; while the levels of SOD, CAT and GSH in the HFD+BD group were significantly higher than those in the HFD group, further confirming that Lactiplantibacillus plantarum BD7807 had a significant antioxidant effect, could significantly increase the levels of SOD, CAT and GSH, and could effectively reduce the intestinal oxidative stress injury caused by HFD.

[0152] The results are as Figure 5As shown, the levels of pro-inflammatory cytokines such as TNF-α, IL-6, and IL-1β in the serum of mice in the HFD group were significantly higher than those in the ND group, while the level of the anti-inflammatory cytokine IL-10 was significantly lower than that in the ND group, indicating that HFD induced an intestinal inflammatory response. In the HFD+BD group of mice treated with Lactiplantibacillus plantarum BD7807 by gavage, the levels of TNF-α, IL-6, and IL-1β in their serum were significantly lower than those in the HFD group only, while the level of IL-10 was significantly higher than that in the HFD group. These findings further supported that Lactiplantibacillus plantarum BD7807 effectively regulated the balance of cytokines, had the ability to regulate intestinal inflammatory responses, and alleviated intestinal inflammatory damage induced by HFD.

[0153] 3) Detection of intestinal permeability-related indicators:

[0154] The intestinal permeability indicators: the concentrations of DAO, D-LA, and LPS were detected using an ELISA kit provided by Shanghai Enzyme-linked Biotechnology Co., Ltd. (Shanghai, China).

[0155] As Figure 6 shown in A, compared with the ND group, the serum D-LA level of mice in the HFD group was significantly increased, indicating that HFD caused damage to the intestinal barrier function and increased intestinal permeability; in the HFD+BD group treated with Lactiplantibacillus plantarum BD7807, the serum D-LA level was significantly lower than that in the HFD group, indicating that Lactiplantibacillus plantarum BD7807 could effectively improve the intestinal barrier function and reduce intestinal permeability.

[0156] As Figure 6 shown in B, the serum LPS level of mice in the HFD group was significantly higher than that in the ND group, which reflected the intestinal flora imbalance and intestinal barrier function damage caused by HFD, enabling more LPS to enter the blood circulation from the intestine; the serum LPS level in the HFD+BD group was significantly lower than that in the HFD group, indicating that BD7807 could alleviate intestinal flora imbalance, improve intestinal barrier function, and reduce LPS translocation.

[0157] As Figure 6 shown in C, the DAO level of mice in the HFD group was significantly higher than that in the ND group. As an enzyme related to intestinal mucosal damage, the increase in its level reflected the damage of HFD to the intestinal mucosa; the serum DAO level in the HFD+BD group was significantly lower than that in the HFD group, indicating that BD7807 could alleviate the intestinal mucosal damage caused by HFD and protect the integrity of the intestinal mucosa.

[0158] In summary, through the determination of biochemical indicators, the positive effect of Lactiplantibacillus plantarum BD7807 in alleviating oxidative stress damage and intestinal inflammation caused by HFD was revealed, and by reducing intestinal permeability, it effectively alleviated systemic chronic low-grade inflammation.

[0159] 3.4 Colonic Pathology Analysis - H&E Staining

[0160] Fresh mouse colonic tissues were cut into samples approximately 1 cm in size, the contents in the colon were removed, and the tissues were immersed in 10% tissue fixative, embedded in paraffin, sectioned into thin slices and stained.

[0161] As Figure 7 shown, through the observation and analysis of colonic mucosal tissues, it can be found that the colonic mucosal structure of the NC group is intact, with regular morphology, tightly arranged glands without defects, and the number and morphology of crypts are at normal levels, without inflammatory cell infiltration, without goblet cell reduction, and no colonic damage is seen; in the HFD group, mucosal layer defects, significant reduction or even disappearance of goblet cell numbers, disordered gland arrangement, abnormal crypt structure, and accompanied by a large number of inflammatory cell infiltrations can be observed; compared with the HFD group, the degree of lesions in the HFD+BD7807 group is significantly reduced, the degree of mucosal damage is lighter, the lesions are mainly limited to the mucosal layer and submucosa, the inflammatory cell infiltration is reduced, the number of goblet cells increases, individual crypts are deformed, and there is a little inflammatory cell infiltration, but no serious changes such as ulcers and bleeding are seen.

[0162] Based on the above results, Lactiplantibacillus plantarum BD7807 has a significant protective effect on colonic damage and chronic inflammation caused by high-fat diet. Lactiplantibacillus plantarum BD7807 can reduce mucosal damage, increase the number of goblet cells, improve gland arrangement and crypt structure, and reduce inflammatory cell infiltration, thereby protecting the integrity and function of the colonic mucosa.

[0163] Example 4 Lactiplantibacillus plantarum BD7807 Enhances the Integrity of the Intestinal Barrier Epithelium

[0164] 4.1 Immunohistochemistry (IHC) Staining

[0165] 1) Fix the colonic tissues in 4% paraformaldehyde solution for 48 h; perform paraffin embedding on the fixed tissues.

[0166] 2) Cut the paraffin-embedded tissues into 4-μm thick sections, and then dewax and hydrate the sections to remove paraffin and rehydrate the tissues.

[0167] 3) Treat the sections with 3% hydrogen peroxide solution at room temperature for 10 minutes to inactivate endogenous peroxidase activity.

[0168] 4) Microwave heat the sections in 0.1 mol / L sodium citrate buffer for 10 min for antigen retrieval; seal with 5% fetal bovine serum at room temperature for 1 h.

[0169] 5) Incubate overnight with goat anti-rabbit-1 (ZO-1) (diluted 1:200; ProSci Biotech, Jiangsu, China) and rabbit anti-mouse Occludin (diluted 1:500, ProSci Biotech, Jiangsu, China) antibodies. After washing with PBS, add HRP-conjugated secondary antibody and incubate at room temperature for 30 min.

[0170] 6) React the sections with HRP substrate 3,3'-diaminobenzidine (DAB) to form color, observe and obtain images under a microscope, and quantitatively analyze the obtained images using ImageJ software to evaluate the expression and distribution of ZO-1 and Occludin proteins.

[0171] The results are as Figure 8 , immunohistochemical analysis showed that compared with the ND group, HFD significantly inhibited the expression and distribution of ZO-1 and Occludin proteins, indicating that HFD caused damage to the integrity of tight junctions in liver tissue and affected the normal function of the liver. However, in HFD mice treated with Lactiplantibacillus plantarum BD7807, the expression levels of ZO-1 and Occludin were significantly upregulated, returning to levels close to those in the ND group, suggesting that BD7807 can effectively restore the decrease in tight junction protein expression caused by HFD and improve the integrity of tight junctions in liver tissue.

[0172] 4.2 Real-time fluorescence quantitative PCR (RT-qPCR)

[0173] 1) Extract total RNA from colon tissue using Trizol reagent (Regen Biotechnology Co., Ltd., Beijing, China).

[0174] 2) Subsequently, transcribe RNA into cDNA using a reverse transcription kit (Novozem Biotech Co., Ltd.) by a conventional method in the prior art.

[0175] 3) Use the SYBR Green RT-qPCR method and a 96-well instrument (Applied Biosystems, USA) to detect the expression of mRNA.

[0176] The primer sequences are shown in Table 4 below. Quantify the gene levels based on the gene level of the internal reference gene β-actin. Then apply the 2 -ΔΔCt -ΔΔCt analysis method to analyze the obtained results.

[0177] Table 4 Primer sequences

[0178] Gene Forward primer (5’-3’) Reverse primer (5’-3’) β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT Zo-1 GAGCAGGCTTTGGAGGAGAC TGGGACAAAAGTCCGGGAAG Occludin CCCGAAGAAAGATGGATCGG TTGGAGGAGTAGGCCATTGG Claudin-1 CAGGTCTCCTCATGGCTTTGC CTTCCGAAAAGAAGGCTGTCC Claudin-2 CAACTGGTGGGCTACATCCTA CCCTTGGAAAAGCCAACCG Claudin-3 CGGCTCTGCTCACCTTAGTA CGGCTCTGCTCACCTTAGTA

[0179] The results are as Figure 9As shown, compared with the ND group, HFD significantly decreased the mRNA expression levels of intestinal tight junction (TJ)-related genes (ZO-1, Occludin, Claudin-1, Claudin-2, and Claudin-3). In contrast, after intragastric administration of Lactiplantibacillus plantarum BD7807, the expression of intestinal TJ-related genes was largely restored, and the expression levels of intestinal TJ-related genes were significantly upregulated compared with the HFD group. The above results indicate that Lactiplantibacillus plantarum BD7807 improves HFD-induced intestinal epithelial barrier dysfunction by regulating the expression of intestinal TJ genes.

[0180] 4.3 Alcian blue staining

[0181] In this study, Alcian blue was used to evaluate intestinal mucosal integrity, and the specific operation steps are as follows:

[0182] 1) Fix the colon tissue specimens in 4% paraformaldehyde solution for 24 hours. After fixation, the tissues are processed by paraffin embedding, and 4-μm-thick sections are cut from the fixed tissues. The sections are then dewaxed and hydrated.

[0183] 2) Then stain the sections with Alcian blue for 20 min. The stained sections are dehydrated successively through ethanol and xylene, and then sealed with neutral resin.

[0184] 3) Observe the sections under a microscope and acquire images. Use ImageJ software to perform quantitative analysis on the obtained images to evaluate the integrity of the mucosal layer and the distribution of mucin.

[0185] The staining results are as Figure 10 shown. In mice with HFD-induced intestinal inflammation, the gel-like mucin on the mucosal surface was significantly reduced, and the mucus layer was replaced by the basophilic layer of the intestinal epithelium. In contrast, in the HFD+BD group of mice treated with Lactiplantibacillus plantarum BD7807, the mucus layer in the mucosal layer was significantly maintained, and the lesions with depleted mucin were significantly reduced.

[0186] In summary, Lactiplantibacillus plantarum BD7807 can effectively promote the expression of intestinal tight junction proteins and mucin, thereby improving the intestinal barrier dysfunction caused by a high-fat diet.

[0187] Example 5 Lactiplantibacillus plantarum BD7807 can regulate the intestinal microbiota composition of HFD-fed mice

[0188] 5.1 Intestinal microbiota composition of mice

[0189] To evaluate the effect of Lactiplantibacillus plantarum BD7807 on the intestinal microbiota composition, the V3-V4 region of the 16S rRNA gene was sequenced, and the specific operation steps are as follows:

[0190] 1) DNA extraction: Total bacterial DNA was extracted from the colonic content samples using a bacterial DNA kit (Omega Bio-Tek, USA) according to the manufacturer's instructions.

[0191] 2) PCR amplification and sequencing: The V3-V4 region of the 16S rRNA gene was amplified by PCR and sequenced. All experimental procedures, including DNA extraction, PCR amplification, and sequencing, were performed by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China).

[0192] 3) Data analysis: The richness and evenness of the gut microbiota were evaluated using the Chao1 index, Ace index, Shannon index, and Simpson index. The differences in the microbial community structure were evaluated using principal coordinate analysis (PCoA) of β-diversity.

[0193] As Figure 11 shown in A, the α-diversity indices of different groups (ND, HFD, HFD+BD), including the Chao1 index, Ace index, Shannon index, and Simpson index, are presented. The results showed no significant differences between groups (labeled "ns"), indicating that the addition of HFD and Lactiplantibacillus plantarum BD7807 did not significantly alter the richness or evenness of the gut microbiota.

[0194] Figure 11 B shows the principal coordinate analysis (PCoA) score plot of β-diversity. The results showed obvious separation between groups, indicating significant differences in the microbial community structure.

[0195] In summary, the addition of Lactiplantibacillus plantarum BD7807 did not significantly alter the richness or evenness (α-diversity) of the gut microbiota, but significantly changed the structure of the microbial community (β-diversity). This finding suggests that Lactiplantibacillus plantarum BD7807 may act by regulating the microbial community structure rather than by altering the diversity of the microbiota. This result demonstrates the important role of Lactiplantibacillus plantarum BD7807 in regulating the gut microbiota and improving gut health.

[0196] 5.2 Changes at the phylum, family, and genus levels among different taxa

[0197] To further investigate the role of Lactiplantibacillus plantarum BD7807 in gut microbiota regulation, the changes at the phylum, family, and genus levels among different taxa were studied.

[0198] Figure 12AShows the microbial community composition at the phylum level in different treatment groups (ND, HFD, HFD+BD). Firmicutes and Bacteroidota are the dominant phyla in the mouse gut microbiota. The abundance of Bacteroidota in the HFD group increased significantly, while this trend was reversed after adding Lactiplantibacillus plantarum BD7807 (P<0.01), indicating that Lactiplantibacillus plantarum BD7807 helps restore the balance of the gut microbial community. In addition, HFD feeding led to an increase in the Firmicutes / Bacteroidota ratio, while adding Lactiplantibacillus plantarum BD7807 significantly decreased this ratio.

[0199] Figure 12B Shows the microbial community composition at the family level in different treatment groups (ND, HFD, HFD+BD). The abundance of Erysipelotrichaceae in mice fed with HFD increased significantly. In contrast, adding Lactiplantibacillus plantarum BD7807 significantly inhibited the proliferation of Erysipelotrichaceae, indicating that BD7807 may improve gut health by inhibiting the proliferation of Erysipelotrichaceae.

[0200] Figure 12C Shows the microbial community composition at the genus level in different treatment groups (ND, HFD, HFD+BD). HFD intake significantly increased the abundance of Faecalibaculum and decreased the abundance of lactic acid bacteria (such as Lactobacillus). The intervention of Lactiplantibacillus plantarum BD7807 promoted the growth of the genus Lactobacillus and inhibited the proliferation of Faecalibaculum (P<0.05), indicating that Lactiplantibacillus plantarum BD7807 helps increase the abundance of beneficial bacteria and inhibit harmful bacteria.

[0201] In summary, Lactiplantibacillus plantarum BD7807 can effectively regulate the gut microbiota composition of HFD-fed mice, increase the abundance of gut beneficial bacteria (such as lactic acid bacteria) and inhibit the proliferation of harmful bacteria (such as Faecalibaculum and Erysipelotrichaceae), thus maintaining the healthy state of the gut microenvironment.

[0202] The above embodiments are intended to illustrate the implementation of the present invention and should not be construed as limiting the present invention. In addition, various modifications listed herein and changes in the methods of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of Lactiplantibacillus plantarum BD7807 with a preservation number of CGMCC NO.33630 in the preparation of a product for treating intestinal barrier dysfunction.

2. The use according to claim 1, characterized in that The intestinal barrier dysfunction is intestinal barrier dysfunction induced by a high-fat diet.

3. The use according to claim 1, characterized in that The product for treating lipid metabolism disorders has any one or more of the following effects: 1) Maintain the balance of intestinal flora; 2) Enhance intestinal barrier function; 3) Repair intestinal barrier damage; 4) Regulate immune response; 5) Improve the structure and function of the intestinal barrier.

4. The use according to claim 3, characterized in that Maintaining the balance of intestinal flora includes increasing the diversity of intestinal microorganisms, improving the abundance of beneficial intestinal bacteria and / or reducing the abundance of harmful intestinal bacteria; preferably, the microbial diversity includes α diversity and / or β diversity.

5. The use according to claim 3, wherein the enhancement of intestinal barrier function is to reduce intestinal cell permeability; preferably, the reduction of intestinal cell permeability includes inhibiting the increase of D-LA, DAO and / or LPS levels in the blood.

6. The use according to claim 3, wherein the repairing of intestinal barrier damage comprises inhibiting the decrease of the transepithelial electrical resistance of intestinal cells, inhibiting the increase of FITC-dextran influx in intestinal cells and / or inhibiting the increase of ALP activity in intestinal cells.

7. The use according to claim 3, wherein the regulating immune response is to reduce the concentration of pro-inflammatory factors and / or increase the concentration of anti-inflammatory factors; preferably, the pro-inflammatory factors are TNF-α, IL-6 and / or IL-1β; preferably, the anti-inflammatory factor is IL-10.

8. The use according to claim 3, wherein improving the structure and function of the intestinal barrier comprises restoring the expression of intestinal TJ-related genes or reducing oxidative stress; preferably, the intestinal TJ-related genes are selected from one or more of ZO-1, Occludin, Claudin-1, Claudin-2 or Claudin-3; preferably, reducing oxidative stress comprises reducing the content of SOD, CAT or GSH and / or increasing the content of MDA.

9. A product for treating intestinal barrier dysfunction, characterized in that: The product contains the Lactobacillus plantarum BD7807 described in claim 1.

10. The product according to claim 9, characterized in that The number of viable bacteria in the product is 1×10 8 ~1×10 10 cfu / mL.

Images