Saccharomyces cerevisiae strain for de novo synthesis of fucoxanthine precursor neoxanthine and application of saccharomyces cerevisiae strain

Abstract

The invention discloses a saccharomyces cerevisiae strain for de novo synthesis of fucoxanthine precursor neoxanthine and application of the saccharomyces cerevisiae strain, and belongs to the technical field of biology. According to the recombinant saccharomyces cerevisiae disclosed by the invention, the 3-hydroxy-3-methylglutaryl coenzyme A reductase, the isopentenyl pyrophosphate isomerase, the farnesyl pyrophosphate synthase and the endoplasmic reticulum size regulation factor are expressed in an enhanced manner; according to the method, geranyl geranyl diphosphate synthase, phytoene dehydrogenase, 15-cis-phytoene synthase, bifunctional lycopene cyclase / phytoene synthase, beta-carotene hydroxylase, zeaxanthin epoxidase truncated mutant and violaxanthin deep oxidase-like protein are subjected to heterologous expression, so that the zeaxanthin deep oxidase-like protein is obtained; the ROX1 and GAL80 genes in the saccharomyces cerevisiae are knocked out, and the expression of squalene synthase ERG9 is down-regulated. When the strain is subjected to shake flask fermentation, the contents of neoxanthine and violaxanthin of the strain respectively reach 1.78 mg / L and 26.77 mg / L, so that the strain has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to a Saccharomyces cerevisiae strain for de novo synthesis of neoxanthin, a fucoxanthin precursor, and its application, belonging to the field of biotechnology. Background Art

[0002] Saccharomyces cerevisiae is a commonly used generally recognized as safe (GRAS) model microorganism and food safety strain in the fermentation industry, with many advantages such as clear genetic background, convenient gene manipulation, simple nutritional requirements, and strong production robustness. Its endogenous mevalonate (MVA) pathway can provide precursors for the synthesis of terpenoids, so Saccharomyces cerevisiae is an excellent platform for the heterologous production of many high-value terpenoids.

[0003] Fucoxanthin is an oxygenated tetraterpenoid carotenoid with characteristic groups such as hydroxyl, epoxy, and allene bonds, and plays a key role in antioxidant, anti-photodamage, anti-obesity, anti-cancer, anti-diabetes, anti-inflammatory and other aspects. Neoxanthin is a key precursor in the fucoxanthin synthesis pathway and has functions such as antioxidant, anti-cancer, and induction of apoptosis. The industrial production of fucoxanthin and neoxanthin mainly relies on extraction from marine plants such as brown algae, facing limitations such as low extraction content, high production cost, serious seasonal and regional restrictions, and cannot meet the international market demand. However, the existing research work has not yet achieved de novo heterologous synthesis of fucoxanthin, and the heterologous synthesis of neoxanthin has only achieved microgram-level synthesis in Escherichia coli by introducing a heterologous synthesis pathway. This indicates that engineering different microbial chassis to synthesize neoxanthin and improve its yield has important application potential for the heterologous high-efficiency production of neoxanthin and fucoxanthin. However, since neoxanthin synthase has chloroplast localization in natural hosts such as plants and algae, it is not clear whether it can be highly expressed in Saccharomyces cerevisiae. Therefore, the discovery, identification, and application of key step catalytic enzymes are a major challenge in existing research. Summary of the Invention

[0004] To solve the above problems, the present invention explores the key enzymes for neoxanthin synthesis in Saccharomyces cerevisiae and realizes the heterologous synthesis of neoxanthin, providing a recombinant Saccharomyces cerevisiae strain. The recombinant Saccharomyces cerevisiae, through gene recombination, strongly expresses truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2; and heterologously expresses geranylgeranyl diphosphate synthase CrtE from Taxus x media, phytoene dehydrogenase CrtI from Blakeslea trispora, 15-cis-phytoene synthase CrtB from Pantoea agglomerans, bifunctional lycopene cyclase / phytoene synthase CrtYB from Phaffia rhodozyma, β-carotene hydroxylase CrtZ from Pantoea ananatis, truncated mutant t24ZEP of zeaxanthin epoxidase from Vitis vinifera, and violaxanthin deepoxidase-like protein mutant t19VDL1-SV40 from Phaeodactylum tricornutum; simultaneously knocks out the transcriptional repressor ROX1 of ergosterol biosynthesis (ERG) genes and the galactose / lactose metabolism regulator GAL80; and down-regulates the expression of squalene synthase ERG9. The genetically engineered Saccharomyces cerevisiae of the present invention can not only efficiently produce neoxanthin, but also achieve extracellular secretion expression, simplifying the subsequent purification process.

[0005] The first object of the present invention is to provide a recombinant Saccharomyces cerevisiae, which includes the following modifications: overexpressing truncated 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis-phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ, and truncated mutant t24ZEP of zeaxanthin epoxidase, introducing a violaxanthin deepoxidase-like protein expression cassette, knocking out the transcriptional repressor ROX1 and the galactose / lactose metabolism regulator GAL80, and weakly expressing squalene synthase ERG9; wherein,

[0006] the β-carotene hydroxylase CrtZ is derived from Pantoea ananatis or Brevundimonas vesicularis,

[0007] the amino acid sequence of the truncated mutant t24ZEP of zeaxanthin epoxidase is as shown in SEQ ID NO.8,

[0008] The violaxanthin deepoxidase-like protein expression cassette contains one or more of the following:

[0009] (1) Violaxanthin deepoxidase-like protein or violaxanthin deepoxidase-like protein with its own localization signal peptide deleted;

[0010] (2) Violaxanthin deepoxidase-like protein fused with a maltose-binding protein tag, or violaxanthin deepoxidase-like protein with its own localization signal peptide deleted and fused with a maltose-binding protein tag;

[0011] (3) Violaxanthin deepoxidase-like protein fused with a nuclear localization signal peptide, or violaxanthin deepoxidase-like protein with its own localization signal peptide deleted and fused with a nuclear localization signal peptide.

[0012] Furthermore, it contains at least one of the following:

[0013] (1) The Gene ID of the 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 is 42650, the Gene ID of the isopentenyl pyrophosphate isomerase IDI1 is 855986, the Gene ID of the farnesyl pyrophosphate synthase ERG20 is 853272, the Gene ID of the endoplasmic reticulum size regulator INO2 is 851701, the Gene ID of the geranylgeranyl diphosphate synthase CrtE is 45505274, the Gene ID of the phytoene desaturase CrtI is 37729024, the Gene ID of the 15-cis-phytoene synthase CrtB is 429485116, the GenBank number of the bifunctional lycopene cyclase / phytoene synthase CrtYB is ALK24266.1, the Gene ID of the transcriptional repressor ROX1 is 856178, the Gene ID of the galactose / lactose metabolism regulatory protein GAL80 is 854954, and the Gene ID of the squalene synthase ERG9 is 856597;

[0014] (2) The GenBank number of the β-carotene hydroxylase CrtZ derived from Pantoea ananatis is CRH37458.1; the GenBank number of the β-carotene hydroxylase CrtZ derived from Brevundimonas vesicularis is ABC50108.1;

[0015] (3) The Gene ID of the violaxanthin deepoxidase-like protein is 7201244;

[0016] (4) The violaxanthin deepoxidase-like protein with its own targeting signal peptide deleted comprises the sequence shown in SEQ ID NO.4 (the optimal sequence for removing the signal peptide screened and verified by the present invention);

[0017] (5) The maltose-binding protein tag comprises the MBP tag;

[0018] (6) The nuclear localization signal peptide comprises SV40.

[0019] Further, the nucleotide sequence of SV40 is as shown in SEQ ID NO.5, and the nucleotide sequence of the MBP tag is as shown in SEQ ID NO.6.

[0020] Further, it contains at least one of the following:

[0021] (1) The maltose-binding protein tag is fused to the N-terminus of the violaxanthin deepoxidase-like protein or the violaxanthin deepoxidase-like protein with its own targeting signal peptide deleted;

[0022] (2) The nuclear localization signal peptide is fused to the C-terminus of the violaxanthin deepoxidase-like protein or the violaxanthin deepoxidase-like protein with its own targeting signal peptide deleted;

[0023] (3) The maltose-binding protein tag is connected by a linking sequence or directly connected;

[0024] (4) The nuclear localization signal peptide is connected by a linking sequence or directly connected.

[0025] Further, the linking sequence can be any sequence capable of connecting nucleotides, such as the sequence shown in SEQ ID NO.7.

[0026] Further, it contains at least one of the following:

[0027] (1) The overexpression method includes genomic integration and / or replacement of the original promoter on the genome (with a stronger promoter);

[0028] (2) The weakening expression includes replacement of the original promoter on the genome (with a weaker promoter).

[0029] Further, it contains at least one of the following:

[0030] (1) The overexpression includes integrating the encoding genes of 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis-phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ or truncated mutant of zeaxanthin epoxidase t24ZEP into the genome;

[0031] (2) The overexpression includes replacing the promoter before the encoding gene of farnesyl diphosphate synthase ERG20 or endoplasmic reticulum size regulator INO2 in the genome with a strong promoter (the strong promoter is a promoter with higher expression intensity than the original promoter);

[0032] (3) The weakening expression includes replacing the promoter before the encoding gene of squalene synthase ERG9 in the genome with a weak promoter (the weak promoter is a promoter with lower expression intensity than the original promoter).

[0033] Furthermore, it contains at least one of the following:

[0034] (1) The integration sites in the genome include one or several of ROX1 site, ERG20 site, 911b site, INO2 site (in actual operation, it can be integrated into the promoter region upstream of INO2 or directly replace the INO2 gene expression frame), 308a site, 416d site, 1014a site, ERG9 site (in actual operation, it can be integrated into the promoter region upstream of ERG9 or directly replace the ERG9 gene expression frame), 1309a site, 208a site, 1622b site, YPRCδ15c site;

[0035] (2) Integrating at least one copy of the overexpression gene or expression frame into the genome.

[0036] Furthermore, it contains at least one of the following:

[0037] (1) Integrating the encoding gene of 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 at the ROX1 site and / or ERG20 site;

[0038] (2) Integrating the encoding gene of isopentenyl pyrophosphate isomerase IDI1 at the 911b site;

[0039] (3) Integrating the encoding gene of geranylgeranyl diphosphate synthase CrtE at at least one of the 308a site, 416d site, 1014a site;

[0040] (4) Integrate the gene encoding phytoene desaturase CrtI at at least one of the sites of 308a, 416d, and 1014a;

[0041] (5) Integrate the gene encoding 15-cis-phytoene synthase CrtB upstream of the ERG9 locus;

[0042] (6) Integrate the gene encoding bifunctional lycopene cyclase / phytoene synthase CrtYB at the 1309a locus;

[0043] (7) Integrate the gene encoding β-carotene hydroxylase CrtZ at the 208a locus;

[0044] (8) Integrate the gene encoding zeaxanthin epoxidase truncated mutant t24ZEP at the 1622b locus;

[0045] (9) Integrate the expression cassette of violaxanthin de-epoxidase-like protein at the YPRCδ15c locus;

[0046] (10) Replace the promoter of farnesyl pyrophosphate synthase ERG20 on the genome with the P TEF1 promoter;

[0047] (11) Replace the promoter of endoplasmic reticulum size regulator INO2 on the genome with the P PGK1 promoter;

[0048] (12) Replace the promoter of squalene synthase ERG9 on the genome with the P HXT1 promoter.

[0049] Furthermore, it contains at least one of the following:

[0050] (1) Express 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 using the P GPD promoter;

[0051] (2) Express isopentenyl pyrophosphate isomerase IDI1 using the P TEF1 promoter;

[0052] (3) Express 15-cis-phytoene synthase CrtB using the P TEF1 promoter;

[0053] (4) Express phytoene desaturase CrtI and geranylgeranyl diphosphate synthase CrtE using the P GAL1,10 bidirectional promoter;

[0054] (5) Express bifunctional lycopene cyclase / phytoene synthase CrtYB using the P GAL7 promoter;

[0055] (6) Use promoter P GAL7 to express β-carotene hydroxylase CrtZ;

[0056] (7) Use promoter P GAL7 to express truncated mutant t24ZEP of zeaxanthin epoxidase;

[0057] (8) The violaxanthin deepoxidase-like protein expression cassette contains promoter P GAL7 promoter.

[0058] Furthermore, the recombinant Saccharomyces cerevisiae uses the modified or unmodified Saccharomyces cerevisiae as the starting strain; the starting strain includes Saccharomyces cerevisiae BY4741.

[0059] The second object of the present invention is to provide the use of the recombinant Saccharomyces cerevisiae in the preparation of zeaxanthin, violaxanthin or neoxanthin.

[0060] Furthermore, glucose is used as the substrate for synthesis.

[0061] The third object of the present invention is to provide a method for producing zeaxanthin, violaxanthin or neoxanthin, including the step of fermenting and producing using the recombinant Saccharomyces cerevisiae.

[0062] Furthermore, the fermentation includes shake flask fermentation or fed-batch fermentation.

[0063] Furthermore, the fermentation includes the following steps: inoculating the recombinant Saccharomyces cerevisiae into a seed medium to obtain a seed liquid, and inoculating the seed liquid into a fermentation medium for fermentation.

[0064] Furthermore, it is cultured at 28-32 °C and 180-280 rpm.

[0065] Furthermore, the inoculation amount of the seed liquid is 1-10% (v / v).

[0066] Furthermore, the seed medium contains the following components: uracil 10-500 mg / L, amino acid-free yeast nitrogen source 1-10 g / L, anhydrous glucose 15-25 g / L.

[0067] Furthermore, the fermentation medium contains the following components: tryptone 15-25 g / L, anhydrous glucose 15-25 g / L, yeast extract 5-15 g / L.

[0068] The beneficial effects of the present invention:

[0069] The present invention provides a recombinant Saccharomyces cerevisiae, which overexpresses truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, and endoplasmic reticulum size regulator INO2 through gene recombination, and heterologously expresses geranylgeranyl diphosphate synthase CrtE from Taxus x media, phytoene dehydrogenase CrtI from Blakeslea trispora, 15-cis-phytoene synthase CrtB from Pantoea agglomerans, bifunctional lycopene cyclase / phytoene synthase CrtYB from Phaffia rhodozyma, β-carotene hydroxylase CrtZ from Pantoea ananatis, truncated mutant t24ZEP of zeaxanthin epoxidase from Vitis vinifera, and mutant t19VDL1-SV40 of violaxanthin de-epoxidase-like protein from Phaeodactylum tricornutum. At the same time, the transcriptional repressor ROX1 of ergosterol biosynthesis (ERG) genes and the galactose / lactose metabolism regulator GAL80 are knocked out; and the expression of squalene synthase ERG9 is down-regulated. This strain can heterologously synthesize neoxanthin, a key precursor of fucoxanthin. When it is used for 250 mL shake flask fermentation, the yield of neoxanthin reaches 1.78 mg / L. The recombinant strain constructed by the present invention realizes the heterologous synthesis of neoxanthin in the yeast chassis and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 It is the proportional distribution of violaxanthin in different organelles in recombinant Saccharomyces cerevisiae YF02.

[0071] Figure 2 It is the zeaxanthin yield (mg / L) of recombinant Saccharomyces cerevisiae YF01 and the biomass (OD 600 ) after the reaction ends.

[0072] Figure 3 It is the violaxanthin yield (mg / L) of recombinant Saccharomyces cerevisiae YF02 and the biomass (OD 600 ) after the reaction ends.

[0073] Figure 4 It is the violaxanthin and neoxanthin yields (mg / L) of recombinant Saccharomyces cerevisiae YF03 - YF17. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0074] The present invention will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.

[0075] The solution involved in the present invention is as follows:

[0076] The present invention provides a method for constructing a recombinant Saccharomyces cerevisiae, and the method comprises the following steps:

[0077] (1) Knock out the gene encoding ROX1 enzyme on the genome of BY4741, and integrate the P GPD -tHMG1-T ADH1 fragment into the genome of BY4741 (i.e., the ROX1 enzyme locus on the genome) to construct BY4741ΔROX1-P GPD -tHMG1-T ADH1 , named Saccharomyces cerevisiae Y1;

[0078] (2) Integrate the P TEF1 -IDI1-T CYC1 fragment into the genome of strain Y1 (integrate it into the 911b locus, which is located on chromosome 9 and the guiding sequence is GTAATATTGTCTTGTTTCCC) to construct the Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 , named Saccharomyces cerevisiae Y2;

[0079] (3) Integrate the P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 fragment into the genome of strain Y2 (integrate it into the ERG20 locus, and the Gene ID of the ERG20 locus is 853272) to construct the Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 , named Saccharomyces cerevisiae Y3;

[0080] (4) Integrate the P PGK1 -INO2-T INO2 fragment into the genome of strain Y3 (integrate it into the INO2 locus, and the Gene ID of the INO2 locus is 851701) to construct the Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1-911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 , named as Saccharomyces cerevisiae Y4;

[0081] (5) Integrate P TEF1 -CrtB-T CYC1 -P HXT1 into the genome of strain Y4 to replace the natural promoter of ERG9 (integrated upstream of the ERG9 locus, the Gene ID of the ERG9 locus is 856597), and construct the Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 , named as Saccharomyces cerevisiae Y4L1;

[0082] (6) Integrate T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 into the genome of strain Y4L1 (integrated at the 308a locus, which is located on chromosome 3, and the guiding sequence is CACTTGTCAAACAGAATATA), and construct the Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L2;

[0083] (7) Knock out the gene encoding GAL80 enzyme on the genome of Y4L2 to construct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L3;

[0084] (8) Integrate T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 into the genome of Y4L3 strain (integrated into locus 416d, which is located on chromosome 4 and the guiding sequence is TAGTGCACTTACCCCACGTT) to construct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10-CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L4;

[0085] (9) Integrate P GAL7 -CrtYB-T CYC1 into the genome of strain Y4L4 (integrated at locus 1309a, which is located on chromosome 13, and the guiding sequence is CCTGTGGTGACTACGTATCC), and construct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 , named Saccharomyces cerevisiae Y4C;

[0086] (10) Integrate T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 into the genome of strain Y4C (integrated at locus 1014a, which is located on chromosome 10, and the guiding sequence is TTATGTGCGTATTGCTTTCA), and construct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -PHXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y5C;

[0087] (11) Integrate P GAL7 -CrtZ-T CYC1 into the genome of strain Y5C (integrated at locus 208a, which is located on chromosome 2 and has a guiding sequence of GTCCGCTAAACAAAAGATCT), and construct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -P GAL7 -CrtZ-T CYC1 , named Saccharomyces cerevisiae YF01;

[0088] (12) Integrate P GAL7 -t24ZEP-T CYC1The fragment was integrated into the genome of strain YF01 (integrated at the 1622b locus, which is located on chromosome 16 and has a guiding sequence of TAAAGCCACCACATCGCAAA), and the Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -P GAL7 -CrtZ-T CYC1 -P GAL7 -t24ZEP-T CYC1 , named Saccharomyces cerevisiae YF02;

[0089] (13) Integrate the P GAL7 -t19VDL1-SV40-T CYC1 fragment into the genome of strain YF02 (integrated at the YPRCδ15c locus, which is located on chromosome 16 and has a guiding sequence of AATCCGAACAACAGAGCATA), and construct the Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -911b-P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -P GAL7 -CrtZ-T CYC1 -P GAL7 -t24ZEP-T CYC1 -P GAL7 -t19VDL1-SV40-T CYC1 , named Saccharomyces cerevisiae YF15.

[0090] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is obtained by gene recombination: integrating 3-hydroxy-3-methylglutaryl coenzyme A reductase tHMG1 into the ROX1 enzyme site on the Saccharomyces cerevisiae genome; and integrating it into the ERG20 site on the Saccharomyces cerevisiae genome, and the Gene ID of the ERG20 site is 853272;

[0091] Integrating isopentenyl pyrophosphate isomerase IDI1 into the 911b site on the Saccharomyces cerevisiae genome, which is located on chromosome 9, and the guiding sequence is GTAATATTGTCTTGTTTCCC;

[0092] Integrating P TEF1 Promoter-enhanced expression of farnesyl pyrophosphate synthase ERG20 into the ERG20 site on the Saccharomyces cerevisiae genome;

[0093] Replacing the natural promoter of the endoplasmic reticulum size regulator INO2 on the Saccharomyces cerevisiae genome with P PGK1 Promoter, and the Gene ID of the INO2 site is 851701;

[0094] Integrating geranylgeranyl diphosphate synthase CrtE derived from Taxus x media into the 308a, 416d, and 1014a sites on the Saccharomyces cerevisiae genome respectively; the 308a site is located on chromosome 3, and the guiding sequence is CACTTGTCAAACAGAATATA; the 416d site is located on chromosome 4, and the guiding sequence is TAGTGCACTTACCCCACGTT; the 1014a site is located on chromosome 10, and the guiding sequence is TTATGTGCGTATTGCTTTCA;

[0095] Integrate the phytoene desaturase CrtI from Blakeslea trispora into the 308a, 416d, and 1014a loci on the genome of Saccharomyces cerevisiae; the 308a locus is on chromosome 3, and the guiding sequence is CACTTGTCAAACAGAATATA; the 416d locus is on chromosome 4, and the guiding sequence is TAGTGCACTTACCCCACGTT; the 1014a locus is on chromosome 10, and the guiding sequence is TTATGTGCGTATTGCTTTCA;

[0096] Integrate the 15-cis-phytoene synthase CrtB from Pantoea agglomerans into the P ERG9 locus on the genome of Saccharomyces cerevisiae, and the Gene ID of the ERG9 locus is 856597;

[0097] Integrate the bifunctional lycopene cyclase / phytoene synthase CrtYB from Phaffia rhodozyma into the 1309a locus on the genome of Saccharomyces cerevisiae. This locus is on chromosome 13, and the guiding sequence is CCTGTGGTGACTACGTATCC;

[0098] Integrate the β-carotene hydroxylase CrtZ from Erwinia uredovora into the 208a locus on the genome of Saccharomyces cerevisiae. This locus is on chromosome 2, and the guiding sequence is GTCCGCTAAACAAAAGATCT;

[0099] Integrate the truncated mutant t24ZEP of zeaxanthin epoxidase from Vitis vinifera into the 1622b locus on the genome of Saccharomyces cerevisiae. This locus is on chromosome 16, and the guiding sequence is TAAAGCCACCACATCGCAAA;

[0100] Integrate the violaxanthin deepoxidase-like protein mutant t19VDL1-SV40 from Phaeodactylum tricornutum into the YPRCδ15c locus on the genome of Saccharomyces cerevisiae. This locus is on chromosome 16, and the guiding sequence is AATCCGAACAACAGAGCATA;

[0101] Meanwhile, knockout the transcriptional repressors ROX1 of the ergosterol biosynthesis (ERG) gene and the galactose / lactose metabolism regulatory protein GAL80; and by replacing the native promoter P ERG9 of ERG9 with P HXT1 promoter, down-regulate the expression of squalene synthase ERG9.

[0102] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae enhances the expression of tHMG1 through the P GPD promoter, enhances the expression of INO2 through the P PGK1 promoter, enhances the expression of ERG20 and IDI1 and heterologously expresses CrtB through the P TEF1 promoter, heterologously expresses CrtI and CrtE through the P GAL1,10 bidirectional promoter, and heterologously expresses CrtYB, CrtZ, t24ZEP and t19VDL1-SV40 through the P GAL7 promoter.

[0103] In one embodiment of the present invention, 2 copies of tHMG1, 1 copy of IDI1, 1 copy of ERG20 are enhancedly expressed on the genome of Saccharomyces cerevisiae BY4741, and 1 copy of INO2 is enhancedly expressed; 3 copies of CrtE, 3 copies of CrtI, 1 copy of CrtB, 1 copy of CrtYB, 1 copy of CrtZ, 1 copy of t24ZEP, and 1 copy of t19VDL1-SV40 are heterologously expressed on the genome of Saccharomyces cerevisiae BY4741.

[0104] The materials and methods involved in the following examples are as follows:

[0105] (1) Sequences:

[0106] The amino acid sequence of t19VDL1 is shown in SEQ ID NO.4, the nucleotide sequence of the nuclear localization tag SV40 is shown in SEQ ID NO.5, the nucleotide sequence of the maltose binding protein tag MBP is shown in SEQ ID NO.6, and the nucleotide sequence of the linker Linker is shown in SEQ ID NO.7.

[0107] (2) Primer sequences:

[0108] Table 1 Primer sequences

[0109]

[0110]

[0111]

[0112] (3) Strains:

[0113] The BY4741 strain involved in the following examples was purchased from Beijing Huayueyang Biotechnology.

[0114] (4) Media:

[0115] LB liquid medium: containing 10 g of tryptone, 10 g of NaCl and 5 g of yeast extract per liter.

[0116] SD-His medium: containing 50 mg of uracil, 50 mg of tryptophan, 50 mg of leucine, 6.7 g of amino acid-free yeast nitrogen source, and 20 g of anhydrous glucose per liter.

[0117] SD-His-Leu medium: containing 50 mg of uracil, 50 mg of tryptophan, 6.7 g of amino acid-free yeast nitrogen source, and 20 g of anhydrous glucose per liter.

[0118] SD-His-Leu-Trp medium: containing 50 mg of uracil, 6.7 g of amino acid-free yeast nitrogen source, and 20 g of anhydrous glucose per liter.

[0119] SD-Ura plate: 6.7 g / L of YNB medium, 20 g / L of glucose, 50 mg / L of L-tryptophan, 50 mg / L of L-leucine, 50 mg / L of L-histidine, and 20 g / L of agar powder.

[0120] SD-His plate: 6.7 g / L of YNB medium, 20 g / L of glucose, 50 mg / L of L-tryptophan, 50 mg / L of L-leucine, 50 mg / L of uracil, and 20 g / L of agar powder.

[0121] SD-His-Leu plate: 6.7 g / L of YNB medium, 20 g / L of glucose, 50 mg / L of L-tryptophan, 50 mg / L of uracil, and 20 g / L of agar powder.

[0122] SD-His-Leu-Trp plate: 6.7 g / L of YNB medium, 20 g / L of glucose, 50 mg / L of uracil, and 20 g / L of agar powder.

[0123] YPD solid plate: 1% yeast powder, 2% peptone, 2% glucose, 1.5% agar powder.

[0124] YPD medium: containing 20 g of tryptone, 20 g of anhydrous glucose, and 10 g of yeast extract per liter.

[0125] (5) Detection of zeaxanthin, violaxanthin and neoxanthin contents:

[0126] 500 μL of the fermented bacterial liquid was taken and added to a crushing tube, and an equal volume of ethyl acetate was added as the extraction phase. Glass beads were used to grind and break the cells. After centrifugation, the upper layer of ethyl acetate was aspirated, appropriately diluted with pure acetonitrile, filtered through a filter membrane, and then introduced into a liquid phase bottle. An Agilent 1260 high-performance liquid chromatography (HPLC) instrument and an Agilent ZORBAX EclipsePlus C18 chromatographic column (4.6×250 mm, 5 μm) were used to detect the yields of zeaxanthin, violaxanthin, and neoxanthin at a wavelength of 440 nm using a gradient elution program. The elution program is shown in Table 2:

[0127] Table 2: Gradient system program

[0128] Time (min) Mobile Phase A (%) Mobile Phase B (%) Mobile Phase C (%) 0 100 0 0 20 100 0 0 22 0 100 0 45 0 100 0 50 0 10 90 65 0 10 90 70 100 0 0 75 100 0 0

[0129] Mobile phase A consisted of 73% HPLC-grade acetonitrile and 27% ultrapure water, mobile phase B consisted of 80% HPLC-grade acetonitrile and 20% ultrapure water, and mobile phase C consisted of 60% HPLC-grade methanol and 40% HPLC-grade isopropanol. After filtration by suction filtration, HPLC detection was carried out. The HPLC conditions were as follows: Agilent 1260 was used for high-performance liquid chromatography detection, the chromatographic column was Agilent ZORBAX Eclipse Plus C18 (4.6×250 mm, 5 μm), the detection column temperature was 25 °C, and the flow rate was 1.4 mL·min -1 , the wavelength was 440 nm, and the injection volume was 20 μL.

[0130] (6) Detection method for recombinant Saccharomyces cerevisiae OD 600 :

[0131] The yeast seed liquid cultured for 16 - 24 h was inoculated into a 250 mL shaking flask containing 25 mL of YPD medium at an inoculation amount of 1%, and cultured at 30 °C and 220 rpm. When sampling, it was appropriately diluted and then the OD was measured using an ultraviolet spectrophotometer 600 .

[0132] The construction of the plasmids involved in the following examples was carried out in E. coli JM109. After the plasmid construction was completed, it was used as a template to amplify the expression cassette. At the same time, the homologous arms upstream and downstream of the integration site and the auxotrophic marker containing LoxP sites at both ends were amplified and transformed into the chassis strain for engineering transformation.

[0133] Example 1: Construction of Saccharomyces cerevisiae strain Y1

[0134] The specific steps are as follows:

[0135] (1) Synthesis of fragments:

[0136] The gene fragment P GPD -tHMG1-TADH1 (The sequence is recorded in the invention patent with the publication number: CN 113684141A);

[0137] Using the Saccharomyces cerevisiae BY4741 genome as a template, the gene fragment ROX1-UP was amplified with primers ROX1-UP-F and ROX1-UP-R;

[0138] The gene fragment ROX1-DOWN was amplified with primers ROX1-DOWN-F and ROX1-DOWN-R;

[0139] Using the plasmid pMHyLp-His (the sequence is recorded in the invention patent with the publication number: CN 113684141A) as a template, the ROX1-His fragment was amplified with primers ROX1-loxH-F and ROX1-loxH-R.

[0140] (2) Fuse the four fragments P GPD -tHMG1-T ADH1 , ROX1-UP, ROX1-DOWN, and ROX1-His by fusion PCR using PCR, and recover the correct band by gel cutting after running the gel to obtain the fusion gene fragment ΔROX1-P GPD -tHMG1-T ADH1 .

[0141] (3) Transform the fusion gene fragment in step (2) into the competent cells of Saccharomyces cerevisiae BY4741 strain, culture it on an SD-His plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-tHMG1-F and YZ-tHMG1-R. Select the single colony with the correct band to obtain the strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -His.

[0142] (4) Prepare the competent cells from the strain obtained in step (3), transform it with the plasmid pY26-Cre (the sequence is recorded in the invention patent with the publication number: CN 113684141A), culture it on an SD-Ura plate at 30 °C for 2-3 days, pick a single colony and inoculate it into YPD medium for 15-24 h, then streak it on a YPD plate containing 5-FOA at a concentration of 1 mg / mL and culture it at 30 °C for 2-3 days. Spot the single colonies grown on SD-Ura, SD-His, and YPD solid plates respectively for verification. The single colony that grows only on the YPD medium is the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 , named Saccharomyces cerevisiae Y1.

[0143] Example 2: Construction of Saccharomyces cerevisiae strain Y2

[0144] (1) Artificially synthesize gene fragment P TEF1 -IDI1-T CYC1 (The sequence is recorded in the invention patent with the publication number: CN 113684141A, namely "P TEF1 -IDI-T CYC1 ");

[0145] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment 911b-UP with primers 911b-UP-F and 911b-UP-R;

[0146] Amplify the gene fragment 911b-DOWN with primers 911b-DOWN-F and 911b-DOWN-R;

[0147] Using the plasmid pMHyLp-His as a template, amplify the IDI1-His fragment with primers IDI1-loxH-F and IDI1-loxH-R.

[0148] (2) Perform fusion PCR on the four fragments P TEF1 -IDI1-T CYC1 , 911b-UP, 911b-DOWN, and IDI1-His by PCR. After gel electrophoresis, cut and recover the correct band to obtain the fusion gene fragment 911b-P TEF1 -IDI1-T CYC1 containing the 911b upstream and downstream homologous arms.

[0149] (3) Transform the gene fragment in step (2) into the competent cells of the Y1 strain prepared in Example 1, culture on an SD-His plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-IDI1-F and YZ-IDI1-R. Select the single colony with the correct band to obtain the strain Y1-P TEF1 -IDI1-T CYC1 -His.

[0150] (4) Prepare the strain obtained in step (3) into competent cells, transform it into the pY26-Cre plasmid, culture it on an SD-Ura plate at 30 °C for 2 - 3 days, pick a single colony and inoculate it into YPD medium for 15 - 24 h, then streak it on a YPD plate containing 5-FOA at a concentration of 1 mg / mL and culture it at 30 °C for 2 - 3 days. Spot plate and verify the single colonies grown on SD-Ura, SD-His, and YPD solid plates respectively. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 , named as Saccharomyces cerevisiae Y2.

[0151] Example 3: Construct Saccharomyces cerevisiae strain Y3

[0152] The specific steps are as follows:

[0153] (1) Artificially synthesize the gene fragment P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 (The sequence is recorded in the invention patent with the publication number: CN 113684141 A);

[0154] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment ERG20-UP with primers ERG20-UP-F and ERG20-UP-R;

[0155] Amplify the gene fragment ERG20-DOWN with primers ERG20-DOWN-F and ERG20-DOWN-R;

[0156] Using the plasmid pMHyLp-His as a template, amplify the ERG20-His fragment with primers ERG20-loxH-F and ERG20-loxH-R.

[0157] (2) Perform fusion PCR on the four fragments P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 , ERG20-UP, ERG20-DOWN, and ERG20-His in step (1) by PCR. After gel electrophoresis, cut and recover the correct band to obtain the fusion gene fragment ΔERG20-P containing the upstream and downstream homologous arms of ERG20 GPD -tHMG1-T ADH1 -P TEF1 -ERG20-TCYC1 ;

[0158] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of strain Y2 prepared in Example 2, culture on an SD-His plate at 30 °C for 2 - 3 days, and perform single colony PCR verification using primers YZ-ERG20-F and YZ-ERG20-R; select single colonies with correct bands to obtain strain Y2-P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -His.

[0159] (4) Prepare the competent cells of the strain obtained in step (3), transform into the pY26-Cre plasmid, culture on an SD-Ura plate at 30 °C for 2 - 3 days, pick a single colony and inoculate it into YPD medium for culturing for 15 - 24 h, streak on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL, and culture at 30 °C for 2 - 3 days. Perform dot plate verification on the single colonies grown on SD-Ura, SD-His, and YPD solid plates respectively. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 , named Saccharomyces cerevisiae Y3.

[0160] Example 4: Construction of Saccharomyces cerevisiae strain Y4

[0161] The specific steps are as follows:

[0162] (1) Artificially synthesize the gene fragment P PGK1 -INO2-T INO2 (The sequence is recorded in the invention patent with the publication number: CN113684141A);

[0163] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment INO2-UP with primers INO2-UP-F and INO2-UP-R;

[0164] Amplify the gene fragment INO2-DOWN with primers INO2-DOWN-F and INO2-DOWN-R;

[0165] Using plasmid pMHyLp-His as a template, the INO2-His fragment was amplified with primers INO2-loxH-F and INO2-loxH-R.

[0166] (2) The four fragments P PGK1 -INO2-T INO2 , INO2-UP, INO2-DOWN, and INO2-His in step (1) were subjected to fusion PCR using PCR, and the correct band obtained by gel electrophoresis was excised and recovered to obtain a fusion gene fragment ΔP INO2 -P PGK1 -INO2-T INO2 ;

[0167] (3) The fusion gene fragment obtained in step (2) was transformed into the competent cells of strain Y3 prepared in Example 3, cultured on an SD-His plate at 30 °C for 2 - 3 days, and single colony PCR verification was performed using primers YZ-INO2-F and YZ-INO2-R; single colonies with correct bands were selected to obtain strain Y3-P PGK1 -INO2-T INO2 -His.

[0168] (4) The strain obtained in step (3) was prepared into competent cells, transformed with the pY26-Cre plasmid, cultured on an SD-Ura plate at 30 °C for 2 - 3 days, single colonies were inoculated into YPD medium and cultured for 15 - 24 h, and then streaked on a YPD plate containing 5-fluorouracil at a concentration of 1 mg / mL and cultured at 30 °C for 2 - 3 days. The single colonies that grew were subjected to spot plate verification on SD-Ura, SD-His, and YPD solid plates respectively. The single colonies that grew only on the YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 , named Saccharomyces cerevisiae Y4.

[0169] Example 5: Construction of Saccharomyces cerevisiae strain Y4L1

[0170] The specific steps are as follows:

[0171] (1) Artificially synthesize the gene fragment P TEF1 -CrtB-T CYC1 -PHXT1 (The sequence is recorded in the invention patent with the publication number: CN114561311A);

[0172] Using the genome of Saccharomyces cerevisiae BY4741 as a template, with primers P ERG9 -UP-F, P ERG9 -UP-R to amplify the gene fragment P ERG9 -UP;

[0173] Using primers P ERG9 -DOWN-F, P ERG9 -DOWN-R to amplify the gene fragment P ERG9 -DOWN;

[0174] Using the plasmid pMHyLp-Trp (the sequence is recorded in the invention patent with the publication number: CN114561311A) as a template, and using primers P ERG9 -loxT-F, P ERG9 -loxT-R to amplify the P ERG9 -Trp fragment.

[0175] (2) Fuse the four fragments P TEF1 -CrtB-T CYC1 -P HXT1 , P ERG9 -UP, P ERG9 -DOWN, P ERG9 -Trp in step (1) by fusion PCR using PCR. After cutting and recovering the correct band obtained by gel electrophoresis, a fusion gene fragment ΔP ERG9 containing the upstream and downstream homologous arms of P ERG9 -P TEF1 -CrtB-T CYC1 -P HXT1 is obtained;

[0176] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of the Y4 strain prepared in Example 4, culture it on an SD-Trp plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-CrtB-F and YZ-CrtB-R; select the single colony with the correct band to obtain the strain Y4-P TEF1 -CrtB-T CYC1 -P HXT1 -Trp.

[0177] (4) Prepare the strain obtained in step (3) into competent cells, transform it into the pY26-Cre plasmid, culture it on an SD-Ura plate at 30 °C for 2-3 days, pick a single colony and inoculate it into YPD medium for 15-24 h, then streak it on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and culture it at 30 °C for 2-3 days. Spot the single colonies grown on SD Ura, SD Trp, and YPD solid plates for verification. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 , named Saccharomyces cerevisiae Y4L1.

[0178] Example 6: Construction of Saccharomyces cerevisiae strain Y4L2

[0179] The specific steps are as follows:

[0180] (1) Artificially synthesize the gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 (The sequence is recorded in the invention patent with the publication number: CN114561311A);

[0181] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment 308a-UP with primers 308a-UP-F and 308a-UP-R;

[0182] Amplify the gene fragment 308a-DOWN with primers 308a-DOWN-F and 308a-DOWN-R;

[0183] Using the plasmid pMHyLp-Leu (the sequence is recorded in the invention patent with the publication number: CN114561311A) as a template, amplify the 308a-Leu fragment with primers 308a-loxL-F and 308a-loxL-R.

[0184] (2) The four fragments T in step (1) CYC1 -CrtI-P GAL1,10 -CrtE-TADH1 For 308a-UP, 308a-DOWN, and 308a-Leu, fusion PCR was performed using PCR. After gel electrophoresis, the correct bands were excised and recovered to obtain the fusion gene fragment 308a-T containing the upstream and downstream homologous arms of 308a CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;

[0185] (3) The fusion gene fragment obtained in step (2) was transformed into the competent cells of the Y4L1 strain prepared in Example 5 and cultured on an SD-Leu plate at 30 °C for 2 - 3 days. Single colony PCR verification was performed using the primers YZ-CrtEI-1F and YZ-CrtEI-1R; Single colonies with correct bands were selected to obtain the strain Y4L1-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Leu

[0186] (4) The strain obtained in step (3) was prepared into competent cells and transformed into the pY26-Cre plasmid. It was cultured on an SD-Ura plate at 30 °C for 2 - 3 days. Single colonies were inoculated into YPD medium and cultured for 15 - 24 h, then streaked on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and cultured at 30 °C for 2 - 3 days. The single colonies that grew were spotted on SD-Ura, SD-Leu, and YPD solid plates for verification. The single colonies that grew only on the YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT 1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L2

[0187] Example 7: Construction of Saccharomyces cerevisiae strain Y4L3

[0188] The specific steps are as follows:

[0189] (1) Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment GAL80-UP was amplified with primers GAL80-UP-F and GAL80-UP-R.

[0190] The gene fragment GAL80-DOWN was amplified with primers GAL80-DOWN-F and GAL80-DOWN-R.

[0191] Using the plasmid pMHyLp-His as a template, the GAL80-His fragment was amplified with primers GAL80-loxH-F and GAL80-loxH-R.

[0192] (2) The three fragments GAL80-UP, GAL80-DOWN, and GAL80-His in step (1) were subjected to fusion PCR by PCR. After gel electrophoresis, the correct band was cut and recovered to obtain the fusion gene fragment ΔGAL80 containing the upstream and downstream homologous arms of GAL80.

[0193] (3) The fusion gene fragment in step (2) was transformed into the competent cells of the Y4L2 strain prepared in Example 6 and cultured on an SD-His plate at 30 °C for 2-3 days. Single colony PCR verification was performed using primers YZ-ΔGAL80-F and YZ-ΔGAL80-R. Single colonies with correct bands were selected to obtain the strain Y4L2ΔGAL80-His.

[0194] (4) The strain obtained in step (3) was prepared into competent cells and transformed into the pY26-Cre plasmid. It was cultured on an SD-Ura plate at 30 °C for 2-3 days. Single colonies were inoculated into YPD medium and cultured for 15-24 h, and then streaked on a YPD plate containing 5-FOA at a concentration of 1 mg / mL and cultured at 30 °C for 2-3 days. The grown single colonies were subjected to dot plate verification on SD-Ura, SD-His, and YPD solid plates. The single colonies that grew only on the YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TE F1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-TERG9 -T CYC1 -Cr tI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L3.

[0195] Example 8: Construction of Saccharomyces cerevisiae strain Y4L4

[0196] The specific steps are as follows:

[0197] (1) Artificially synthesize gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 (The sequence is recorded in the invention patent with the publication number: CN114561311A);

[0198] Using the genome of Saccharomyces cerevisiae BY4741 as a template, amplify the gene fragment 416d-UP with primers 416d-UP-F and 416d-UP-R;

[0199] Amplify the gene fragment 416d-DOWN with primers 416d-DOWN-F and 416d-DOWN-R;

[0200] Using the plasmid pMHyLp-His as a template, amplify the 416d-His fragment with primers 416d-loxH-F and 416d-loxH-R.

[0201] (2) Perform fusion PCR on the four fragments T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , 416d-UP, 416d-DOWN, and 416d-His in step (1) by PCR. After gel electrophoresis, cut and recover the correct band to obtain the fusion gene fragment 416d-T containing 416d upstream and downstream homologous arms CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;

[0202] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of the Y4L3 strain prepared in Example 7, culture on an SD-His plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-CrtEI-1F and YZ-CrtEI-2R; Select the single colony with the correct band to obtain the strain Y4L3-T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -His.

[0203] (4) Prepare the strain obtained in step (3) into competent cells, transform it into the pY26-Cre plasmid, culture it on an SD-Ura plate at 30 °C for 2-3 days, pick a single colony and inoculate it into YPD medium for 15-24 h, then streak it on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and culture it at 30 °C for 2-3 days. Spot the single colonies grown on SD-Ura, SD-His, and YPD solid plates for verification. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TE F1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -Cr tI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y4L4.

[0204] Example 9: Construction of Saccharomyces cerevisiae strain Y4C

[0205] The specific steps are as follows:

[0206] (1) Artificially synthesize the gene fragment P GAL7 -CrtYB-T CYC1 (The sequence is recorded in the invention patent with the publication number: CN114561311A);

[0207] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment 1309a-UP with primers 1309a-UP-F and 1309a-UP-R;

[0208] Amplify the gene fragment 1309a-DOWN with primers 1309a-DOWN-F and 1309a-DOWN-R;

[0209] Using plasmid pMHyLp-Leu as a template, the 1309a-Leu fragment was amplified with primers 1309a-loxL-F and 1309a-loxL-R.

[0210] (2) The four fragments P GAL7 -CrtYB-T CYC1 , 1309a-UP, 1309a-DOWN, and 1309a-Leu were subjected to fusion PCR using PCR, and the correct band obtained by gel electrophoresis was excised and recovered to obtain the fusion gene fragment 1309a-P GAL7 -CrtYB-T CYC1 ;

[0211] (3) The fusion gene fragment obtained in step (2) was transformed into the competent cells of the Y4L4 strain prepared in Example 8, cultured on an SD-Leu plate at 30 °C for 2 - 3 days, and single colony PCR verification was performed using primers YZ-CrtYB-F and YZ-CrtYB-R; single colonies with correct bands were selected to obtain the strain Y4L4-P GAL7 -CrtYB-T CYC1 -Leu.

[0212] (4) The strain obtained in step (3) was prepared into competent cells, transformed into the pY26-Cre plasmid, cultured on an SD-Ura plate at 30 °C for 2 - 3 days, single colonies were inoculated into YPD medium and cultured for 15 - 24 h, and then streaked on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and cultured at 30 °C for 2 - 3 days. The single colonies that grew were subjected to dot blot verification on SD-Ura, SD-Leu, and YPD solid plates respectively. The single colonies that grew only on the YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-PGAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 , named Saccharomyces cerevisiae Y4C.

[0213] Example 10: Construction of Saccharomyces cerevisiae strain Y5C

[0214] The specific steps are as follows:

[0215] (1) Artificially synthesize gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 (The sequence is recorded in the invention patent with the publication number: CN114561311A);

[0216] Using the genome of Saccharomyces cerevisiae BY4741 as a template, amplify the gene fragment 1014a-UP with primers 1014a-UP-F and 1014a-UP-R;

[0217] Amplify the gene fragment 1014a-DOWN with primers 1014a-DOWN-F and 1014a-DOWN-R;

[0218] Using the plasmid pMHyLp-Trp as a template, amplify the 1014a-Trp fragment with primers 1014a-loxT-F and 1014a-loxT-R.

[0219] (2) Fuse the four fragments T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 、1014a-UP, 1014a-DOWN, 1014a-Trp in step (1) by PCR for fusion PCR. After cutting and recovering the correct band obtained by gel electrophoresis, the fusion gene fragment 1014a-T containing the upstream and downstream homologous arms of 1014a is obtained CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;

[0220] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of the Y4C strain prepared in Example 9, culture on an SD-Trp plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-CrtEI-1F and YZ-CrtEI-3R; Select the single colony with the correct band to obtain the strain Y4C-P GAL7 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Trp.

[0221] (4) Prepare the strain obtained in step (3) into competent cells, transform it into the pY26-Cre plasmid, culture it on an SD-Ura plate at 30 °C for 2-3 days, pick a single colony and inoculate it into YPD medium for 15-24 h, streak it on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL, and culture it at 30 °C for 2-3 days. Spot the single colonies grown on SD-Ura, SD-Trp, and YPD solid plates respectively for verification. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 , named Saccharomyces cerevisiae Y5C.

[0222] Example 11: Construction of Saccharomyces cerevisiae strain YF01

[0223] The specific steps are as follows:

[0224] (1) Manually synthesize the gene fragment P GAL7 -CrtZ-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.1);

[0225] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment 208a-UP with primers 208a-UP-F and 208a-UP-R;

[0226] Amplify the gene fragment 208a-DOWN with primers 208a-DOWN-F and 208a-DOWN-R;

[0227] Using plasmid pMHyLp-His as a template, the 208a-His fragment was amplified with primers 208a-loxH-F and 208a-loxH-R.

[0228] (2) The four fragments P GAL7 -CrtZ-T CYC1 , 208a-UP, 208a-DOWN, and 208a-His were subjected to fusion PCR using PCR. The correct band obtained by gel electrophoresis was excised and recovered to obtain the fusion gene fragment 208a-P GAL7 -CrtZ-T CYC1 ;

[0229] (3) The fusion gene fragment obtained in step (2) was transformed into the competent cells of Y5C strain prepared in Example 10 and cultured on an SD-His plate at 30 °C for 2 - 3 days. Single colony PCR verification was performed using primers YZ-CrtZ-F and YZ-CrtZ-R; Single colonies with correct bands were selected to obtain strain Y5C-P GAL7 -CrtZ-T CYC1 -His.

[0230] (4) The strain obtained in step (3) was prepared into competent cells and transformed into pY26-Cre plasmid. It was cultured on an SD-Ura plate at 30 °C for 2 - 3 days. Single colonies were picked and inoculated into YPD medium and cultured for 15 - 24 h, then streaked on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and cultured at 30 °C for 2 - 3 days. The single colonies that grew were spotted on SD-Ura, SD-His, and YPD solid plates for verification. The single colonies that grew only on YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1-CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtZ-T CYC1 , named as Saccharomyces cerevisiae YF01.

[0231] Recombinant strains obtained by introducing different β-carotene hydroxylase genes:

[0232] Same as the construction of YF01, with the only difference being that CrtZ therein is replaced by HlCrtZ (GenBank accession number AKQ20654.1), BvCrtZ (GenBank accession number ABC50108.1) or PsCrtZ (UniProtKB / Swiss-Prot accession number Q44262.1), and Saccharomyces cerevisiae strains YF01-1, YF01-2, and YF01-3 were respectively prepared.

[0233] Example 12: Construction of Saccharomyces cerevisiae strain YF02

[0234] The specific steps are as follows:

[0235] (1) Artificially synthesize gene fragment P GAL7 -t24ZEP-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.2);

[0236] Using the genome of Saccharomyces cerevisiae BY4741 as a template, gene fragment 1622b-UP was amplified with primers 1622b-UP-F and 1622b-UP-R;

[0237] Using primers 1622b-DOWN-F and 1622b-DOWN-R, gene fragment 1622b-DOWN was amplified;

[0238] Using plasmid pMHyLp-Leu as a template, the 1622b-Leu fragment was amplified with primers 1622b-loxL-F and 1622b-loxL-R.

[0239] (2) Fuse the four fragments P GAL7 -t24ZEP-T CYC1 , 1622b-UP, 1622b-DOWN, and 1622b-Leu in step (1) by fusion PCR using PCR, and the correct band obtained by gel electrophoresis was cut and recovered to obtain the fusion gene fragment 1622b-P containing 1622b upstream and downstream homologous arms GAL7-t24ZEP-T CYC1 ;

[0240] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of strain YF01 prepared in Example 11, culture on an SD-Leu plate at 30 °C for 2-3 days, and perform single colony PCR verification using primers YZ-t24ZEP-F and YZ-t24ZEP-R; select single colonies with correct bands to obtain strain YF01-P GAL7 -t24ZEP-T CYC1 -Leu.

[0241] (4) Prepare the competent cells of the strain obtained in step (3), transform into the pY26-Cre plasmid, culture on an SD-Ura plate at 30 °C for 2-3 days, inoculate single colonies into YPD medium and culture for 15-24 h, streak on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL, and culture at 30 °C for 2-3 days. Perform dot plate verification of the grown single colonies on SD-Ura, SD-Leu, and YPD solid plates respectively. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtZ-T CYC1 -P GAL7 -t24ZEP-T CYC1 , named Saccharomyces cerevisiae YF02.

[0242] Example 13: Introduction of Different Violaxanthin Synthases

[0243] 1. Recombinant Strain Obtained by Introducing the Potential Violaxanthin Synthase VDL1 Gene

[0244] The specific steps are as follows:

[0245] (1) Artificially synthesize gene fragment P GAL7 -VDL1-T CYC1 (The Gene ID of VDL1 is 7201244);

[0246] Using the Saccharomyces cerevisiae BY4741 genome as a template, amplify the gene fragment YPRCδ15c-UP with primers YPRCδ15c-UP-F and YPRCδ15c-UP-R;

[0247] Amplify the gene fragment YPRCδ15c-DOWN with primers YPRCδ15c-DOWN-F and YPRCδ15c-DOWN-R;

[0248] Using the plasmid pMHyLp-Trp as a template, amplify the YPRCδ15c-Trp fragment with primers YPRCδ15c-loxT-F and YPRCδ15c-loxT-R.

[0249] (2) Perform fusion PCR on the four fragments P GAL7 -VDL1-T CYC1 , YPRCδ15c-UP, YPRCδ15c-DOWN, and YPRCδ15c-Trp in step (1) by PCR. After running the gel, cut and recover the correct band to obtain the fusion gene fragment YPRCδ15c-P GAL7 -VDL1-T CYC1 ;

[0250] (3) Transform the fusion gene fragment obtained in step (2) into the competent cells of the YF02 strain prepared in Example 12, culture on an SD-Trp plate at 30 °C for 2 - 3 days, and perform single colony PCR verification using primers YZ-VDL1-F and YZ-VDL-R; select the single colony with the correct band to obtain the strain YF02-P GAL7 -VDL1-T CYC1 -Trp.

[0251] (4) Prepare the strain obtained in step (3) into competent cells, transform it into the pY26-Cre plasmid, culture it on an SD-Ura plate at 30 °C for 2 - 3 days, pick a single colony and inoculate it into YPD medium for 15 - 24 h, then streak it on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and culture it at 30 °C for 2 - 3 days. Spot the single colonies grown on SD-Ura, SD-Trp, and YPD solid plates respectively for verification. The single colonies that grow only on the YPD medium are the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtZ-T CYC1 -P GAL7 -t24ZEP-T CYC1 -P GAL7 -VDL1-T CYC1 , named Saccharomyces cerevisiae YF03.

[0252] 2. The recombinant strain obtained by introducing the plant-derived neoxanthin synthase NSY gene

[0253] The construction method is the same as that of YF03, with the only difference being that VDL1 is replaced by SlNSY from Solanum lycopersicum (Gene ID: 543649), MtNSY from Medicago truncatula (GenBank number: RHN50675.1), or TrNSY from Trifolium repens (GenBank number: KAK2352017.1). Saccharomyces cerevisiae strains YF03-1, YF03-2, and YF03-3 were respectively prepared. After HPLC detection, the target product neoxanthin was not detected.

[0254] The construction method is the same as that of YF03, with the only difference being that VDL1 is replaced by VDL2 (Gene ID: 7200954). Saccharomyces cerevisiae strain YF04 was prepared. After HPLC detection, the target product neoxanthin was not detected.

[0255] Example 14: Subcellular distribution of violaxanthin in recombinant strain YF02 under shake-flask fermentation conditions

[0256] The specific steps are as follows:

[0257] (1) Streak strain YF02 on an SD-Leu plate and culture it at 30 °C for 2 - 3 days. Pick a single colony and inoculate it into an SD-His-Leu medium and culture for 15 - 24 h. Then inoculate it into 4 250 mL shake flasks each containing 25 mL of YPD medium and culture at 30 °C for 96 h;

[0258] (2) After fermentation, wash and resuspend 100 mL of the fermentation broth with Tris-HCl solution (20 mM Tris-HCl, 250 mM sucrose, pH 7.4) and make the volume up to 50 mL;

[0259] (3) Use a high-pressure homogenizer (>1,000 bar, 10 min) to break the bacterial solution. After breaking, aliquot 20 mL per tube into 2 50 mL centrifuge tubes;

[0260] (4) Use a 50 mL floor centrifuge to centrifuge one tube of the broken bacterial solution at 1,000 × g for 10 min. The precipitate is the cell nucleus. Transfer the supernatant to a new 50 mL centrifuge tube;

[0261] (5) Use a 50 mL floor centrifuge to centrifuge the supernatant obtained in the previous step at 3,000 × g for 10 min. The precipitate is the incompletely broken cells. Transfer the supernatant to a new 50 mL centrifuge tube;

[0262] (6) Centrifuge the supernatant obtained in the previous step using a 50 mL floor centrifuge at 15,000×g (it is necessary to strictly balance), centrifuge for 10 min, the precipitate is mitochondria and peroxisomes, transfer the supernatant to a new 50 mL centrifuge tube;

[0263] (7) Using an ultracentrifuge, pour the supernatant obtained in the previous step onto an analytical balance into an ultracentrifuge tube (place the matching centrifuge tube cap on the balance tray at the same time), prepare all samples to a mass error of less than 0.01 g, record the supernatant volume difference, tighten the centrifuge tube and place it in the rotor, after evacuating, centrifuge at 30,000×g for 30 min, the precipitate is microsomes;

[0264] (8) Using an ultracentrifuge, transfer another tube of broken bacterial liquid to a new ultracentrifuge tube and balance it, after evacuating, centrifuge at 30,0000×g for 60 min, the precipitate is the cell membrane, the top is lipid droplets, and the middle is cytoplasm;

[0265] (9) Extract different component organelles with ethyl acetate and then use HPLC to detect the production of violaxanthin. The results are as Figure 1 shown. The main organelles where violaxanthin is distributed are the nucleus.

[0266] Example 15: Construction of Saccharomyces cerevisiae strain YF15

[0267] 1. The specific steps are as follows:

[0268] (1) Use TargetP-2.0 to predict the chloroplast targeting peptide of VDL1 protein. The results show that the first 19 amino acids at its N-terminus are the chloroplast targeting peptide; in addition, since we found that precursor violaxanthin is mainly distributed in the nucleus, we tried to fuse the SV40 nuclear localization tag at its C-terminus to localize the enzyme mutant in the nucleus, so as to achieve the synthesis of neoxanthin;

[0269] Artificially synthesize the gene fragment P GAL7 -t19VDL1-SV40-T CYC1 (The nucleotide sequence is shown in SEQ ID NO.3, the amino acid sequence of t19VDL1 is shown in SEQ ID NO.4, and the nucleotide sequence of the SV40 tag is shown in SEQ ID NO.5);

[0270] Using the genome of Saccharomyces cerevisiae BY4741 as a template, amplify the gene fragment YPRCδ15c-UP with primers YPRCδ15c-UP-F and YPRCδ15c-UP-R;

[0271] Amplify the gene fragment YPRCδ15c-DOWN with primers YPRCδ15c-DOWN-F and YPRCδ15c-DOWN-R;

[0272] Using plasmid pMHyLp-Trp as a template, the YPRCδ15c-Trp fragment was amplified with primers YPRCδ15c-loxT-F and YPRCδ15c-loxT-R.

[0273] (2) The four fragments P GAL7 -t19VDL1-SV40-T CYC1 、YPRCδ15c-UP, YPRCδ15c-DOWN, and YPRCδ15c-Trp were subjected to fusion PCR using PCR, and the correct bands obtained by gel electrophoresis were cut and recovered to obtain the fusion gene fragment YPRCδ15c-P GAL7 -t19VDL1-SV40-T CYC1 ;

[0274] (3) The fusion gene fragment obtained in step (2) was transformed into the competent cells of the YF02 strain prepared in Example 12, cultured on an SD-Trp plate at 30 °C for 2 - 3 days, and single colony PCR verification was performed using primers YZ-VDL1-F and YZ-VDL-R; single colonies with correct bands were selected to obtain the strain YF02-P GAL7 -t19VDL1-SV40-T CYC1 -Trp.

[0275] (4) The strain obtained in step (3) was prepared into competent cells, transformed with the pY26-Cre plasmid, cultured on an SD-Ura plate at 30 °C for 2 - 3 days, a single colony was inoculated into YPD medium and cultured for 15 - 24 h, and then streaked on a YPD plate containing 5-fluoroorotic acid at a concentration of 1 mg / mL and cultured at 30 °C for 2 - 3 days. The single colonies that grew were subjected to spot plate verification on SD-Ura, SD-Trp, and YPD solid plates respectively. The single colonies that grew only on the YPD medium were the correct Saccharomyces cerevisiae strain BY4741ΔROX1-△GAL80-P GPD -tHMG1-T ADH1 -P TEF1 -IDI1-T CYC1 -P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -P PGK1 -INO2-T INO2 -P TEF1 -CrtB-T CYC1 -P HXT1 -ERG9-T ERG9 -T CYC1 -CrtI-PGAL1,10 -CrtE-T ADH1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtYB-T CYC1 -T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -P GAL7 -CrtZ-T CYC1 -P GAL7 -t24ZEP-T CYC1 -P GAL7 -t19VDL1-SV40-T CYC1 , named as Saccharomyces cerevisiae YF15.

[0276] 2. Other recombinant strains obtained by optimizing the targeting peptide:

[0277] The construction method is the same as that of YF03, the only difference is that VDL1 is replaced by t52SlNSY (deleting the nucleotide sequence encoding the N-terminal 2-52 amino acids of the SlNSY protein) or t50TrNSY (deleting the nucleotide sequence encoding the N-terminal 2-50 amino acids of the TrNSY protein), and Saccharomyces cerevisiae strains YF03-4 and YF03-5 are respectively prepared. After HPLC detection, the target product neoxanthin is not detected.

[0278] The construction method is the same as that of YF03, the only difference is that VDL1 is replaced by t19VDL1 (deleting the nucleotide sequence encoding the N-terminal 2-19 amino acids of the VDL1 protein), t23VDL2 (deleting the nucleotide sequence encoding the N-terminal 2-23 amino acids of the VDL2 protein), or t31VDL2 (deleting the nucleotide sequence encoding the N-terminal 2-31 amino acids of the VDL2 protein), and Saccharomyces cerevisiae strains YF05, YF06, and YF07 are respectively prepared.

[0279] Consider increasing the production of the target product by enhancing soluble expression in the cytoplasm: The construction method is the same as that of YF03, with the only difference being that VDL1 is replaced with MBP-VDL1 (the N-terminus of the VDL1 protein is fused with the maltose-binding protein tag MBP, and the nucleotide sequences of MBP and the linker are shown in SEQ ID NO.6-7 respectively), MBP-VDL2 (the N-terminus of the VDL2 protein is fused with the maltose-binding protein tag MBP), MBP-t19VDL1 (the N-terminus of the t19VDL1 protein is fused with the maltose-binding protein tag MBP), MBP-t23VDL2 (the N-terminus of the t23VDL2 protein is fused with the maltose-binding protein tag MBP), or MBP-t31VDL2 (the N-terminus of the t23VDL2 protein is fused with the maltose-binding protein tag MBP), and the Saccharomyces cerevisiae strains YF08, YF09, YF10, YF11, and YF12 are respectively prepared.

[0280] The construction method is the same as that of YF03, with the only difference being that VDL1 is replaced with VDL1-SV40 (the C-terminus of the VDL1 protein is fused with the nuclear localization tag SV40), VDL2-SV40 (the C-terminus of the VDL2 protein is fused with the nuclear localization tag SV40), t23VDL2-SV40 (the C-terminus of the t23VDL2 protein is fused with the nuclear localization tag SV40), and t31VDL2-SV40 (the C-terminus of the t31VDL2 protein is fused with the nuclear localization tag SV40), and the Saccharomyces cerevisiae strains YF13, YF14, YF16, and YF17 are respectively prepared.

[0281] Example 16: The specific steps for the production of zeaxanthin, violaxanthin, and neoxanthin by the recombinant strains under shake-flask fermentation conditions are as follows:

[0282] (1) Respectively culture the above recombinant Saccharomyces cerevisiae strains Y5C, YF01 - YF17 at 30 °C and 220 rpm for 16 - 24 h to prepare seed solutions. Inoculate the prepared seed solutions into 250 mL conical flasks containing 25 mL of YPD medium at an inoculation amount of 2% (v / v), and culture at 30 °C and 220 rpm for 96 h to prepare fermentation broths.

[0283] (2) Calculate the yields of zeaxanthin, violaxanthin, and neoxanthin:

[0284] Pipette 500 μL of the resuspended fermentation broth, wash and resuspend it with an equal volume of deionized water, then put it into a disruption tube together with 500 μL of ethyl acetate and an appropriate amount of glass beads with a diameter of 0.5 mm, and disrupt the cells using a whole-cell grinder. After centrifugation, pipette the ethyl acetate, appropriately dilute it with pure acetonitrile, filter it through a membrane into a liquid-phase injection vial, and perform high-performance liquid chromatography detection. Calculate the fermentation yields of the engineered strains by converting with the peak areas of zeaxanthin, violaxanthin, and neoxanthin standards. Pipette the fermentation broth, dilute it 100 times, and then measure the OD using a UV spectrophotometer. 600。

[0285] The results are shown in Table 3-5 and Figures 2 - 4 as follows. The zeaxanthin yield of strain YF01 expressing CrtZ reached 32.10 mg / L, and the OD 600 reached 32.50; the violaxanthin yield of strain YF02 expressing t24ZEP reached 31.62 mg / L, and the OD 600 reached 32.40; the neoxanthin yield of strain YF15 expressing t19VDL1-SV40 reached 1.78 mg / L, the violaxanthin yield was 26.77 mg / L, and the OD 600 was 33.82.

[0286] Table 3: Zeaxanthin yield of different recombinant Saccharomyces cerevisiae and OD after fermentation 600

[0287]

[0288]

[0289] Table 4: Violaxanthin yield in recombinant Saccharomyces cerevisiae and OD after fermentation 600

[0290] Strain Violaxanthin Yield (mg / L) <![CDATA[OD 600 > YF01 0 35.78 YF02 31.62 32.40

[0291] Table 5: Neoxanthin and violaxanthin yields in recombinant Saccharomyces cerevisiae and OD after fermentation 600

[0292] Strain Neoxanthin Yield (mg / L) Violaxanthin Yield (mg / L) <![CDATA[OD 600 > YF02 0 37.16 34.57 YF03 1.09 24.29 34.59 YF04 0 26.76 35.44 YF05 1.46 23.90 35.29 YF06 0 28.49 34.85 YF07 0 28.40 33.91 YF08 0.81 23.30 35.68 YF09 0 25.57 34.35 YF10 1.56 23.79 34.81 YF11 0 22.65 33.32 YF12 0 24.90 35.25 YF13 1.74 21.45 34.68 YF14 0 28.49 35.04 YF15 1.78 26.77 33.82 YF16 0 21.04 36.09 YF17 0.08 25.42 35.76

[0293] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. And the obvious changes or alterations derived therefrom are still within the protection scope of the present invention.

Claims

1. A recombinant Saccharomyces cerevisiae, characterized in that The recombinant Saccharomyces cerevisiae comprises the following modifications: overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ and zeaxanthin epoxidase t24ZEP truncated mutant, introduction of a violaxanthin deep oxidase-like protein expression frame, knockout of the transcriptional repressor ROX1 and the galactose / lactose metabolism regulatory protein GAL80, and weakened expression of squalene synthase ERG9; wherein, The β-carotene hydroxylase CrtZ is derived from Pantoea ananatis or Brevundimonas vesicularis, The amino acid sequence of the zeaxanthin epoxidase truncated mutant t24ZEP is shown in SEQ ID NO.8, The violaxanthin deep oxidase-like protein expression frame contains one or more of the following: (1) Violaxanthin deep oxidase-like protein or violaxanthin deep oxidase-like protein with its own localization signal peptide deleted; (2) a violaxanthin deep oxidase-like protein fused with a maltose binding protein tag, or a violaxanthin deep oxidase-like protein fused with a maltose binding protein tag and with its own localization signal peptide deleted; (3) A violaxanthin deep oxidase-like protein fused with a nuclear localization signal peptide, or a violaxanthin deep oxidase-like protein fused with a nuclear localization signal peptide and deleting its own localization signal peptide.

2. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that Contains at least one of the following characteristics: (1) The Gene ID of the 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is 42650, the Gene ID of the isopentenyl pyrophosphate isomerase IDI1 is 855986, the Gene ID of the farnesyl pyrophosphate synthase ERG20 is 853272, the Gene ID of the endoplasmic reticulum size regulator INO2 is 851701, the Gene ID of the geranylgeranyl diphosphate synthase CrtE is 45505274, the Gene ID of the phytoene dehydrogenase CrtI is 37729024, the Gene ID of the 15-cis phytoene synthase CrtB is 429485116, the GenBank number of the bifunctional lycopene cyclase / phytoene synthase CrtYB is ALK24266.1, the Gene ID of the transcriptional repressor ROX1 is 856178, the Gene ID of the galactose / lactose metabolism regulatory protein GAL80 is 851701, and the Gene ID of the galactose / lactose metabolism regulatory protein GAL80 is 851702. The ID is 854954, and the Gene ID of squalene synthase ERG9 is 856597; (2) The GenBank number of β-carotene hydroxylase CrtZ from Pantoea ananatis is CRH37458.1; the GenBank number of β-carotene hydroxylase CrtZ from Brevundimonas vesicularis is ABC50108.1; (3) The Gene ID of the violaxanthin deep oxidase-like protein is 7201244; (4) The violaxanthin deep oxidase-like protein with its own localization signal peptide deleted includes the sequence shown in SEQ ID NO.4; (5) The maltose binding protein tag includes an MBP tag; (6) The nuclear localization signal peptide includes SV40.

3. The recombinant Saccharomyces cerevisiae according to claim 2, characterized in that The nucleotide sequence of the SV40 is shown in SEQ ID NO.5; the nucleotide sequence of the MBP tag is shown in SEQ ID NO.

6.

4. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that Contains at least one of the following characteristics: (1) The maltose binding protein tag is fused to the N-terminus of the violaxanthin deep oxidase-like protein or the violaxanthin deep oxidase-like protein with its own localization signal peptide deleted; (2) the nuclear localization signal peptide is fused to the C-terminus of the violaxanthin deep oxidase-like protein or the violaxanthin deep oxidase-like protein with its own localization signal peptide deleted; (3) the maltose binding protein tag is connected via a linker sequence or directly connected; (4) The nuclear localization signal peptide is connected via a linker sequence or directly connected.

5. The recombinant Saccharomyces cerevisiae according to claim 4, characterized in that The connection sequence includes the sequence shown in SEQ ID NO.

7.

6. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that Contains at least one of the following characteristics: (1) The overexpression method includes genome integration and / or replacing the original promoter on the genome with a strong promoter; the strong promoter is a promoter with higher expression intensity than the original promoter; Preferably, the overexpression comprises integrating into the genome the coding genes of 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ and zeaxanthin epoxidase truncation mutant t24ZEP, The overexpression includes replacing the promoter in front of the gene encoding farnesyl pyrophosphate synthase ERG20 or endoplasmic reticulum size regulator INO2 on the genome with a strong promoter; (2) The weakened expression includes replacing the original promoter on the genome with a weak promoter; the weak promoter is a promoter with lower expression strength than the original promoter; Preferably, the weakened expression comprises replacing the promoter in front of the gene encoding squalene synthase ERG9 on the genome with a weak promoter.

7. The recombinant Saccharomyces cerevisiae according to claim 6, characterized in that Contains at least one of the following characteristics: (1) The genomic integration sites include ROX1 site, ERG20 site, 911b site, INO2 site, 308a site, 416d site, 1014a site, P ERG9 One or more of site 1309a, site 208a, site 1622b, and YPRCδ15c; (2) Integrate at least one copy of an overexpression gene or expression cassette into the genome.

8. The recombinant Saccharomyces cerevisiae according to claim 7, characterized in that Contains at least one of the following characteristics: In the genome of the starting strain, two copies of 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, one copy of isopentenyl pyrophosphate isomerase IDI1, one copy of farnesyl pyrophosphate synthase ERG20 or one copy of endoplasmic reticulum size regulator INO2 are enhanced and expressed; three copies of geranylgeranyl diphosphate synthase CrtE, three copies of phytoene dehydrogenase CrtI, one copy of 15-cis-phytoene synthase CrtB, one copy of bifunctional lycopene cyclase / phytoene synthase CrtYB, one copy of β-carotene hydroxylase CrtZ, one copy of zeaxanthin epoxidase t24ZEP or one copy of violaxanthin deep oxidase-like protein expression frame are heterologously expressed.

9. The recombinant Saccharomyces cerevisiae according to any one of claims 1 to 8, characterized in that Contains at least one of the following characteristics: (1) Integration of the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 at the ROX1 locus and / or ERG20 locus; (2) integration of the gene encoding isopentenyl pyrophosphate isomerase IDI1 at the 911b locus; (3) integrating the gene encoding geranylgeranyl diphosphate synthase CrtE at at least one of the 308a site, 416d site, and 1014a site; (4) integrating the gene encoding phytoene dehydrogenase CrtI at at least one of the 308a site, the 416d site, and the 1014a site; (5) In P ERG9 The site was integrated with the gene encoding 15-cis-phytoene synthase CrtB; (6) integration of the bifunctional lycopene cyclase / phytoene synthase CrtYB encoding gene at the 1309a locus; (7) integration of the gene encoding β-carotene hydroxylase CrtZ at the 208a site; (8) integration of the gene encoding the zeaxanthin epoxidase truncated mutant t24ZEP at the 1622b locus; (9) integration of a violaxanthin deep oxidase-like protein expression cassette at the YPRCδ15c locus; (10) Replace the promoter of farnesyl pyrophosphate synthase ERG20 on the genome with P TEF1 Promoter; (11) Replace the promoter of the endoplasmic reticulum size regulator INO2 on the genome with P PGK1 Promoter; (12) Replace the promoter of squalene synthase ERG9 on the genome with P HXT1 Promoter.

10. The recombinant Saccharomyces cerevisiae according to any one of claims 1 to 9, characterized in that Contains at least one of the following characteristics: (1) Using P GPD The promoter expresses 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1; (2) Using P TEF1 The promoter expresses isopentenyl pyrophosphate isomerase IDI1; (3) Using P TEF1 The promoter expresses 15-cis-phytoene synthase CrtB; (4) Using P GAL1,10 The bidirectional promoter expresses phytoene dehydrogenase CrtI and geranylgeranyl diphosphate synthase CrtE; (5) Using P GAL7 The promoter expresses the bifunctional lycopene cyclase / phytoene synthase CrtYB; (6) Using P GAL7 The promoter expresses β-carotene hydroxylase CrtZ; (7) Using P GAL7 The promoter expresses the zeaxanthin epoxidase truncation mutant t24ZEP; (8) The violaxanthin deep oxidase-like protein expression frame contains P GAL7 Promoter.

11. The recombinant Saccharomyces cerevisiae according to claim 1, characterized in that The recombinant Saccharomyces cerevisiae uses modified or unmodified Saccharomyces cerevisiae as a starting strain; the starting strain includes Saccharomyces cerevisiae BY 4741.

12. The method for constructing a recombinant Saccharomyces cerevisiae according to any one of claims 1 to 11, characterized in that: The following steps are involved: By gene recombination, the expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, and endoplasmic reticulum size regulator INO2 was enhanced; geranylgeranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, 15-cis phytoene synthase CrtB, bifunctional lycopene cyclase / phytoene synthase CrtYB, β-carotene hydroxylase CrtZ, zeaxanthin epoxidase t24ZEP and violaxanthin deep oxidase-like protein expression cassette were heterologously expressed; the transcriptional repressor ROX1 and galactose / lactose metabolism regulatory protein GAL80 were knocked out by gene recombination; the expression of squalene synthase ERG9 was downregulated by gene recombination.

13. The construction method according to claim 12, characterized in that: The 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 was integrated into the ROX1 site and ERG20 site of the Saccharomyces cerevisiae genome; the isopentenyl pyrophosphate isomerase IDI1 was integrated into the 911b site of the Saccharomyces cerevisiae genome; TEF1 The promoter-enhanced expression of farnesyl pyrophosphate synthase ERG20 was integrated into the ERG20 locus on the Saccharomyces cerevisiae genome; PGK1 The endoplasmic reticulum size regulator INO2 whose promoter was enhanced was integrated into the INO2 site on the Saccharomyces cerevisiae genome; the geranylgeranyl diphosphate synthase CrtE was integrated into the 308a site, 416d site and 1014a site on the Saccharomyces cerevisiae genome respectively; the phytoene dehydrogenase CrtI was integrated into the 308a site, 416d site and 1014a site on the Saccharomyces cerevisiae genome respectively; the 15-cis phytoene synthase CrtB was integrated into the P ERG9 site; the bifunctional lycopene cyclase / phytoene synthase CrtYB was integrated into the 1309a site on the Saccharomyces cerevisiae genome; the β-carotene hydroxylase CrtZ was integrated into the 208a site on the Saccharomyces cerevisiae genome; the zeaxanthin epoxidase t24ZEP truncation mutant was integrated into the 1622b site on the Saccharomyces cerevisiae genome; the violaxanthin deep oxidase-like protein expression cassette was integrated into the YPRCδ15c site on the Saccharomyces cerevisiae genome.

14. The construction method according to claim 13, characterized in that: Contains at least one of the following characteristics: (1) The guide sequence integrated into the 911b site of the Saccharomyces cerevisiae genome is GTAATATTGTCTTGTTTCCC; (2) The guide sequence integrated into the 308a site on the Saccharomyces cerevisiae genome is CACTTGTCAAACAGAATATA; (3) The guide sequence for integration into the 416d site of the Saccharomyces cerevisiae genome is TAGTGCACTTACCCCACGTT; (4) The guide sequence for integration into the 1014a site on the Saccharomyces cerevisiae genome is TTATGTGCGTATTGCTTTCA; (5) The guide sequence integrated into the 1309a site on the Saccharomyces cerevisiae genome is CCTGTGGTGACTACGTATCC; (6) The guide sequence for integration into the 208a site of the Saccharomyces cerevisiae genome is GTCCGCTAAACAAAAGATCT; (7) The guide sequence for integration into the 1622b site of the Saccharomyces cerevisiae genome is TAAAGCCACCACATCGCAAA; (8) The guide sequence for integration into the YPRCδ15c locus on the Saccharomyces cerevisiae genome is AATCCGAACAACAGAGCATA.

15. A system for de novo synthesis of zeaxanthin, violaxanthin or neoxanthin, characterized in that: The system comprises: (1) the recombinant Saccharomyces cerevisiae described in any one of claims 1 to 11 or the recombinant Saccharomyces cerevisiae obtained by the construction method described in any one of claims 12 to 14; and (2) glucose.

16. Use of the recombinant Saccharomyces cerevisiae according to any one of claims 1 to 11, the recombinant Saccharomyces cerevisiae obtained by the construction method according to any one of claims 12 to 14, or the system according to claim 15 in synthesizing zeaxanthin, violaxanthin or neoxanthin.

17. The use according to claim 16, characterized in that Glucose is used as substrate for synthesis.

18. A method for producing zeaxanthin, violaxanthin or neoxanthin, characterized in that: The method comprises the step of fermenting the recombinant Saccharomyces cerevisiae obtained by the recombinant Saccharomyces cerevisiae described in any one of claims 1 to 11 or the recombinant Saccharomyces cerevisiae obtained by the construction method described in any one of claims 12 to 14.

19. The method according to claim 18, characterized in that The fermentation includes shake flask fermentation or batch fed fermentation; the fermentation includes the following steps: inoculating the recombinant brewer's yeast into a seed culture medium to obtain a seed liquid, and inoculating the seed liquid into a fermentation culture medium for fermentation.

20. The method according to claim 19, characterized in that Contains at least one of the following characteristics: (1) Cultivate at 28-32°C and 180-280 rpm; (2) The seed solution inoculation amount is 1-10% (v / v); (3) The seed culture medium contains the following components: 10-500 mg / L uracil, 1-10 g / L amino-free yeast nitrogen source, and 15-25 g / L anhydrous glucose; (4) The fermentation medium contains the following components: 15-25 g / L tryptone, 15-25 g / L anhydrous glucose, and 5-15 g / L yeast extract.

Images