Rnas, pharmaceutical compositions, conjugates and uses

Abstract

The application relates to the technical field of diabetic retinal vasculopathy, in particular to RNA, a pharmaceutical composition, a conjugate and application. The nucleotide sequence of the RNA is shown in SEQ ID NO:1. The RNA can inhibit the proliferation, tube formation and migration capacity of retinal vascular endothelial cells, thereby playing a role in inhibiting diabetic retinal angiogenesis. The RNA can also inhibit the inflammatory response caused by diabetic retinal vasculopathy, and has the effect of treating diabetic retinal vasculopathy.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of diabetic retinal vasculopathy, and in particular to RNA, a pharmaceutical composition, a conjugate and applications. BACKGROUND

[0002] Diabetic retinopathy (DR) is a common progressive ocular microvascular complication of diabetes. Early clinical features include pericyte loss, endothelial cell dysfunction, microaneurysm formation, intraretinal hemorrhage, exudation and intraretinal microvascular abnormalities. With the progression of the disease, capillary non-perfusion leads to retinal hypoxia, which in turn drives pathological angiogenesis, and the high leakage of the newly formed blood vessels leads to repeated vitreous hemorrhage, forming fibrovascular scars, and the contraction of fibrous tissue leads to retinal traction and vision loss.

[0003] The main treatment methods for such diseases at present include systemic treatment, fundus laser photocoagulation, intraocular injection of drugs, vitrectomy surgery, etc. Intraocular injection of anti-vascular endothelial growth factor (VEGF) drugs has become the mainstream of anti-angiogenic therapy, which inhibits abnormal angiogenesis and leakage by blocking the binding of VEGF to endothelial cell receptors, thereby reducing the symptoms and progression of the disease. However, anti-VEGF therapy does not have high cell specificity in its effect on pathological vessels, so there are still limitations in the effect of this treatment on vision improvement. Therefore, intervention only on endothelial cells cannot achieve the desired therapeutic effect. There is an urgent need in clinical practice to find new target cells and highly specific and targeted genes in order to target early diabetic retinal vasculopathy for targeted treatment. SUMMARY

[0004] The present application discloses a kind of RNA, can inhibit the proliferation of retinal vascular endothelial cells, tube formation and migration ability, and reduce the level of retinal inflammatory factors, and then play the role of inhibiting diabetic retinal vasculopathy.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiments disclose an RNA, the nucleotide sequence of which is shown in SEQ ID NO:1 (UGAUCUUCAGUCUAACGCUCUCCCAACU).

[0007] In a second aspect, a pharmaceutical composition comprises the RNA of the first aspect and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0008] In a third aspect, the embodiments disclose the use of the RNA of the first aspect in the preparation of a medicament for preventing or treating diabetic retinal disease.

[0009] In a fourth aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for preventing or treating diabetic retinal angiopathy.

[0010] In a fifth aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for inhibiting inflammation of the fundus.

[0011] In a sixth aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for inhibiting proliferation of retinal vascular endothelial cells.

[0012] In a seventh aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for inhibiting tube formation of retinal vascular endothelial cells.

[0013] In an eighth aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for inhibiting migration of retinal vascular endothelial cells.

[0014] In a ninth aspect, the embodiments disclose use of the RNA according to the first aspect in the preparation of a drug for reducing the level of inflammatory factors in the retina.

[0015] In a tenth aspect, the embodiments disclose a conjugate comprising the RNA according to the first aspect. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a CCK8 experiment for detecting the effect of the RNA provided in the embodiments on the viability of human retinal vascular endothelial cells (HRVECs) under HG conditions (in vitro simulation of high glucose induction model);

[0017] Figure 2 is an EdU proliferation experiment for detecting the effect of the RNA provided in the embodiments on the proliferation of human retinal vascular endothelial cells (HRVECs) under HG conditions;

[0018] Figure 3 is a Matrigel tube formation experiment for detecting the effect of the RNA provided in the embodiments on the tube formation ability of human retinal vascular endothelial cells (HRVECs) under HG conditions;

[0019] Figure 4 is a Transwell migration experiment for detecting the effect of the RNA provided in the embodiments on the migration ability of human retinal vascular endothelial cells (HRVECs) under HG conditions;

[0020] Figure 5 is an Evans blue staining determination experiment for detecting the effect of the RNA provided in the embodiments on the permeability of retinal blood vessels in a STZ-induced diabetic animal model;

[0021] Figure 6is the effect of RNA provided by the retinal trypsin digestion experiment detection example on the number of non-cellular capillaries in the retina of STZ-induced diabetic animal models;

[0022] Figure 7 is the effect of RNA provided by the qPCR detection example on the level of inflammatory factors in the retina of STZ-induced diabetic animal models. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application will be further described in detail below in combination with examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application. The reagents not specifically described in the present application are conventional reagents and can be obtained from commercial channels; the methods not specifically described are conventional experimental methods and can be known from prior art.

[0024] The present inventors have found that an RNA having a nucleotide sequence as shown in SEQ ID NO: 1. The single-stranded molecule of the RNA (such as SEQ ID NO: 1), or the double-stranded molecule of the RNA, can reduce the proliferation, tube formation and migration of vascular endothelial cells, significantly inhibit inflammatory response, and has the effect of treating diabetic retinal vascular disease. Compared with other antibody therapeutic drugs, the RNA molecule provided by the present application has the dual effects of anti-vascular disease and anti-inflammation, and has a good clinical application prospect in the treatment of diabetic retinal vascular disease and related eye diseases.

[0025] In some test examples, the inhibitory effect of the RNA as shown in SEQ ID NO: 1 on the activity of human retinal vascular endothelial cells (HRVECs) was tested by CCK-8 method.

[0026] The test process includes:

[0027] Human retinal vascular endothelial cells (HRVECs, CSC) were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin and 1% streptomycin at 37°C with 5% CO2 in a 96-well plate to a confluence of about 60%, and then divided into a model group (HG), a treatment group (RNA), a non-treatment group (NC) and a blank group (Ctrl). In the treatment group, 2x10 4 HRVECs cells per well were mixed with Lipofectamine RNAiMAX Transfection Reagent (Cat No: 13778075, Thermo Fisher) and 30nM RNA as shown in SEQ ID NO: 1 for 6h. In the non-treatment group, 2x10 4HRVECs cells were cultured for 6 h with Lipofectamine RNAiMAX Transfection Reagent and 30 nM RNA (NC-RNA) as shown in SEQ ID NO:2. The control group and model group cells were cultured in the same volume of culture medium for 6 h. After 6 h of culture, the treatment group, non-treatment group, and model group cells were treated for 24 h with DMEM medium containing 50 mM glucose, 12% fetal bovine serum, 1% penicillin, and 1% streptomycin (i.e., HG treatment; the control group cells were not treated with HG). The culture medium was discarded, and the cells were incubated at 37°C for 1 h with basal medium containing 10% CCK-8 (CatNo: C0038; Beyotime, China). The absorbance was measured at 450 nm, and the cell viability (%) was calculated based on the absorbance. Cell viability was the percentage of the difference between the 450 nm absorbance of each group and the 450 nm absorbance of the control group relative to the 450 nm absorbance of the control group.

[0028] like Figure 1 As shown, the cell viability in the model group was significantly higher than that in the control group, indicating that HG treatment promoted HRVEC cell viability. However, treatment with the RNA provided in this application inhibited HRVEC cell viability.

[0029] In some test cases, the inhibitory effect of RNA such as SEQ ID NO:1 on the proliferation of human retinal vascular endothelial cells (HRVECs) was tested using the EdU method.

[0030] The testing process includes:

[0031] 1) HRVECs were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin, and 1% streptomycin at 37°C with 5% CO2 in 24-well plates until confluence reached approximately 60%. The cells were then divided into a model group (HG), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 2 × 10⁶ cells were cultured per well. 5 HRVECs cells were cultured for 6 h with Lipofectamine RNAiMAX Transfection Reagent (CatNo: 13778075, Thermo Fisher) and 30 nM RNA as shown in SEQ ID NO: 1. In the non-treatment group, 2 × 10⁶ cells were cultured per well. 5HRVECs cells were cultured for 6 h with Lipofectamine RNAiMAX Transfection Reagent and 30 nM RNA (NC-RNA) as shown in SEQ ID NO:2. Control group cells and model group cells were cultured in the same volume of culture medium for 6 h. After 6 h of culture, the treatment group cells, non-treatment group cells, and model group cells were treated for 24 h with DMEM medium containing 50 mM glucose, 12% fetal bovine serum, 1% penicillin, and 1% streptomycin (i.e., HG treatment; control group cells were not treated with HG).

[0032] 2) Discard the culture medium, wash the cells twice with PBS buffer, and then use EdU working solution (EdU stock solution diluted 1000 times with complete culture medium; EdU stock solution is from BeyoClick). TM EdU-488 Cell Proliferation Detection Kit (CatNo: C0071S, Beyotime) was added to a 24-well plate at a volume of 1 mL / well. After incubation for 2-3 hours, the EdU working solution was discarded, and 1 mL of 4% paraformaldehyde was added to each well for fixation at room temperature for 15 min. The paraformaldehyde was discarded, and 500 μL of washing buffer (PBS containing 3% BSA) was added to each well for washing 3 times, 3-5 min each time. The washing buffer was discarded, and 500 μL of permeabilization buffer (PBS containing 0.3% Triton X-100) was added to each well for incubation at room temperature for 10-15 min. The permeabilization buffer was discarded, and 500 μL of washing buffer was added to each well for washing 1-2 times, 3-5 min each time. The washing buffer was discarded, and 200 μL of Click reaction solution was prepared according to the manufacturer's instructions. Incubate with Click reaction solution at room temperature in the dark for 30 min; discard the reaction solution, add 500 μL of washing buffer to each well and wash 1-2 times, 3-5 min each time; discard the washing buffer, add 200 μL of DAPI to each well and incubate at room temperature in the dark for 10 min; discard the DAPI staining solution, add 500 mL of PBS to each well and wash 3 times, 3-5 min each time. Take images using a fluorescence microscope; the blue signal represents the DAPI signal, and the red signal represents the EdU signal.

[0033] like Figure 2 As shown, using HG to simulate a pathological environment, the proliferation signal of HRVECs cells after RNA treatment provided in this application embodiment is reduced, thereby indicating that the RNA treatment provided in this application embodiment can significantly inhibit the proliferation ability of HRVECs cells under HG-induced pathological conditions.

[0034] In some test cases, the inhibitory effect of RNA such as SEQ ID NO:1 on the tube-forming ability of human retinal vascular endothelial cells (HRVECs) was tested by matrix gel tube-forming assays.

[0035] The testing process includes:

[0036] 1) HRVECs cells were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin and 1% streptomycin at 37°C with 5% CO2 in a 24-well plate to a confluence of about 60% and divided into a model group (HG), a treatment group (RNA), a non-treatment group (NC) and a blank group (Ctrl). In the treatment group, 2 x 10 5 HRVECs cells per well were mixed with Lipofectamine RNAiMAX Transfection Reagent (Cat No: 13778075, Thermo Fisher) and 30 nM of RNA shown in SEQ ID NO: 1 for 6 h. In the non-treatment group, 2 x 10 5 HRVECs cells per well were mixed with Lipofectamine RNAiMAX Transfection Reagent and 30 nM of RNA (NC-RNA) shown in SEQ ID NO: 2 for 6 h. The same volume of culture solution was added to the cells in the blank group and the cells in the model group for 6 h. The cells in the treatment group, the cells in the non-treatment group and the cells in the model group cultured for 6 h were treated with DMEM medium containing 50 mM glucose, 12% fetal bovine serum, 1% penicillin and 1% streptomycin for 24 h (i.e. HG treatment was performed, and the cells in the blank group were not subjected to HG treatment).

[0037] 2) A total of 40 μL of Matrigel (Cat No: 356234, Corning, USA) was added to each well of the cells in each group and incubated for 20 min; the HRVECs in different groups were digested with trypsin-EDTA (Cat No: 25200114, Thermo Fisher) and centrifuged, and then resuspended to a density of 8 x 10 5 cells / mL; 500 μL of the cell suspension was seeded in a well containing only 40 μL of Matrigel and cultured for 4 to 6 h, and then observed under a microscope.

[0038] As shown in Figure 3 HG was used to simulate pathological conditions, and the RNA provided in the embodiments significantly reduced the tube formation ability of HRVECs cells under the pathological conditions induced by HG.

[0039] In some test examples, the inhibitory effect of RNA such as SEQ ID NO: 1 on the migration ability of HRVECs cells was tested by a Transwell migration experiment.

[0040] The test process included:

[0041] 1) HRVECs were cultured in DMEM medium containing 12% fetal bovine serum, 1% penicillin, and 1% streptomycin at 37°C with 5% CO2 in 24-well plates until confluence reached approximately 60%. The cells were then divided into a model group (HG), a treatment group (RNA), a non-treatment group (NC), and a blank group (Ctrl). In the treatment group, 2 × 10⁶ cells were cultured per well. 5 HRVECs cells were cultured for 6 h with Lipofectamine RNAiMAX Transfection Reagent (CatNo: 13778075, Thermo Fisher) and 30 nM RNA as shown in SEQ ID NO: 1. In the non-treatment group, 2 × 10⁶ cells were cultured per well. 5 HRVECs cells were cultured for 6 h with Lipofectamine RNAiMAX Transfection Reagent and 30 nM RNA (NC-RNA) as shown in SEQ ID NO:2. Control group cells and model group cells were cultured in the same volume of culture medium for 6 h. After 6 h of culture, the treatment group cells, non-treatment group cells, and model group cells were treated for 24 h with DMEM medium containing 50 mM glucose, 12% fetal bovine serum, 1% penicillin, and 1% streptomycin (i.e., HG treatment; control group cells were not treated with HG).

[0042] 2) After digesting and centrifuging the cells in each group with trypsin-EDTA, resuspend them in serum-free DMEM to a final volume of 4 × 10⁻⁶ cells / mL. 5 The density of HRVECs was determined; each group of HRVECs was seeded into Transwell chambers (Cat No: 53097, BDFalcon, USA) in 24-well plates, with 10% FBS medium at the bottom; after incubation at 37°C for 20 hours, the medium was removed from the 24-well plates, and the cells were washed three times with PBS for 15 min each time; after fixation with methanol for 15 min, the cells were washed three times with PBS, and then stained with 0.2% crystal violet (Cat No: C805211, Maclean's, China) for 3 min. Unmigrated cells in the upper wells were wiped off with cotton swabs and observed under a microscope.

[0043] like Figure 4 As shown, using HG to simulate a pathological environment, the RNA treatment provided in this application significantly reduces the migration ability of HRVECs cells under HG-induced pathological conditions.

[0044] In some test cases, the effect of RNA such as SEQ ID NO:1 on vascular leakage in the retina of STZ-induced diabetic model mice was tested in animal experiments with diabetic models.

[0045] The process of establishing a diabetic animal model includes: starving 8-week-old male C57 mice overnight (12h); preparing an injection solution (2.1g / 100mL citric acid, 2.9g / 100mL sodium citrate, 1.5% streptozotocin (CatNo: 2196GR001, Biofroxx GmbH, Germany)); injecting 0.1mL / 10mg into each mouse intraperitoneally (the solution was placed on ice and injected within 15 minutes); collecting tail vein blood to measure blood glucose one week later; if the blood glucose value is >=16.7mmol / L, the model is considered successfully established.

[0046] An Evans blue staining assay includes:

[0047] Healthy male C57 mice were used as the control group (Ctrl). STZ-induced diabetic mice were divided into a model group (DR), a treatment group (RNA), and a non-treatment group (NC). Three months after modeling, 2 μL of 20 μM RNA (as shown in SEQ ID NO:1) was injected intravitreally into the treatment group mice. 2 μL of 20 μM RNA (as shown in SEQ ID NO:2) (NC-RNA) was injected intravitreally into the control group mice. The model group and the control group received no treatment. Seven days after drug administration, mice in each group were intraperitoneally injected with ketamine (80 mg / kg) and toluenethiazide (4 mg / kg) for general anesthesia. Evans blue solution (30 mg / mL, Cat No: E2129, Sigma-Aldrich) was injected via the femoral vein using an insulin injector at a dose of 45 mg / kg. After 45 min of circulation, the mice were sacrificed, and the eyeballs were removed and fixed in 4% paraformaldehyde for 45 min. The retina was then fenestrated, placed on a glass slide, cut into a four-leaf clover shape, pressed into a slide, and observed under a fluorescence microscope.

[0048] like Figure 5 As shown, intravitreal injection of RNA such as SEQ ID NO:1 into STZ-induced diabetic model mice reduced vascular leakage in the retina of STZ-induced diabetic model mice.

[0049] In some test cases, the effect of RNA such as SEQ ID NO:1 in reducing cell-free capillaries in the retina of STZ-induced diabetic rat models was tested in animal experiments with diabetic models.

[0050] The testing process includes:

[0051] C57 male healthy mice were used as blank group (Ctrl), and STZ-induced diabetic model mice were divided into model group (DR), treatment group (RNA), and non-treatment group (NC). After 3 months of modeling, the treatment group mice were intravitreally injected with 2 μL of RNA as shown in SEQ ID NO: 1 at a concentration of 20 μM. The control group mice were intravitreally injected with 2 μL of RNA as shown in SEQ ID NO: 2 at a concentration of 20 μM (NC-RNA), and the model group and blank group were not treated. After 7 days of injection, the mice were sacrificed, and the eyeballs were placed in 10% neutral formaldehyde solution at 4°C for 24 hours. After windowing and dissection, the retinas were immersed in normal temperature water and shaken overnight. The retinas were placed in 0.1M Tris buffer (pH 7.8) containing 3% trypsin (Cat No: 1004GR025, Biofroxx GmbH, Germany) for digestion at 37°C for 1 hour. The retinas after digestion were placed on a glass slide, and 1 mL syringe was used to repeatedly blow and suck around the vascular network until the tissue around the blood vessels was removed. The glass slide was air-dried, and PAS staining was performed according to the instructions, and the slide was mounted and observed under a microscope.

[0052] As shown in Figure 6 After intravitreal injection of RNA as shown in SEQ ID NO: 1 into STZ-induced diabetic model mice, the number of acellular capillaries in the retinas of STZ-induced diabetic model mice was reduced.

[0053] In some test examples, qPCR experiments tested the effect of RNA as shown in SEQ ID NO: 1 on reducing the inflammation level in the retinas of STZ-induced diabetic model mice.

[0054] The test process included:

[0055] 1) C57 male healthy mice were used as blank group (Ctrl), and STZ-induced diabetic model mice were divided into model group (DR), treatment group (RNA), and non-treatment group (NC). After 3 months of modeling, the treatment group mice were intravitreally injected with 2 μL of RNA as shown in SEQ ID NO: 1 at a concentration of 20 μM. The non-treatment group mice were intravitreally injected with 2 μL of RNA as shown in SEQ ID NO: 2 at a concentration of 20 μM (NC-RNA), and the model group and blank group were not treated.

[0056] 2) Seven days after drug administration, mice were sacrificed, and their retinas were harvested. RNA was extracted from the retina of each group using a tissue RNA column extraction kit, and the quality and purity of the RNA were detected spectrophotometrically. cDNA was generated by reverse transcription using SYBR Green (CatNo: RC112-01, 18091050, 100029284, Nanjing Novizan Biotechnology Co., Ltd.) and then subjected to real-time quantitative PCR. 4 μL of 2×SYBE green qPCRmasterMix was used, along with 1 μL of a mixture of 10 μM upstream and downstream primers (as shown in Table 1), 1 μL of cDNA, and 4 μL of double-distilled water for amplification. Amplification was performed using an ABI 7500 Real-Time PCR system: 40 cycles of 95℃ for 30 s, 95℃ for 5 s, and 60℃ for 34 s, followed by melting curve analysis at 95℃ for 15 s, 60℃ for 1 min, 95℃ for 30 s, and 60℃ for 15 s. Each sample was replicated in triplicate. β-actin was used as an internal reference gene, and the results were analyzed based on the ct value using a 23... －△△ct The methods were calculated separately. In addition, the expression of IL-1β, IL-6 and TNF-α proteins in the retina of mice in each group was detected by mouse IL-1β, IL-6 and TNF-α ELISA kits (CatNo: MM-0040M2, MM-0163M2, MM-0132M2, Wuhan Enzyme Immunosorbent Assay Biotechnology Co., Ltd.).

[0057] Table 1

[0058]

[0059]

[0060] like Figure 7 As shown, intravitreal injection of RNA such as SEQ ID NO:1 into STZ-induced diabetic model mice reduced the level of inflammation in the mouse retina.

[0061] Based on the above test examples, this application found that RNA such as SEQ ID NO:1 and / or 2 has an inhibitory effect on the proliferation of human retinal vascular endothelial cells (HRVECs), inhibits HRVECs cell tube formation and migration, reduces vascular leakage in the mouse retina, reduces the number of cell-free capillaries in the mouse retina, and reduces the level of inflammation in the retina of STZ-induced diabetic model mice.

[0062] Based on this, an RNA is disclosed in the embodiments, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0063] The examples disclose the use of the RNA in the preparation of drugs for the prevention or treatment of diabetic retinopathy.

[0064] The embodiments disclose use of the RNA in preparation of a drug for preventing or treating diabetic retinal angiopathy.

[0065] The embodiments disclose use of the RNA in preparation of a drug for inhibiting inflammation related to fundus.

[0066] The embodiments disclose use of the RNA in preparation of a drug for inhibiting proliferation of retinal vascular endothelial cells.

[0067] The embodiments disclose use of the RNA in preparation of a drug for inhibiting retinal microvascular tube formation.

[0068] The embodiments disclose use of the RNA in preparation of a drug for inhibiting migration of retinal vascular endothelial cells.

[0069] The embodiments disclose use of the RNA in preparation of a drug for reducing the level of inflammatory factors in retina.

[0070] The embodiments disclose conjugates comprising the RNA according to the application.

[0071] In one embodiment of the application, the oligomeric compounds are linked to ligands / conjugates, which can be used, for example, to increase cellular uptake of the antisense RNA. Such conjugation can occur at the terminal position 5’ / 3’-OH, but the ligands can also occur on the sugars and / or bases. In particular, growth factors to which the antisense RNA can be conjugated can include transferrin or folate. Transferrin-polylysine-RNA complexes or folate-polylysine-RNA complexes can be prepared for uptake by cells expressing high levels of transferrin or folate receptors. Other examples of conjugates / ligands are cholesterol moieties, duplex intercalators such as acridines, poly-L-lysine, “capping” with one or more nuclease resistant linkages such as monothiophosphates, and the like. The application also provides conjugates comprising a compound according to the application as described herein, and at least one non-nucleotide or non-polynucleotide moiety covalently attached to the compound. Thus, in one embodiment in which the compound of the application consists of a specified nucleic acid, the compound can also comprise, as disclosed herein, at least one non-nucleotide or non-polynucleotide moiety (e.g., does not comprise one or more nucleotides or nucleotide analogs) covalently attached to the compound. The non-nucleotide base moiety can be, for example, or comprise a sterol such as cholesterol.

[0072] Thus, it will be appreciated that the RNA of the application, for example, the RNA used in a pharmaceutical (therapeutic) preparation, can comprise further non-nucleotide base components, for example, conjugates as defined herein.

[0073] Based on this, the embodiments disclose the RNA and a pharmaceutically acceptable diluent, carrier or adjuvant.

[0074] The RNA of the present application can be used directly or in the form of various pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salts" refers to salts that retain the desired biological activity of the RNA identified herein and exhibit minimal undesired toxicological effects. Non-limiting examples of such salts can be formed with organic amino acids, and base addition salts with metal cations or with cations formed from ammonium, N,N-dibenzylethylenediamine, D-glucosamine, tetraethylammonium, or ethylenediamine, for example, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, and the like.

[0075] In some embodiments, the RNA can be in the form of a prodrug. RNA is an ionically negatively charged in nature. Due to the lipophilic nature of the cell membrane, cellular uptake of RNA is reduced compared to neutral or lipophilic equivalents. This polar 'barrier' can be circumvented by using prodrug approaches (see, e.g., Crooke, R.M. (1998) in Crooke, S.T. Antisense research and Application. Springer-Verlag, Berlin, Germany, Vol. 131, pp. 103-140).

[0076] Pharmaceutically acceptable binding agents and adjuvants can constitute part of the formulated medicament.

[0077] The pharmaceutical compositions of the present application include, but are not limited to, solutions, emulsions, or liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Delivery of drugs to tumor tissue can be enhanced by carrier-mediated delivery, including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylenimine polymers, nanoparticles, and microspheres (Dass CR. J Pharm Pharmacol 2002; 54(1): 3-27). Pharmaceutical formulations of the present application, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques. Such techniques include the step of bringing into association active ingredient with a pharmaceutical carrier or excipient. In general, the preparations are prepared by uniformly and intimately bringing into association the active ingredient with a liquid carrier or a finely divided solid carrier or both. The product is then shaped or compacted as desired. Compositions of the present application can be formulated in any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gelcaps, liquid syrups, soft gels, and suppositories. Compositions of the present application can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension can also contain stabilizers. The compounds of the present application can also be conjugated to active pharmaceutical agents such as aspirin, ibuprofen, sulfa drugs, anti-diabetic agents, anti-bacterial agents, or antibiotics.

[0078] The above description is only preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto, and any person skilled in the art can easily think of changes or replacements within the technical scope disclosed in the present application, which should be covered in the protection scope of the present application.

Claims

1. Use of an RNA, characterized in that, The application is used for preparing a drug for preventing or treating diabetic retinopathy; the RNA nucleotide sequence is shown as SEQ ID NO:

1. The application is used for preparing a drug for preventing or treating diabetic retinopathy; the RNA nucleotide sequence is shown as SEQ ID NO:1.

Images