Expression cassette group, telomere-telomerase system and application of telomere-telomerase system

Abstract

The invention relates to the field of bioengineering, in particular to an expression cassette set, a telomere-telomerase system and application of the telomere-telomerase system. The invention provides an expression cassette group. The expression cassette group comprises an expression cassette 1 and an expression cassette 2, the expression cassette 1 comprises a URA3 tag, an ACT1 gene and a tos sequence; the expression box 2 comprises a telN gene and a nuclear localization sequence. The telomere-telomerase system provided by the invention can control formation and loss of linear chromosomes. And recognizing and cutting the tos site by utilizing a TelN enzyme to form a linear chromosome with a hairpin closed tail end. Meanwhile, the existence of the TelN enzyme can enable the linear chromosome to be stably copied, so that the formation and degradation of the linear chromosome can be controlled by controlling the expression of the TelN enzyme.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and particularly to expression cassette sets, telomere-telomerase systems and their applications. Background Art

[0002] The genome of Saccharomyces cerevisiae consists of 12 Mb of DNA and has 16 linear chromosomes. To maintain chromosomal stability, three important cis-elements are required during mitosis and meiosis, namely, a compact centromere, an origin of replication, and conserved telomere sequences. Eukaryotic chromosomes are linear and have natural ends similar to DNA double-strand breaks, namely, telomeres. The general structure and function of telomeres (as Figure 1 shown) are conserved. Telomeres and telomere-binding proteins together form a complex collectively referred to as "shelterin", which stabilizes a lasso structure called the telomere loop, thereby distinguishing the natural chromosome ends that should not be repaired from double-strand DNA breaks for maintaining chromosomal integrity and controlling the cell division cycle.

[0003] Yeast telomere sequences are irregular and can be generally summarized as T(G1-3). These sequences are replicated by the catalytic subunit of telomerase from the telomerase RNA template (TLC1 in yeast). Therefore, the RNA template is partially used, and in each round of telomerase activity, only very short fragments are replicated from different regions of the template. The telomeres of eukaryotic cells usually terminate with a G-rich 3' single-stranded DNA overhang. In addition to telomere sequences, the chromosomal ends of yeast have subtelomeric sequences, including two repeat units: X and Y' elements. The Y' element exists in 1-4 tandem repeats, and TG repeats are sometimes found between the X and Y' elements and between the Y' and Y' elements.

[0004] Telomerase is a ribonucleoprotein reverse transcriptase that functions to regulate telomere elongation. By repairing and extending the telomeres damaged during DNA replication, telomerase can increase the number of cell divisions and plays an important role in maintaining telomere stability, maintaining cell viability, and reactivating and delaying aging. In addition, studies have shown that in cells of different species, the reaction of telomerase to repair and extend telomeres is host-specific. Regardless of the origin of telomerase, the telomeres catalyzed and synthesized by it conform to the specificity of the host cell.

[0005] Phage N15 is the first known virus to transfer linear phage into Escherichia coli. Different from most temperate phages that integrate their genomes into the bacterial host chromosome, phage N15 replicates its genome in the form of non-integrated linear dsDNA with covalently closed ends in the Escherichia coli host. The replication of the N15 linear plasmid is due to the cleavage and ligation activity of the phage-encoded proto-telomerase TelN at the 22-bp palindromic telO sequence of its telomerase occupancy site (tos). The tos sequence consists of a series of inverted repeats (R1 / L1 to R3 / L3) located on both sides of the telO cleavage site (as shown in Figure 2 ). During the life cycle, the N15 replicon alternates between linear and circular forms. After infection of Escherichia coli, the linear virions circularize through their single-stranded cohesive ends, and then the TelN telomerase cleaves and reanneals within tos to form covalently closed telomeres. The resulting linear plasmid can serve as a template for synthesizing circular head-to-head dimers, be cleaved into linear forms by the TelN telomerase during the lysogenic cycle, or be decomposed into circular head-to-head monomers by the TelN telomerase during lytic development, and then undergo late replication similar to the λ type to produce linear virions. The telomeric ends of the linear plasmid promote its retention and replication in the bacterial host by protecting the plasmid from nuclease degradation. In short, the role of the TelN telomerase is to recognize the palindromic sequence of phage N15, have cleavage and ligation activities, and promote replication and lytic development. Insufficient levels of the normally functioning TelN telomerase will lead to abnormal and inefficient DNA replication and the accumulation of circular "head-to-head" dimers and circular "head-to-tail" monomers, and linear molecules cannot be formed.

[0006] The proto-telomerase TelN decomposes the tos site into hairpin telomeric ends (as shown in Figure 3 ), enabling phage N15 to stably replicate as a linear plasmid in Escherichia coli. This decomposition process does not involve host- or phage-derived intermediates or cofactors, so the host in a heterologous environment does not affect the linearization of phage DNA and the formation of hairpin structures by the TelN protein. SUMMARY OF THE INVENTION

[0007] In view of this, the present invention provides an expression cassette set, a telomere-telomerase system and its applications. The telomere-telomerase system provided by the present invention can control the formation and loss of linear chromosomes. By using the TelN enzyme to recognize and cleave the tos site, a linear chromosome with hairpin-closed ends is formed. At the same time, the presence of the TelN enzyme enables the stable replication of the linear chromosome, so the formation and degradation of the linear chromosome can be controlled by controlling the expression of the TelN enzyme.

[0008] To achieve the above invention purposes, the present invention provides the following technical solutions:

[0009] The present invention provides an expression cassette group, comprising: expression cassette 1 and expression cassette 2;

[0010] The expression cassette 1 comprises: a URA3 tag, an ACT1 gene, and a tos sequence;

[0011] The expression cassette 2 comprises: a telN gene and a nuclear localization sequence.

[0012] In some embodiments of the present invention, in the above-mentioned expression cassette group, the expression cassette 1 has:

[0013] (1) a nucleotide sequence as shown in SEQ ID NO:1; or

[0014] (2) a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (1), and having the same or similar function as the nucleotide sequence as shown in (1); or

[0015] (3) a nucleotide sequence having at least 80% identity with the nucleotide sequence as shown in (1) or (2); and

[0016] The expression cassette 2 has:

[0017] (4) a nucleotide sequence as shown in SEQ ID NO:2; or

[0018] (5) a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (4), and having the same or similar function as the nucleotide sequence as shown in (4); or

[0019] (6) a nucleotide sequence having at least 80% identity with the nucleotide sequence as shown in (4) or (5).

[0020] In some embodiments of the present invention, in the above-mentioned expression cassette group, the sequence of SEQ ID NO:1 is:

[0021]

[0022]

[0023] Wherein: the capital part is the sequence of the URA3 tag, the underlined part is the sequence of the ACT1 gene, the bold part is the XhoI restriction site, and the bold underlined part is the tos sequence.

[0024] In some embodiments of the present invention, in the above-mentioned expression cassette group, the sequence of SEQ ID NO:2 is:

[0025]

[0026]

[0027] Among them: The capitalized part is the sequence of the telN gene, and the bold part is the nuclear localization sequence.

[0028] In some embodiments of the present invention, in the above-mentioned expression cassette set, the expression cassette 1 further includes: the URA3 promoter.

[0029] In some embodiments of the present invention, in the above-mentioned expression cassette set, the sequence of the URA3 promoter is as shown in SEQ ID NO: 3: ttcaattcatcattttttttttattcttttttttgatttcggtttctttgaaatttttttgatt cggtaatctccgaacagaaggaagaacgaaggaaggagcacagacttagattggtatatatacgcatatgtagtgttgaagaaacatgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcaggaaacgaagataaatc.

[0030]

[0031] The present invention also provides an expression vector, comprising: the above-mentioned expression cassette set and acceptable genetic elements.

[0032] In some embodiments of the present invention, in the above-mentioned expression vector, the acceptable genetic elements include: His tag and / or Leu2 tag.

[0033] In some embodiments of the present invention, in the above-mentioned expression vector, the expression cassette 1 carries a His tag; the expression cassette 2 carries a Leu2 tag.

[0034] The present invention also provides a telomere-telomerase system, comprising: the above-mentioned expression cassette set and / or the above-mentioned expression vector.

[0035] The present invention also provides the use of the above-mentioned expression cassette, the above-mentioned expression vector and / or the above-mentioned telomere-telomerase system in regulating the linearization of the circular plasmid and / or circular chromosome of a strain.

[0036] The present invention also provides the use of the above-mentioned expression cassette, the above-mentioned expression vector and / or the above-mentioned telomere-telomerase system in regulating the loss and / or gene expression of the circular plasmid and / or circular chromosome of a strain.

[0037] The present invention also provides the use of the above-mentioned expression cassette, the above-mentioned expression vector and / or the above-mentioned telomere-telomerase system in regulating the formation and / or degradation of the linear chromosome of a strain.

[0038] In some embodiments of the present invention, in the above-mentioned use, the strain includes: Saccharomyces cerevisiae.

[0039] The present invention also provides a method for regulating the formation and / or degradation of the linear chromosome of a strain, comprising the following steps: transferring the above-mentioned expression vector into the strain and culturing.

[0040] The beneficial effects of the present invention include:

[0041] (1) Based on the TelN / tos module of phage, the present invention develops a novel telomere system in Saccharomyces cerevisiae. Using gene editing technology, the tos site is inserted into the circular plasmid and chromosome, and the tos site is specifically modified by expressing the TelN enzyme to form a linear chromosome with two hairpin-closed ends. Experiments confirm that this novel telomere system can replace the natural telomere of Saccharomyces cerevisiae, and this system can be used to control the stability of artificial chromosomes.

[0042] (2) The URA3-ACT1-tos cassette provided by the present invention is easy to construct and screen, and can efficiently insert or replace new telomeres on chromosomes. At the same time, after the TelN enzyme recognizes and cleaves the Tos site, it can be determined whether the chromosome is linear through auxotrophic screening, which is simple and convenient.

[0043] (3) The yeast telN gene plasmid provided by the present invention can control the linearization of circular plasmids or chromosomes carrying the URA3-ACT1-tos cassette, and thus control the loss of circular plasmids or chromosomes and gene expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0045] Figure 1 Showing the schematic diagram of the telomere structure of Saccharomyces cerevisiae;

[0046] Figure 2 Showing the schematic diagram of the structure of the telomere occupancy site (tos);

[0047] Figure 3 Showing the telRL site and the hairpin end sequence of bacteriophage N15;

[0048] Figure 4 Showing the plasmid schematic diagram; wherein: the left figure shows the plasmid schematic diagram with expression cassette 1 and His3 tag in Example 1; the right figure shows the plasmid schematic diagram with expression cassette 2 and Leu2 tag in Examples 1 and 2;

[0049] Figure 5 Showing the single colony of Saccharomyces cerevisiae with the tos site in the circular plasmid cleaved; wherein: the left figure shows the growth of the Saccharomyces cerevisiae strain on the SC-Leu-His+5foa plate; the right figure shows the growth of the Saccharomyces cerevisiae strain on the SC-Leu-His-Ura plate;

[0050] Figure 6 Showing the dot blot of the loss rate of the His tag in subculture; wherein: the upper figure shows the growth of the strain with / without expression cassette 2 on the SC-Leu plate; the lower figure shows the growth of the strain with / without expression cassette 2 on the SC-Leu-His plate;

[0051] Figure 7 Showing the schematic diagram of the wild-type circular Saccharomyces cerevisiae chromosome No. 5;

[0052] Figure 8Single colonies of Saccharomyces cerevisiae showing the cleavage of the tos site in circular chromosomes; where: the left figure shows the growth of the Saccharomyces cerevisiae strain on the SC-Leu + 5foa plate; the right figure shows the growth of the Saccharomyces cerevisiae strain on the SC-Leu-Ura plate. Detailed implementation manners

[0053] The present invention discloses expression cassette sets, telomere-telomerase systems and their applications.

[0054] It should be understood that the expression "one or more of..." individually includes each of the objects recited after the said expression and various different combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0055] The terms "comprising", "having" or "containing", including the use of their grammatical synonyms, should generally be understood as open and non-restrictive, for example, not excluding other unrecited elements or steps, unless specifically stated otherwise or understood from the context otherwise.

[0056] It should be understood that as long as the present invention is still operable, the order of steps or the order of performing certain actions is not important. In addition, two or more steps or actions can be carried out simultaneously.

[0057] The use of any and all examples or exemplary language in this article, such as "for example" or "including", is only intended to better illustrate the present invention and does not limit the scope of the present invention unless a claim is made. No language in this specification should be construed as indicating that any unclaimed element is essential for the practice of the present invention.

[0058] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant values in the specific embodiments have been presented as precisely as possible here. However, any value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise clearly stated, it should be understood that all ranges, quantities, values and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0059] Based on the TelN / tos module, the present invention uses gene editing technology to insert the tos site into circular plasmids and chromosomes respectively, and introduces the TelN enzyme for site-specific cleavage, and designs and constructs an orthogonal telomere system.

[0060] The present invention constructs a URA3-ACT1-tos cassette and homologous arm sequences. By circularizing the wild-type chromosome of Saccharomyces cerevisiae, it is possible to determine whether the chromosome is linear through auxotrophic screening.

[0061] The present invention constructs a telN gene expression vector, which can control the linearization of circular plasmids or chromosomes carrying the URA3-ACT1-tos cassette, and thus control the loss of circular plasmids or chromosomes and gene expression.

[0062] In Examples 1 and 2 of the present invention, the raw materials and reagents used can be purchased from the market.

[0063] The following further elaborates the present invention in conjunction with examples:

[0064] Example 1 Circular Plasmid

[0065] We first constructed a URA3-ACT1-tos cassette that does not affect the function of the URA3 tag and assembled it on a shuttle plasmid with a His3 tag. Then the above shuttle plasmid was transferred into wild-type Saccharomyces cerevisiae BY4742 to obtain a chassis bacterium. A plasmid carrying the telN gene and a Leu2 tag was transferred into the chassis bacterium and spread on an SC-Leu-His+5foa plate. Then the single colonies that grew were streaked on an SC-Leu-His-Ura plate, and strains that could not grow on the SC-Leu-His-Ura plate were selected (as Figure 5 shown), indicating that the URA3 tag on the circular plasmid in the strain was destroyed due to the cleavage of the Tos site by the TelN enzyme.

[0066] To illustrate the effect of the TelN enzyme on the maintenance of linear plasmids with cleaved Tos sites in Saccharomyces cerevisiae, the strain was inoculated into an SC-Leu liquid medium for culture. After 24 h of culture, it was transferred for subculture, and at the same time, the bacterial liquid was taken for serial dilution. 3 μL of the bacterial liquid was taken for each concentration gradient and spotted on Sc-Leu and Sc-Leu-His medium plates. After 48 h of culture, the growth of the strains was photographed and recorded. The results are as Figure 6 shown. The results show that the expression of the TelN enzyme can better maintain linear plasmids with Tos ends in Saccharomyces cerevisiae.

[0067] Example 2 Circular Chromosome

[0068] We first constructed a URA3-ACT1-tos cassette that does not affect the function of the URA3 tag, and obtained the left and right homologous arms of the telomere of wild-type chromosome V of Saccharomyces cerevisiae by PCR amplification. Then, the homologous arms were ligated to both ends of the URA3-ACT1-tos cassette using the OE-PCR method. Subsequently, the above DNA fragment was transferred into wild-type Saccharomyces cerevisiae BY4742 to obtain the chassis strain. A plasmid carrying the telN gene and the Leu2 tag was transferred into the chassis strain, and the cells were spread on an SC-Leu+5foa plate. Then, the single colonies that grew were streaked on an SC-Leu-Ura plate, and the strains that could not grow on the SC-Leu-Ura plate were selected (as shown in Figure 8 ), indicating that the URA3 tag on the circular chromosome in this strain was disrupted due to the cleavage of the tos site by the TelN enzyme.

[0069] To illustrate the effect of the TelN enzyme on the maintenance of linear chromosomes with cleaved Tos sites in Saccharomyces cerevisiae, the strain was inoculated into YPD liquid medium for culture. After 24 h of culture, it was subcultured once. At the same time, the bacterial liquid was streaked on a YPD medium plate. After 48 h of culture, single colonies on the plate were picked and streaked on YPD and Sc-Leu medium plates. After 48 h of culture, the growth of the strains was photographed and recorded, and the loss rate was calculated (loss rate = 1 - number of SC-Leu single colonies / number of YPD single colonies). The results are shown in Table 1. The results indicate that the expression of the TelN enzyme can better maintain linear chromosomes with Tos ends in Saccharomyces cerevisiae.

[0070] Table 1 Loss rate of His tag during subculture

[0071]

[0072] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An expression cassette set, characterized in that include: Expression cassette 1 and expression cassette 2; The expression cassette 1 includes: a URA3 tag, an ACT1 gene and a tos sequence; The expression cassette 2 includes: telN gene and nuclear localization sequence.

2. The expression cassette set according to claim 1, characterized in that The expression cassette 1 has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (1) or (2); and The expression cassette 2 has: (4) the nucleotide sequence shown in SEQ ID NO: 2; or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5).

3. An expression vector, characterized in that include: The expression cassette set as claimed in claim 1 or 2 and acceptable genetic elements.

4. The expression vector according to claim 3, characterized in that The acceptable genetic elements include: His tag and / or Leu2 tag.

5. A telomere-telomerase system, characterized in that include: The expression cassette set according to claim 1 or 2 and / or the expression vector according to claim 3 or 4.

6. Use of the expression cassette set according to claim 1 or 2, the expression vector according to claim 3 or 4 and / or the telomere-telomerase system according to claim 5 in linearizing a circular plasmid and / or a circular chromosome of a regulatory strain.

7. Use of the expression cassette set according to claim 1 or 2, the expression vector according to claim 3 or 4 and / or the telomere-telomerase system according to claim 5 in regulating the loss of circular plasmids and / or circular chromosomes and / or gene expression in bacterial strains.

8. Use of the expression cassette set according to claim 1 or 2, the expression vector according to claim 3 or 4 and / or the telomere-telomerase system according to claim 5 in regulating the formation and / or degradation of linear chromosomes of a strain.

9. The use according to any one of claims 6 to 8, characterized in that The strains include: Saccharomyces cerevisiae.

10. A method for regulating the formation and / or degradation of linear chromosomes of a strain, characterized in that: The method comprises the following steps: transferring the expression vector as claimed in claim 3 or 4 into a bacterial strain, and culturing the bacterial strain.

Images