Actinidia chinensis bacterial canker susceptible gene AcADC1 and application thereof

Abstract

The invention discloses a kiwi fruit bacterial canker susceptible gene AcADC1 and application thereof, and belongs to the technical field of gene engineering. The nucleotide sequence of the AcADC1 gene is shown as SEQ ID NO: 1, kiwi fruit arginine decarboxylase (ADC) is coded and synthesized, the amino acid sequence is shown as SEQ ID NO: 2, and the AcADC1 gene is responsible for catalyzing arginine (Arg) to generate putrescine. The resistance of a kiwi fruit plant with a silent AcADC1 gene to bacterial canker is improved, the resistance of a kiwi fruit plant with an over-expressed AcADC1 gene to bacterial canker is reduced, the AcADC1 gene plays a negative regulation role in the immune response of kiwi fruit to bacterial canker, the AcADC1 gene can be edited by using a gene editing technology, and the AcADC1 gene can be used for preparing the kiwi fruit bacterial canker. And a theoretical basis and gene reserve are provided for disease-resistant breeding of kiwi fruits.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and relates to the susceptibility gene AcADC1 of kiwifruit bacterial canker and its application. Background Art

[0002] Kiwifruit canker is caused by Pseudomonas syringae pv. Actinidiae (Psa), and is one of the common diseases of kiwifruit. This disease can damage the above-ground and underground roots of kiwifruit. The main affected parts are the trunk, branches, leaves and flowers. The main symptoms are branch cankers, leaf spots and flower rots. When the branches or twigs are diseased, the cortical tissue becomes soft and slightly bulges on the surface. Subsequently, the diseased part cracks, showing canker symptoms. The phloem rots to the xylem, showing dark brown lesions, which affects the up and down transport and absorption of nutrients, and ultimately causes the tree body to be unhealthy. After the shoots are infected, the petioles and pedicels inside them turn brown, the leaves and flower buds wither and even die, and ultimately it will even cause the phenomenon of tree death and orchard destruction, causing huge losses to the kiwifruit industry.

[0003] Polyamines (PAs) are low-molecular-weight nitrogenous aliphatic compounds that are ubiquitously present in eukaryotic and prokaryotic cells. In higher plants, the most common polyamines include diamines such as putrescine (Put), cadaverine (Cad), triamines such as spermidine, tetraamines such as spermine, and its isomer thermospermine. Among them, putrescine (Put) has the highest content in nature and is the central product of the PAs biosynthesis pathway. It is mainly synthesized by two pathways: one is catalyzed by arginine decarboxylase (ADC) from arginine (Arg), and the other is catalyzed by ornithine decarboxylase (ODC) from ornithine (Orn). However, the activities of ADC and ODC can be irreversibly inhibited by difluoromethylarginine (DFMA) or difluoromethylornithine (DFMO), respectively. Putrescine plays an important role in regulating plant growth and development, controlling morphogenesis, delaying senescence, and resisting diseases, cold, drought, salt, and other stresses. There is evidence that when infected by pathogens, the accumulation of putrescine in the host body is beneficial to enhancing its disease resistance. For example, when a virus infects tobacco highly resistant to TMV, the putrescine synthase in its body is significantly up-regulated, but not in susceptible varieties; the putrescine level in maize increases after being infected by Ustilago maydis; overexpression of arginine decarboxylase (ADC) increases the putrescine content in Arabidopsis, thereby resisting the infection of Botrytis cinerea; in ADC function-deficient mutants and silenced lines, the decrease in putrescine level leads to pathogen susceptibility; in Arabidopsis, overexpression of the AtADC2 gene and the supplementation of putrescine can induce the expression of plant defense genes and stimulate the biosynthesis of local salicylic acid. In addition, some pathogens can utilize host putrescine to achieve successful infection. For example, Ralstonia solanacearum induces the up-regulation of putrescine in tomatoes through the transcription-activator-like effector (TALEs) Brg11, thus gaining a competitive advantage during infection; Fusarium graminearum can utilize the large amount of putrescine induced in wheat during its infection to stimulate the synthesis of DON toxin. However, it is still unclear whether putrescine is beneficial to the host's disease resistance or will be utilized by pathogens in kiwifruit. Based on this, analyzing the effects of putrescine and its synthetic gene expression levels on the disease resistance of kiwifruit will be of great significance for the cultivation of kiwifruit varieties resistant to bacterial canker. Summary of the Invention

[0004] There is still a lack of research on the effect of putrescine synthesis in kiwifruit plants on the disease resistance of kiwifruit. Starting from the determination of the difference in putrescine content between different resistant and susceptible varieties, the present invention studies the effect of the expression level of putrescine synthesis genes on the disease resistance of kiwifruit. On this basis, the present invention provides a kiwifruit bacterial canker susceptibility gene AcADC1 and its application, realizing the cultivation of disease-resistant kiwifruit varieties.

[0005] In the first aspect, the present invention provides a kiwifruit bacterial canker susceptibility gene AcADC1, and the nucleotide sequence of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:1.

[0006] Furthermore, in the kiwifruit bacterial canker susceptibility gene AcADC1 provided by the present invention, silencing the kiwifruit bacterial canker susceptibility gene AcADC1 can improve the resistance of kiwifruit to kiwifruit bacterial canker.

[0007] Furthermore, in the kiwifruit bacterial canker susceptibility gene AcADC1 provided by the present invention, the nucleotide sequence of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:3.

[0008] Furthermore, in the kiwifruit bacterial canker susceptibility gene AcADC1 provided by the present invention, the primer sequences for PCR amplification of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 are shown in SEQ ID NO:4-5.

[0009] Furthermore, in the kiwifruit bacterial canker susceptibility gene AcADC1 provided by the present invention, the arginine decarboxylase encoded and synthesized by the kiwifruit bacterial canker susceptibility gene AcADC1 has an amino acid sequence shown in SEQ ID NO:2.

[0010] In the second aspect, the present invention provides a method for cultivating disease-resistant kiwifruit varieties by silencing the kiwifruit bacterial canker susceptibility gene AcADC1 or the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 in kiwifruit plants;

[0011] The nucleotide sequence of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:1;

[0012] The nucleotide sequence of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:3.

[0013] Further, in a method for cultivating a kiwifruit variety resistant to bacterial canker provided by the present invention, it includes: constructing a vector containing a silencing fragment of the gene AcADC1, transferring the vector into Agrobacterium, and then transfecting kiwifruit with the obtained Agrobacterium to obtain the variety.

[0014] Further, in a method for cultivating a kiwifruit variety resistant to bacterial canker provided by the present invention, the type of the Agrobacterium is GV3101.

[0015] In the third aspect, the present invention provides the application of the kiwifruit bacterial canker susceptible gene AcADC1 in the resistance of kiwifruit to bacterial canker.

[0016] Further, in the application provided by the present invention, silencing the kiwifruit bacterial canker susceptible gene AcADC1 can improve the resistance of kiwifruit to bacterial canker.

[0017] Compared with the prior art, the technical solution provided by the present invention at least has the following beneficial effects or advantages:

[0018] In the present invention, the putrescine synthesis gene AcADC1 in kiwifruit plants plays a role in the interaction between kiwifruit and Psa, and has a negative regulatory effect in the immune response of kiwifruit to bacterial canker.

[0019] The present invention clarifies the function of the AcADC1 gene: after transient overexpression of the AcADC1 gene, it shows susceptibility to Psa, and the lesion area and pathogen biomass increase significantly; after silencing the AcADC1 gene, it shows resistance to Psa, and the lesion area and pathogen biomass decrease significantly. The AcADC1 gene is a susceptible gene.

[0020] Based on the fact that the AcADC1 gene plays a negative regulatory role in the immune response of kiwifruit plants to bacterial canker, the AcADC1 gene can be used to create kiwifruit varieties resistant to bacterial canker. The specific method is: silencing the AcADC1 gene in kiwifruit plants, and the method for silencing the AcADC1 gene is not limited to the Agrobacterium-mediated method.

[0021] The clarification of the function of the AcADC1 gene in the present invention provides a new direction for the cultivation of kiwifruit varieties resistant to canker, and also provides an important theoretical basis for the safe and sustainable prevention and control of kiwifruit canker. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1Determination of putrescine content in kiwifruit varieties resistant and susceptible to canker disease and the occurrence of canker disease in leaves of Hongyang kiwifruit after exogenous addition of different concentrations of putrescine (Put). Among them, A is the graph of the determination result of putrescine content in kiwifruit varieties resistant and susceptible to canker disease; B is the graph of the occurrence of canker disease in leaves of Hongyang kiwifruit after exogenous addition of different concentrations of putrescine; Control is the blank control; 10μM Put, 100μM Put, 200μM Put are different concentrations of putrescine; H2O is the negative control.

[0023] Figure 2 Symptoms of Hongyang kiwifruit leaves after inoculation with Psa M228 for 5 days after using putrescine synthesis inhibitor. Among them, H2O is the negative control; Psa M228 is inoculated with Psa M228 only; Psa M228+DMFA is inoculated with Psa M228 and DMFA simultaneously, and DMFA is the putrescine synthesis inhibitor.

[0024] Figure 3 The disease occurrence of Hongyang kiwifruit leaves 5 days after inoculation with Psa after silencing of AcADC1 gene and the relative expression level after silencing of AcADC1 gene. Among them, A is the disease occurrence of Hongyang kiwifruit leaves 5 days after inoculation with Psa after silencing of AcADC1 gene; B is the relative expression level after silencing of AcADC1 gene; TRV:00 is Agrobacterium carrying pTRV1:pTRV2 vector; TRV:AcADC1 is Agrobacterium carrying pTRV1:pTRV2-AcADC1 vector.

[0025] Figure 4 The disease occurrence of Hongyang kiwifruit leaves 5 days after inoculation with Psa after transient overexpression of AcADC1 gene and the relative expression level of transient overexpression of AcADC1 gene. Among them, A is the disease occurrence of Hongyang kiwifruit leaves 5 days after inoculation with Psa after transient overexpression of AcADC1 gene; B is the relative expression level of transient overexpression of AcADC1 gene; H2O is the negative control; CK represents Agrobacterium carrying overexpression vector pCAMBIA1302; OE-AcADC1 represents transient overexpression of AcADC1 gene. Detailed implementation methods

[0026] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are all conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0027] The vectors pTRV1, pTRV2, pCAMBIA1302 and the pathogen of kiwifruit bacterial canker, Pseudomonas syringae pv. actinidae (Psa) involved in the following examples were all provided by Northwest A&F University. The highly susceptible kiwifruit cultivar 'Hongyang', the susceptible cultivar 'Nongda Jinmi', the moderately susceptible cultivars 'Xuxiang' and 'Cuixiang', the resistant cultivar 'Hayward' and the highly resistant cultivar 'Longcheng 2' were all collected from Yangling Xintiandi Orchard.

[0028] Example 1

[0029] This example provides a method for determining the putrescine content in different kiwifruit cultivars.

[0030] Weigh 1 g of kiwifruit leaves of different cultivars (including cultivars such as 'Hongyang', 'Nongda Jinmi', 'Xuxiang', 'Cuixiang', 'Hayward' and 'Longcheng 2') with fresh weight, grind them into powder in liquid nitrogen, add 4 mL of 5% (v / v) perchloric acid aqueous solution, incubate for 1 h in an ice bath after homogenization. Then centrifuge at 4 °C and 10,000 g for 40 min, take 2 mL of the supernatant into a new centrifuge tube, first add 2 mL of 4 M NaOH to neutralize perchloric acid, then add 7 μL of benzoyl chloride, incubate at 37 °C for 25 min to derivatize putrescine. Add 2 mL of saturated NaCl solution and ether for extraction, dry the ether containing polyamines with a nitrogen blower, redissolve it with methanol, and filter it through a 0.22 μm filter membrane (organic phase) for later measurement. For the putrescine standard, except for the above-mentioned perchloric acid extraction operation, the same method was used for sample preparation. Quantitative analysis was carried out using a high-performance liquid chromatography system (Waters, W2690 / 5 high-performance liquid chromatography pump / 2998 UV detector, USA). The sample injection volume was 10 μL, and a Waters SymmetryShieldTM RP18 chromatographic column (3.9×20 mm, 5 μm) was used; the column temperature was 30 °C; the mobile phase A was methanol (51%), and the mobile phase B was ultrapure water (49%); the flow rate was 0.7 mL / min; the running time was 20 min, and the putrescine signal of the sample was recorded at 230 nm. The detection results are as Figure 1 shown in A of the following figure. The putrescine content in the highly susceptible cultivar 'Hongyang' and the susceptible cultivar 'Nongda Jinmi' was higher than 100 μmol / g, the putrescine content in the moderately susceptible cultivars 'Xuxiang' and 'Cuixiang' was between 50 - 100 μmol / g, while almost no putrescine was detected in the resistant cultivar 'Hayward' and the highly resistant cultivar 'Longcheng 2'.

[0031] This example also verified the incidence of bacterial canker in the leaves of 'Hongyang' kiwifruit after adding exogenous putrescine. The specific measurement method includes: soaking the healthy kiwifruit leaves of the 'Hongyang' variety in a 0.6% sodium hypochlorite solution for 10 min for surface disinfection, washing 3 times with sterile water, and air-drying. Subsequently, leaf discs were prepared using a perforator with a diameter of 11 mm (avoiding leaf veins and large lateral veins) and placed in 100 mL centrifuge tubes containing 60 mL of 10 4 CFU / mL Psa M228. The leaves were infiltrated 3 times using a vacuum pump (0.1 MPa) until the back of the leaves was more than 90% wet. Finally, the leaf discs infiltrated with Psa M228 were placed face-down and neatly arranged on water agar plates, water agar plates containing 10 μM, 100 μM, and 200 μM, respectively. They were cultured for 16 h under 16 °C light conditions and 8 h under dark conditions. The incidence was measured 5 days after inoculation. During the experiment, infiltrating with H2O using a vacuum pump served as a negative control. The experimental results are shown as Figure 1 shown in B of the figure. Without adding exogenous putrescine (Put), the brown area on the kiwifruit leaves was small; when the concentration of exogenous putrescine increased from 10 μM to 200 μM, the brown area on the kiwifruit leaves increased with the increase in putrescine concentration.

[0032] Example 2

[0033] This example provides a method for measuring the incidence of kiwifruit after inoculation with Psa after using a putrescine synthesis inhibitor.

[0034] Soak the healthy kiwifruit leaves of the 'Hongyang' variety in a 0.6% sodium hypochlorite solution for 10 min for surface disinfection, wash 3 times with sterile water, and air-dry. Subsequently, leaf discs were prepared using a perforator with a diameter of 11 mm (avoiding leaf veins and large lateral veins) and placed in 100 mL centrifuge tubes containing 60 mL of 10 4 CFU / mL Psa M228 and 60 mL of 10 4 CFU / mL Psa M228 + 2 mM DFMA (putrescine synthesis inhibitor). The leaves were infiltrated 3 times using a vacuum pump (0.1 MPa) until the back of the leaves was more than 90% wet. Finally, the leaf discs infiltrated with Psa M228 and Psa M228 + DFMA were placed face-down and neatly arranged on a water agar plate and a water agar plate containing 2 mM DFMA, respectively. They were cultured for 16 h under 16 °C light conditions and 8 h under dark conditions. The incidence was measured 5 days after inoculation. During the experiment, infiltrating with H2O using a vacuum pump served as a negative control. The experimental results are shown as Figure 2 shown in the figure. Using a putrescine synthesis inhibitor is mainly to inhibit the activity of ADC, and the use of a putrescine synthesis inhibitor can reduce the brown area of kiwifruit after inoculation with Psa.

[0035] Example 3

[0036] This example provides a method for obtaining the AcADC1 gene.

[0037] The nucleotide sequence of the AcADC1 gene obtained based on the kiwifruit genome V3.0 is shown in SEQ ID NO:1, and the amino acid sequence of the kiwifruit arginine decarboxylase (ADC) encoded by the AcADC1 gene is shown in SEQ ID NO:2.

[0038] Extract the RNA of kiwifruit leaves of the "Hongyang" variety using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., product number 0416-50), and obtain cDNA using a reverse transcription kit (ThermoFisher Scientific, product number K1162). Using cDNA as a template, design primers for the full-length sequence of the AcADC1 gene and perform PCR amplification.

[0039] Primer sequences for PCR amplification of the AcADC1 gene:

[0040] Forward primer: (5’-ATGCCGGCCCTCGCTTGTTTC-3’);

[0041] Reverse primer: (5’-TCAACGCTTAAGTGAGTAC-3’).

[0042] The PCR amplification system includes: 25 μL of 2×Phanta Max Master Mix, 1 μL of template cDNA, and add water to 50 μL.

[0043] PCR amplification program: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, cycle 35 times; finally, extension at 72°C for 5 min.

[0044] Perform electrophoresis separation on an agarose gel. Purify the PCR product using the Magen gel recovery kit HiPure Gel Pure DNA MiniKit.

[0045] Example 4

[0046] This example provides a method for constructing an AcADC1 gene silencing vector.

[0047] Extract total RNA from kiwifruit and reverse transcribe it into cDNA. Design primers according to the sequence of the AcADC1 gene (SEQ ID NO:1) to amplify a partial fragment for the construction of the AcADC1 gene silencing vector. Perform PCR amplification on a partial fragment of the AcADC1 gene to obtain a nucleotide sequence of 407 bp in length (SEQ ID NO:3), which is the specific fragment of the AcADC1 gene.

[0048] Primers for amplifying the nucleotide sequence shown in SEQ ID NO:3:

[0049] Forward primer (SEQ ID NO:4): (5’-GTGAGCTCGGTACCGGATCCGAGGG GCTCGCAGAGGATGC-3’);

[0050] Reverse primer (SEQ ID NO:5): (5’-TGAGTAAGGTTACCGAATTCTGCAA CGGCAAGCTCGAT-3’).

[0051] PCR amplification program: Pre-denature at 95°C for 2 min; denature at 95°C for 15 s, anneal at 55°C for 15 s, extend at 72°C for 10 s, for 35 cycles; finally extend at 72°C for 5 min.

[0052] The PCR products were analyzed by electrophoresis on 1% agarose gel, and the PCR products were purified using the Magen Gel Extraction Kit HiPure GelPure DNA Mini Kit. The purified PCR products were ligated to the BamHI / EcoRI-digested pTRV2 vector according to the operating method of the ClonExpress II One Step Cloning Kit (Vazyme) to obtain the recombinant plasmid pTRV2-AcADC1 capable of silencing the AcADC1 gene. The recombinant plasmid was transformed into competent Escherichia coli DH5α cells, spread on an LB plate (containing 50 μg / mL kanamycin), and after culturing at 37°C for 16 h, colony PCR verification was performed. Three clones were picked, and according to the operation of the plasmid extraction kit (Takara), the TRV2-AcADC1 plasmid was extracted. The sequence of the TRV2-AcADC1 plasmid is shown in SEQ ID NO:3. The plasmid with correct sequencing was heat-shock transformed into Agrobacterium tumefaciens GV3101, spread on an LB plate (containing 50 μg / mL kanamycin and 50 μg / mL rifampicin), and after culturing at 28°C for 48 h, colony PCR verification was performed. The correct clones were picked for subsequent experiments.

[0053] Example 5

[0054] This example provides a method for constructing an AcADC1 gene transient overexpression vector.

[0055] Based on the kiwifruit genome V3.0, the nucleotide sequence of the AcADC1 gene is shown in SEQ ID NO:1, and the amino acid sequence encoded by the AcADC1 gene is shown in SEQ ID NO:2.

[0056] The RNA of kiwifruit leaves of the "Hongyang" variety was extracted using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., product number 0416-50), and cDNA was obtained using a reverse transcription kit (ThermoFisher Scientific, product number K1162). Using the cDNA as a template, primers were designed for the full-length sequence of the AcADC1 gene and PCR amplification was performed.

[0057] Primer sequences for PCR amplification of the AcADC1 gene:

[0058] Forward primer: (5’-GGGGACTCTTGACCATGGATGCCGGCCCTCGCTTGTT TC-3’);

[0059] Reverse primer: (5’-CTCACCATCCTAGGACTAGTTCAACGCTTAAGTGAGT AC-3’).

[0060] The PCR amplification system includes: 25 μL of 2×Phanta Max Master Mix, 1 μL of template cDNA, and water was added to 50 μL.

[0061] PCR amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, for 35 cycles; finally, extension at 72°C for 5 min.

[0062] The PCR product was analyzed by electrophoresis on a 1% agarose gel, and the PCR product was purified using the Magen Gel Extraction Kit HiPure GelPure DNA Mini Kit. The purified product was ligated to the NcoI / SpeI digested pCAMBIA1302 vector to obtain the recombinant 1302-AcADC1 plasmid according to the method of the ClonExpress II One Step Cloning Kit (Vazyme) according to the kit instructions.

[0063] The plasmid was transformed into Escherichia coli DH5α competent cells, and the cells were spread on an LB plate (containing 50 μg / mL kanamycin). After culturing at 37 °C for 16 h, colony PCR verification was performed. Three clones were picked and plasmids were extracted according to the operation of the plasmid extraction kit (Takara) and sequenced (Shanghai Sangon Biotech Co., Ltd.). The sequence is shown in SEQ ID NO:1. The plasmid with correct sequencing was heat-shock transformed into Agrobacterium tumefaciens GV3101, and the cells were spread on an LB plate (containing 50 μg / mL kanamycin and 50 μg / mL rifampicin). After culturing at 28 °C for 48 h, colony PCR verification was performed, and correct clones were picked for subsequent experiments.

[0064] Example 6

[0065] This example provides the disease susceptibility of kiwifruit after silencing and overexpressing the AcADC1 gene in kiwifruit.

[0066] 1. Agrobacterium culture

[0067] Two days before inoculation, Agrobacterium tumefaciens GV3101 containing TRV1:TRV2 (v:v = 1:1), TRV1:TRV2-AcADC1 (TRV2 vector containing the AcADC1 gene silencing fragment), pCAMBIA1302, and pCAMBIA1302-AcADC1 (pCAMBIA1302 vector containing the AcADC1 gene) was inoculated into an LB culture medium containing 50 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured on a shaker at 28 °C and 220 rpm until the OD 600 value reached 0.5. Then it was washed 3 times with 10 mM MgCl2 buffer and resuspended with freshly prepared Agrobacterium infection solution MMA (containing 0.2 mM AS (acetosyringone), 10 mM MgCl2, 10 mM MES, pH 5.6). The Agrobacterium tumefaciens GV3101 containing different plasmids was wrapped with tin foil and placed at room temperature in the dark for 3 h for standby.

[0068] 2. Agrobacterium leaf disc vacuum infiltration method

[0069] Take several healthy leaves of the 2-year-old disease-susceptible variety "Hongyang" kiwifruit. The leaves should be of uniform size and growth. Wash them thoroughly with tap water, surface disinfect them with 0.6% sodium hypochlorite for 10 min, and rinse them 3 times with sterile water until there is no pungent smell. Finally, dry the residual moisture on the leaf surface with sterile filter paper. Use a sterile punch Prepare leaf discs, and place the leaf discs in GV3101 Agrobacterium tumefaciens containing 60 mL of different plasmids respectively, with 30 - 50 leaf discs in each tube. For both gene silencing and overexpression, the leaves of the "Hongyang" variety are used as experimental materials. Among them, GV3101 Agrobacterium tumefaciens containing the plasmid pTRV1:pTRV2 (v:v = 1:1) is used as the control for silencing the AcADC1 gene, and GV3101 Agrobacterium tumefaciens containing the plasmid pCAMBIA1302 is used as the control for overexpressing the AcADC1 gene. Osmotically infiltrate the back of the leaves with a vacuum pump at 0.1 MPa until more than 90% of the leaves are wet (discard the leaf discs that do not meet the infection requirements), blot the surface moisture of the leaf discs with sterile filter paper, place the leaf discs face down closely on a 0.5% - 0.8% water agar plate, and culture them in an incubator at 28°C.

[0070] 3. Detection of silencing and overexpression efficiency

[0071] Extract the total RNA of the "Hongyang" kiwifruit leaves infected with Agrobacterium tumefaciens carrying the vectors pTRV1:pTRV2 (v / v = 1:1), pTRV1:pTRV2 - AcADC1 (v / v = 1:1), pCAMBIA1302, and pCAMBIA1302 - AcADC1 respectively. Using the cDNA obtained by reverse transcription of RNA as a template, take three biological replicates and three experimental replicates for each treatment. Using Actin as an internal reference gene, detect the expression level of the AcADC1 gene by qRT - PCR.

[0072] The primers used for qRT - PCR to detect silencing efficiency and overexpression are as follows:

[0073] AcADC1 - F: (5’ - GCTCTTTTGGTCTGCAACGG - 3’);

[0074] AcADC1 - R: (5’ - TCCGGCTCATGTCAATCACC - 3’).

[0075] Sequentially add 10 μL of 2×ChamQ SYBR qPCR Master Mix, 0.4 μL of AcADC1 - F, 0.4 μL of AcADC1 - R, 2 μL of Template DNA / cDNA, and 7.2 μL of H2O on ice to establish a total 20 - μL qRT - PCR system and perform amplification. The amplification reaction program is shown in Table 1.

[0076] Table 1 qRT - PCR amplification program

[0077]

[0078]

[0079] The results showed that Agrobacterium carrying pTRV1:pTRV2-AcADC1 reached the silencing requirement 5 days after infection. Compared with the control group pTRV1:pTRV2, the silencing efficiency was 34% (as shown in B of Figure 3 ). Agrobacterium carrying pCAMBIA1302-AcADC1, 5 days after infection, compared with the control group pCAMBIA1302, the expression level of AcADC1 increased by 2.7 times (as shown in B of Figure 4 ), indicating successful overexpression.

[0080] 4) Infection of Pseudomonas syringae pv. actinidiae

[0081] After confirming that the AcADC1 gene reached the silencing or overexpression conditions, the leaf disc vacuum infiltration method was used to inoculate the PsaM228 strain of Pseudomonas syringae pv. actinidiae (1×10 4 CFU / mL) on a 0.8% water agar plate and placed in an artificial climate chamber for cultivation. After 5 days, the infection situation of PsaM228 was observed and the lesion area was statistically analyzed. The results showed that, compared with the TRV:00 control group, the disease incidence of the leaves was significantly reduced after silencing the AcADC1 gene (as shown in A of Figure 3 ), while the disease incidence of the leaves was significantly more severe after overexpressing the AcADC1 gene compared with the control group (as shown in A of Figure 4 ).

[0082] The above results showed that the putrescine content was relatively high in the susceptible varieties of Pseudomonas syringae pv. actinidiae. High levels of putrescine could exacerbate the occurrence of the disease. However, after using the putrescine synthesis inhibitor DMFA, the degree of disease occurrence was significantly reduced. After silencing and overexpressing the putrescine synthesis gene AcADC1 respectively and then inoculating Psa M228, the determination of the disease incidence showed that this gene was a susceptible gene. The clarification of the function of the AcADC1 gene provided a new direction for the cultivation of kiwifruit varieties resistant to Pseudomonas syringae pv. actinidiae and also provided an important theoretical basis for the safe and sustainable prevention and control of Pseudomonas syringae pv. actinidiae.

[0083] The above-described embodiments are some embodiments of the present invention, rather than all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely represents selected embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art under the conditions based on the concept of the present invention through relevant deductions and substitutions without creative efforts fall within the scope of protection of the present invention.

Claims

1. A kiwifruit bacterial canker susceptibility gene AcADC1, characterized in that: The nucleotide sequence of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:

1.

2. The kiwi fruit bacterial canker susceptibility gene AcADC1 according to claim 1, characterized in that: The kiwifruit bacterial canker susceptibility gene AcADC1 is silenced to improve the resistance of kiwifruit to kiwifruit bacterial canker.

3. The kiwi fruit bacterial canker susceptibility gene AcADC1 according to claim 1, characterized in that: The nucleotide sequence of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:

3.

4. The kiwi fruit bacterial canker susceptibility gene AcADC1 according to claim 3, characterized in that: The primer sequences for PCR amplification of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 are shown in SEQ ID NOs: 4-5.

5. The kiwi fruit bacterial canker susceptibility gene AcADC1 according to claim 1, characterized in that: The arginine decarboxylase synthesized by encoding the kiwifruit bacterial canker susceptibility gene AcADC1 has an amino acid sequence as shown in SEQ ID NO:

2.

6. A method for cultivating kiwifruit varieties resistant to bacterial canker, characterized in that: Silencing the kiwifruit bacterial canker susceptibility gene AcADC1 in kiwifruit plants, or silencing a specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1; The nucleotide sequence of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO: 1; The nucleotide sequence of the specific fragment of the kiwifruit bacterial canker susceptibility gene AcADC1 is shown in SEQ ID NO:

3.

7. The method according to claim 6, characterized in that include: A vector containing the silenced fragment of the gene AcADC1 is constructed, the vector is transferred into Agrobacterium, and the obtained Agrobacterium is used to transfect kiwifruit to obtain the product.

8. The method according to claim 7, characterized in that The type of Agrobacterium is GV3101.

9. Use of the kiwi fruit bacterial canker susceptibility gene AcADC1 as claimed in claim 1 in kiwi fruit resistance to bacterial canker.

10. The use according to claim 9, characterized in that: The kiwifruit bacterial canker susceptibility gene AcADC1 is silenced to improve the resistance of kiwifruit to bacterial canker.

Images