Application of beta-glucosidase BnaBG27 in regulation and control of thousand seed weight of rape

Abstract

The invention discloses application of beta-glucosidase BnaBG27 in regulation and control of thousand seed weight of rape, and belongs to the technical field of gene engineering. According to the invention, the BGLU27 gene is separated and obtained from brassica napus Westar, and the gene is found to be highly expressed in rape seeds. Experiments find for the first time that the BGLU27 gene positively regulates the thousand seed weight of the rape, and the thousand seed weight of the rape can be increased by utilizing the gene, so that high-yield rape germplasm can be obtained. The method has a very important application prospect in breeding and improvement of high-yield rape varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of β-glucosidase BnaBG27 in regulating the thousand-seed weight of rapeseed. Background Art

[0002] Rapeseed (Brassica napus L.) is not only an important source of domestic edible vegetable oil and feed protein, but also an oil-vegetable dual-purpose crop, a landscape crop and one of renewable energy sources. As one of the three factors constituting the rapeseed yield, the thousand-seed weight plays an important role in the formation of the final yield. According to research, the heterosis of the thousand-seed weight is weak, and it is not very feasible to increase the thousand-seed weight by heterosis. However, by pyramiding different excellent alleles, the thousand-seed weight can be effectively increased, and then the yield can be improved. Therefore, identifying more thousand-seed weight genes and excellent haplotypes will help to increase the rapeseed yield. The thousand-seed weight is a quantitative trait controlled by multiple genes. At present, more than a hundred thousand-seed weight QTLs have been mapped in rapeseed, but the number of genes verified and cloned does not exceed 10.

[0003] β-glucosidases in plants can be divided into GH1, GH3, GH5 and GH16 glycoside hydrolase families. Among them, the GH1 family has the most members. At present, 48, 38 and 26 GH1 genes have been identified in Arabidopsis thaliana, Oryza sativa and Zea mays, respectively. Multiple sequence alignment results show that GH1 proteins in Arabidopsis thaliana have some conserved domains, such as RFSIWSRIFP, TF / LNEP, and these conserved domains play important roles in enzyme activity. β-glucosidases can hydrolyze β-1,4-glycosidic bonds and release glucose, and are involved in multiple biological processes in plants, such as cellulose degradation, cell wall modification, phytohormone activation and stress response. Previous studies have been carried out on the functions and in vivo substrates of some GH1 genes. For example, Arabidopsis thaliana BGLU45 and BGLU46 can hydrolyze lignin monomer glycosides and participate in the lignin synthesis process. Arabidopsis thaliana BGLU28 and BGLU30 are involved in the glucosinolate metabolism process, and the growth of double mutant plants is significantly inhibited. Arabidopsis thaliana and Oryza sativa BGLU42 hydrolyze oligosaccharides, among which cellotriose is the optimal substrate. After overexpression of this gene, the resistance of plants to pathogenic bacteria is significantly increased, while the results of mutants are opposite. AtBGLU1 hydrolyzes abscisic acid-glycoside and releases abscisic acid. After overexpression of this gene, the abscisic acid content increases, and the abscisic acid content decreases in mutants. Although the functions of some GH1 genes have been studied, they are only concentrated in a few subfamilies, and the functions and substrates of more genes in this family remain to be explored.

[0004] The phylogenetic tree of the GH1 gene family in Arabidopsis thaliana indicates that BGLU27 is most closely related to BGLU26. BGLU26 is involved in the glucosinolate metabolism process, and its in vivo substrates are indole-3-methyl glucosinolate (I3G) and 4-methoxyindole-3-methyl glucosinolate (4MI3G). This gene is a key factor restricting the infection of powdery mildew fungi on plants. However, the metabolic pathway and in vivo substrates involved in BGLU27 are still unclear. To sum up, β-glucosidase is involved in multiple biological processes of plant growth and development, but there is no report on its effect on grain weight. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of β-glucosidase BnaBG27 in regulating the thousand-grain weight of rapeseed, so as to solve the problems existing in the above-mentioned prior art. The BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed seeds, has very important application prospects in the breeding and improvement of high-yield rapeseed varieties, and lays a foundation for obtaining high-yield rapeseed germplasm.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides the application of the BnaBGLU27 gene in any one of the following:

[0008] (1) Application in regulating the thousand-grain weight of rapeseed;

[0009] (2) Application in rapeseed breeding;

[0010] Among them, the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:1 or SEQ ID NO:2. However, this nucleotide sequence is not limited thereto, and it can also be a nucleotide sequence obtained by substituting and / or deleting and / or adding one or more nucleotide residues to any of the above nucleotide sequences.

[0011] The present invention also provides the application of the protein encoded by the BnaBGLU27 gene in any one of the following:

[0012] (1) Application in regulating the thousand-grain weight of rapeseed;

[0013] (2) Application in rapeseed breeding;

[0014] Among them, the amino acid sequence of the protein is shown in SEQ ID NO:3 or SEQ ID NO:4. However, this protein sequence is not limited thereto, and it can also be a derivative amino acid sequence obtained by substituting and / or deleting and / or adding one or more amino acid residues to any of the above amino acid sequences and having the same function.

[0015] The present invention also provides the application of the recombinant vector containing the BnaBGLU27 gene in any one of the following:

[0016] (1) Application in regulating the 1000-seed weight of rapeseed;

[0017] (2) Application in rapeseed breeding;

[0018] Wherein, the recombinant vector is constructed by connecting the BnaBGLU27 gene and an expression vector, and the nucleotide sequence of the BnaBGLU27 gene is shown as SEQ ID NO:1 or SEQ ID NO:2.

[0019] The present invention also provides the application of a host bacterium containing the recombinant vector in any one of the following:

[0020] (1) Application in regulating the 1000-seed weight of rapeseed;

[0021] (2) Application in rapeseed breeding.

[0022] Preferably, the BnaBGLU27 gene positively regulates the 1000-seed weight of rapeseed.

[0023] The present invention also provides a method for regulating the 1000-seed weight of rapeseed, which includes the step of introducing the BnaBGLU27 gene into rapeseed to regulate the 1000-seed weight of rapeseed; wherein, the nucleotide sequence of the BnaBGLU27 gene is shown as SEQ ID NO:1 or SEQ ID NO:2.

[0024] Preferably, the BnaBGLU27 gene positively regulates the 1000-seed weight of rapeseed.

[0025] The present invention also provides a breeding method for increasing the 1000-seed weight of rapeseed, which includes the step of overexpressing the BnaBGLU27 gene in rapeseed to increase the 1000-seed weight of rapeseed; wherein, the nucleotide sequence of the BnaBGLU27 gene is shown as SEQ ID NO:1 or SEQ ID NO:2.

[0026] The present invention also provides a method for cultivating transgenic rapeseed with high 1000-seed weight, which includes the step of overexpressing the BnaBGLU27 gene in rapeseed to obtain transgenic rapeseed with high 1000-seed weight; wherein, the nucleotide sequence of the BnaBGLU27 gene is shown as SEQ ID NO:1 or SEQ ID NO:2.

[0027] The present invention discloses the following technical effects:

[0028] The present invention discovers for the first time that the BnaBGLU27 gene regulates the 1000-seed weight of rapeseed. Through experiments, it is found that the BnaBGLU27 gene positively regulates the 1000-seed weight of rapeseed. Therefore, by using this gene, the 1000-seed weight of rapeseed can be increased, and high-yield rapeseed germplasm can be obtained. The present invention has very important application prospects in the breeding and improvement of high-yield rapeseed varieties. Description of the Drawings

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can also be obtained based on these drawings.

[0030] Figure 1 is the expression pattern of BnaBGLU27;

[0031] Figure 2 is the gene structure of BnaBGLU27 (A), the acquisition of double mutants (B), and the DNA detection (C) and expression level detection (D) of overexpression positive single plants;

[0032] Figure 3 is the statistical analysis result of the 1000-grain weight of wild type, mutant, and overexpression materials. Specific Embodiments

[0033] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0034] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0035] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0036] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.

[0037] Terms such as "comprising", "including", "having", "containing", etc. used in this text are all open-ended terms, meaning including but not limited to.

[0038] Based on the GWAS analysis of 505 rapeseed association population re-sequencing and phenotypic data collected by this research group, a significant QTL locus (unpublished) was detected on chromosome A09 and was repeatedly detected in three environments. To further screen the candidate genes in the QTL interval, the POCKET algorithm based on machine learning was used to predict the candidate genes in this interval, and finally BnaA09.BGLU27 was predicted as the candidate gene in this QTL interval.

[0039] The BnaBGLU27 gene isolated from Brassica napus Westar has one copy each on chromosomes A09 and C08 of rapeseed and two copies on chromosome C04, namely BnaA09.BGLU27 (BnaA09T0515300WE), BnaC08.BGLU27 (BnaC08T0342100WE), BnaC04.BGLU27-1 (BnaC04T0272200WE), and BnaC04.BGLU27-2 (BnaC04T0049800WE). The results of rapeseed seed transcriptome analysis showed that BnaA09.BGLU27 and BnaC08.BGLU27 were highly expressed in developing seeds, while BnaC04.BGLU27-1 and BnaC04.BGLU27-2 were basically not expressed in developing seeds ( Figure 1 ). Therefore, the inventors mainly focused on two genes, BnaA09.BGLU27 and BnaC08.BGLU27. The nucleotide sequences of these two genes are shown in Sequence Listing SEQ ID NO:1 and SEQ ID NO:2 respectively, consisting of 1008 bp and 1620 bp; the protein sequences encoded by this gene are shown in Sequence Listing SEQ ID NO:3 and SEQ ID NO:4 respectively, encoding 335 and 539 amino acids respectively.

[0040] The nucleotide sequence of BnaA09.BGLU27 (A09, SEQ ID NO:1) is:

[0041]

[0042] The nucleotide sequence of BnaC08.BGLU27 (C08, SEQ ID NO: 2) is as follows:

[0043]

[0044] The amino acid sequence of BnaA09.BGLU27 (SEQ ID NO:3) is as follows:

[0045] MNEAAVAGQSGLEVYTVSHNLLLAHAEAVEVFRNNPKCKDGKIGIAHCPVWFEPYDSNCPDDKEACERAMEFMFGWHMDPTVYGDYPEVMKKSIGKRLPSFTAAQSKKLRGSFDFVGVNYYSAFYVKSIPEVDHNTPNWRSDARIEWRKQNKAGQTLGVRGGSEWDFLYPQGLRKFLNYAKNKYESPKFMITENGHCDMDYEKKPKLSNLMDLQRTEYHKKHLQSIQQAIQEDGVEVEGYFAWSLLDNCEWNAGYGVRYGLFYVDYNNGLKRFPKMSAMWFKEFLKREEEIEESEKEEYLLKPAMKKKRFLLATGSASCFIPKMSESSKALELFF。

[0046] The amino acid sequence of BnaC08.BGLU27 (SEQ ID NO:4) is as follows:

[0047] MTQKRNTFSKKNSFGRSDFPEGFLFGTASSAYQYEGAINEAPRGESVWDTFVRKYPERNCYSNADKAVEFYSHYKEDIQRMKDINMDAFRFSISWPRILPLGKKSKGVNQEGINFYNDLIDELLANGITPLATLFHWDTPQALEDEYNGFLSEQAVDDFKDFAALCFEEFGDRVKLWVTLNEPWVYSIGGYDTGRKAPGRASKYMNEAAVAGQSGLEVYTVSHNLLLAHAEAVEVFRNNPKCKDGKIGIAHCPVWFEPYDSNCPDDKEACERAMEFMFGWHMDPTVYGDYPEVMKNSIGKRLPSFTTAQSKKLRGSFDFVGVNYYSAFYVKSIPEVDHNTPNWRSDARIEWRKQNKAGQTLGVRGGSEWDFLYPQGLRKFLNYAKNKYESPKFMITENGHCDMDYEKKPKLSNLMDLQRTEYHKKHLQSIQQAIQEDGVEVEGYFAWSLLDNCEWNAGYGVRYGLFYVDYNNGLKRFPKMSAMWFKEFLKREEEIEESEKEEYLLKSAMKKKRFLLATGATSCFIPKMSESSKALELFF。

[0048] Example 1 Cloning of the Brassica napus BnaA09.BGLU27 gene

[0049] The BGLU27 gene, which encodes β-glucosidase, has four copies in Brassica napus, one copy on each of chromosomes A09 and C08, and two copies on chromosome C04, namely BnaA09.BGLU27 (BnaA09T0515300WE), BnaC08.BGLU27 (BnaC08T0342100WE), BnaC04.BGLU27-1 (BnaC04T0272200WE) and BnaC04.BGLU27-2 (BnaC04T0049800WE). Among them, the nucleotide sequence length of BnaA09.BGLU27 is 1008 bp, and this gene encodes 335 amino acids, as shown in Sequence Listing SEQ ID NO:1.

[0050] (1) RNA extraction

[0051] Total RNA was extracted using TansZol from TransGen Biotech (Catalog No. ET101). Seeds of Brassica napus at 20 days after flowering (20 DAF) were ground into powder in liquid nitrogen. 100 mg of the ground sample was transferred to a 1.5 mL centrifuge tube, and 1 mL of TransZol was added. The tube was vigorously inverted several times to mix well and then left standing at room temperature for 5 minutes. 0.2 mL of chloroform was added, and the mixture was shaken vigorously for 15 seconds and incubated at room temperature for 3 minutes. Centrifugation was performed at 10,000 × g at 4°C for 15 minutes. At this time, the sample was separated into three layers: a colorless aqueous phase (upper layer), an intermediate layer, and a pink organic phase (lower layer). The colorless aqueous phase was transferred to a new centrifuge tube, 0.5 mL of isopropanol was added, and the tube was inverted to mix. Incubation was carried out at room temperature for 10 minutes. Centrifugation was performed at 10,000 × g at 4°C for 10 minutes. The supernatant was removed, and a gelatinous precipitate formed on the side and bottom of the tube. 1 mL of 75% ethanol (prepared with DEPC-treated water) was added, and the mixture was vortexed vigorously. Centrifugation was performed at 7,500 × g at 4°C for 5 minutes. The supernatant was discarded, and the precipitate was air-dried at room temperature. The precipitate was dissolved in 50 - 100 μL of RNA lysis solution and incubated at 55°C for 10 minutes. 1 μL of the extracted total RNA was used to measure the RNA concentration with a Nanodrop, and the RNA purity was identified based on 1.8 < OD260 / OD280 < 2.0. At the same time, 1 μL was taken for 1% agarose gel electrophoresis to detect integrity.

[0052] (2) Synthesis of cDNA

[0053] Reverse transcription was performed using TransGen Biotech EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Catalog No. AE311). Using 1 μg of total RNA as a template, 1 μL of Anchored Oligo(dT)18 Primer, 10 μL of 2×ES Reaction Mix, 1 μL of EasyScript® RT / RI Enzyme Mix, and 1 μL of gDNA Remover were sequentially added, and RNase-free Water was added to make up to 20 μL. After gently mixing the above system, it was placed at 42°C for 30 min. This step was to synthesize the first-strand cDNA and remove gDNA. EasyScript® RT / RI and gDNA Remover were inactivated by heating at 85°C for 5 seconds. 180 μL of RNase-free Water was added to dissolve the synthesized cDNA for later use.

[0054] (3) Amplification of BnaA09.BGLU27 gene

[0055] Using the above cDNA as a template, with the forward primer sequence being BnaA09.BGLU27-pCAMBIA2306-F (SEQ ID NO:5): 5’-ACGGGGGACGAGCTCGGTACC ATGAATGAAGCAGCGGTGG -3’, and the reverse primer sequence being BnaA09.BGLU27-pCAMBIA2306-R (SEQ ID NO:6): 5’-TTGGTCGACTCTAGAGGATCC GAAAAATAGTT CTAGAGCCTTAGATGAT -3’, the full-length CDS fragment of BnaA09.BGLU27 (stop codon removed) was amplified. I-5™ 2×High-Fidelity Master Mix (TSINGKE Biologica technology) was used for PCR amplification. The PCR amplification system was as follows: 25 μL of 2×I-5™ 2×High-Fidelity Master Mix, 2.5 μL of BnaA09.BGLU27-pCAMBIA2306-F (10 μmoL / L), 2.5 μL of BnaA09.BGLU27-pCAMBIA2306-R (10 μmoL / L), 3 μL of cDNA, and 17 μL of ddH2O.

[0056] PCR amplification program: total denaturation at 98℃ for 1 min; denaturation at 98℃ for 15 sec, annealing at 58℃ for 15 sec, extension at 72℃ for 1 min, 34 cycles; total extension at 72℃ for 5 min.

[0057] The amplified product was detected by agarose gel electrophoresis. The full-length CDS sequence of BnaA09.BGLU27 with 1005 bp was obtained, and the product was recovered using the Tiangen agarose gel recovery kit ( http: / / www.tiangen.com / )

[0058] Example 2 Construction of the overexpression transformation vector of the BnaA09.BGLU27 gene

[0059] (1) The vector pCAMBIA2306 was double digested with the fast restriction enzymes Kpn I and Bam HI. The double digestion system was as follows: 10 μL of 5×Fast digestion buffer, 1 μL of Kpn I, 1 μL of Bam HI, 20 μL of the recovered product / plasmid, and 18 μL of ddH2O.

[0060] The digestion reaction was carried out in a 37℃ water bath for 3 hours. The digested product was recovered using the Tiangen DNA purification kit.

[0061] (2)The CDS fragment of the gene was ligated to the vector 35S-pCAMBIA2306, which contains a constitutive expression promoter and an antibiotic marker.

[0062] Ligation reaction system: 6 μL of the amplified fragment of BnaA09.BGLU27, 1 μL of the fragment recovered after vector digestion, 1 μL of Exnase II (Vazyme), and 2 μL of 5×CE II buffer.

[0063] Ligation reaction conditions: 30 min at 37°C.

[0064] (3)Transform Escherichia coli DH5α, and the transformation method is as follows:

[0065] Pipette 10 µL of the ligation product into 50 µL of DH5α competent cells, mix well by pipetting, and place on ice for 30 min; incubate in a 42°C water bath for 1.5 min, then place on ice for 3 min; add 400 µL of antibiotic-free liquid LB medium, and activate at 37°C and 150 r / min in a shaker for 45 - 60 min; pipette 200 µL of the activated bacterial solution and spread it on a solid LB medium with the corresponding resistance, and incubate upside down at 37°C for 12 - 16 h. Then screen for positive clones, extract plasmids and perform restriction enzyme digestion for identification. Select 3 positive clones for sequencing. The analysis results show that the CDS sequence of the BnaA09.BGLU27 gene was successfully ligated to the vector, that is, the plant expression vector 35S-pCAMBIA2306-BnaA09.BGLU27 for transgenic plants was successfully constructed.

[0066] (4)Introduce the correctly constructed recombinant plasmid vector into the Agrobacterium strain GV3101, and select positive monoclonal clones for storage in an -80°C refrigerator. The introduction method is as follows:

[0067] a. Wash the electroporation cuvette: First wash with pure water, then with ultrapure water, pour out, then wash with absolute ethanol (pipette with a 1 mL pipette tip), pour out the absolute ethanol, and place it in the laminar flow hood to dry.

[0068] b. Take 50 μL of Agrobacterium competent GV3101.

[0069] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of the competent cells, gently mix well by pipetting to avoid generating bubbles.

[0070] d. Place the washed and dried electroporation cuvette on ice for pre-cooling, and then pipette the above mixture against the wall of the cuvette.

[0071] e. Set the electroporator to 1800 V.

[0072] f. Take out the electroporation cuvette from the ice, and wipe the outer wall of the electroporation cuvette with absorbent paper.

[0073] g. Place the electroporation cup into the instrument, press the "push" key twice continuously. If you hear a "beep" sound after a few seconds, it is successful;

[0074] h. After successful electroporation, add 400 μL of antibiotic-free LB to the electroporation cup, pipette and mix well, and transfer it to a sterile centrifuge tube;

[0075] i. Activate at 28 °C for about 1 h, take 100 μL and spread it on a plate containing the corresponding antibiotic resistance. Seal it with parafilm and incubate it upside down in a 28 °C incubator for 2 days, then pick colonies for detection.

[0076] (5) Detection of Agrobacterium colonies

[0077] Pick colonies into double-antibiotic LB, culture at 28 °C for 1 hour, take an appropriate amount of bacterial liquid for PCR detection, and preserve the positive Agrobacterium bacterial liquid.

[0078] Example 3 Construction of BnaBGLU27-CRISPR vector

[0079] Use the sgRNA-Cas9 system of the team led by Chen Qijun from the College of Biology, China Agricultural University to create Brassica napus BnaBGLU27 mutants. The experimental procedures are as follows:

[0080] (1) Screening of target sites

[0081] Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / , and screen for target sites sgRNA1 (SEQ ID NO:7): GTATTGCGCATTGTCCCGTG and sgRNA2 (SEQ ID NO:8): AGAAGCATGTGAACGAGCCA, which are located in the second and seventh exon regions of genes BnaA09.BGLU27 and BnaC08.BGLU27 respectively. There are base differences between BnaA04.BGLU27 and BnaC04.BGLU27 and the two target sites. Therefore, sgRNA1 and sgRNA2 only target BnaA09.BGLU27 and BnaC08.BGLU27 (these two genes are highly expressed in developing seeds).

[0082] (2) Primer design

[0083] DT1-BsF (SEQ ID NO:9): 5’-ATATATGGTCTCGATTG GTATTGCGCATTGTCCCGTG GTT-3’;

[0084] DT1-F0 (SEQ ID NO:10): 5’-TG GTATTGCGCATTGTCCCGTGGTTTTAGAGCTAGAAATAGC-3’;

[0085] DT2-R0 (SEQ ID NO:11): 5’-AAC TGGCTCGTTCACATGCTTCT CAATCTCTTAGTCGACTCTAC-3’;

[0086] DT2-BsR (SEQ ID NO:12): 5’-ATTATTGGTCTCGAAAC TGGCTCGTTCACATGCTTCT CAA-3’.

[0087] (3) PCR amplification

[0088] Using the pCBC-DT1T2 diluted 100 times as the template for four-primers PCR amplification. DT1–BsF and DT2-BsR are at normal primer concentrations; DT1-F0 and DT2-R0 are diluted 20 times.

[0089] The amplification system is: 2×I-5™ 2×High-Fidelity Master Mix 25 μL, DT1-BsF (10 μmol / L) 2 μL, DT2-BsR (10 μmol / L) 2 μL, DT1-F (0.5 μmol / L) 2 μL, DT2-R0 (0.5 μmol / L) 2 μL, pCBC-DT1T2 plasmid 3 μL and ddH2O 14 μL.

[0090] PCR amplification program: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 15 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, 34 cycles; final extension at 68°C for 5 min.

[0091] (4) Purify and recover the PCR product, and construct a recombinant expression vector

[0092] Purify and recover the PCR product, and establish the following restriction-ligation system: PCR fragment 2 μL, pKSE401 2 μL, 10×NEB T4 Buffer 1.5 μL, 10×BSA solution 1.5 μL, BsaI (NEB) 1 μL, T4 ligase (NEB) 1 μL and ddH2O 6 μL.

[0093] Reaction conditions: 37°C for 5 h, 50°C for 5 min, 80°C for 10 min.

[0094] (5) Transform Escherichia coli DH5α

[0095] Take 5 μL of the transformed E. coli competent cells, screen them on Kan plates, and identify and sequence the positive clones by PCR. The vector with correct sequencing is the CRISPR vector of BnaBGLU27.

[0096] The primers for identifying positive clones by PCR are:

[0097] U626-IDF (SEQ ID NO:13): 5’-TGTCCCAGGATTAGAATGATTAGGC-3’ and U629-IDR (SEQ ID NO:14): 5’-GTCAGGCTGCAGTAGTTTCCATTAA-3’.

[0098] The PCR reaction system is: 2×I-5™ 2×High-Fidelity Master Mix 10 μL, U626-IDF (10 μmol / L) 0.4 μL, U629-IDR (10 μmol / L) 0.4 μL, cDNA 2 μL, and ddH2O 7.2 μL.

[0099] The PCR reaction program is: total denaturation at 98℃ for 1 min; denaturation at 98℃ for 15 sec, annealing at 58℃ for 15 sec, extension at 72℃ for 30 sec, for 32 cycles; total extension at 72℃ for 5 min.

[0100] (6) Transformation of Agrobacterium tumefaciens GV3101

[0101] Introduce the correctly constructed recombinant plasmid vector into the Agrobacterium strain GV3101, and select positive monoclonal clones for storage in a -80℃ refrigerator. The introduction method is as follows:

[0102] a. Wash the electroporation cuvette: first wash it with pure water, then with ultrapure water, pour it out, then wash it with absolute ethanol (pipette with a 1 mL pipette tip), pour out the absolute ethanol, and place it in the laminar flow hood to dry.

[0103] b. Take 50 μL of Agrobacterium tumefaciens GV3101 competent cells;

[0104] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent cells, gently pipette and mix well to avoid generating bubbles;

[0105] d. Place the washed and dried electroporation cuvette on ice for pre-cooling, and then pipette the above mixture against the wall of the cuvette;

[0106] e. Set the electroporator to 1800 V;

[0107] f. Take the electroporation cuvette out of the ice, and wipe the outer wall of the electroporation cuvette with absorbent paper;

[0108] g. Place the electroporation cup into the instrument, press the "push" key twice continuously. If you hear a "beep" sound after a few seconds, it is successful;

[0109] h. After successful electroporation, add 400 μL of antibiotic-free LB medium to the electroporation cup, pipette a few times, and transfer it to a sterile centrifuge tube;

[0110] i. Activate at 28 °C for about 2 h, take 100 μL and spread it on an LB solid plate containing double antibiotics. Seal it with a sealing film, invert it and culture it in an incubator at 28 °C for 2 days, and pick colonies for detection.

[0111] (7)Agrobacterium colony detection

[0112] Select colonies into double-antibiotic LB culture medium, culture at 28 °C for 2 hours, take an appropriate amount of bacterial liquid for PCR detection, and preserve the positive Agrobacterium bacterial liquid.

[0113] Example 4 Genetic transformation experiment

[0114] (1)Genetic transformation of rapeseed

[0115] Perform genetic transformation of rapeseed on the constructed overexpression vector of BnaA09.BGLU27 and the BnaBGLU27-CRISPR vector. Use the Agrobacterium-mediated genetic transformation method. The receptor used for rapeseed transformation in the present invention is Brassica napus Westar. For the specific operation procedure, please refer to the reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus.

[0116] (2)Identification of CRISPR-transformed single plants

[0117] Sequencing was performed on the obtained rapeseed CRISPR-transformed individual plants to screen for rapeseed mutants. First, the Cas9 protein was identified using the primers Cas9-570-F (5’ -AGACCGTGAAGGTTGTGGAC-3’, SEQ ID NO:15) and Cas9-570-R (5’-TAGTGATCTGCCGTGTCTCG-3’, SEQ ID NO:16). For the individual plants positive for the Cas9 protein, specific amplification and sequencing identification of the target gene were carried out. The method for specific amplification of the target gene was as follows: The primers BGLU27(A09)-CRISPR-F (5’-CTGGACGTGCCTCCAAGTA-3’, SEQ ID NO:17) and BGLU27(A09)-CRISPR-R(5’-TGATCAAATAATATGAGTAAGTCTTGT-3’, SEQ ID NO:18) were used to specifically amplify BnaA09.BGLU27; the primers BGLU27(C08)-CRISPR-F (5’-GCACTTTTAAGTCTTCGTTA-3’, SEQ ID NO:19) and BGLU27(C08)-CRISPR-R (5’-AGCCCTATATAATATGATAAAA-3’, SEQ ID NO:20) were used to specifically amplify BnaC08.BGLU27. The amplification method was as follows:

[0118] The PCR amplification system was: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. The PCR amplification conditions were: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 30 sec, for 34 cycles; final extension at 72°C for 5 min.

[0119] The amplified target fragment was subjected to PCR product sequencing, and the sequencing results were analyzed using the DSDecode online website ( http: / / skl.scau.edu.cn / dsdecode / ) to analyze the editing status of the target site. The sequencing results showed that two mutant independent lines (bglu27-1 and bglu27-2) in which both of the two homologous genes of BnaBGLU27 (BnaA09.BGLU27 and BnaC08.BGLU27) were edited were obtained; Figure 2 in A, B).

[0120] (3) Identification of overexpressed transformed individual plants

[0121] Genomic DNA of the overexpressed transgenic rapeseed plants obtained by extraction was used to detect the insertion of the exogenous gene fragment by PCR. In this invention, the overexpression backbone vector is 35S-pCAMBIA2306. Primers pCAMBIA2306-R (5’-CATGGTGGCAAATTCTGATCC-3’, SEQ ID NO:21) were designed on the vector backbone. PCR was performed by combining the vector backbone primers with the exogenous fragment primers (BnaA09.BGLU27-pCAMBIA2306-F: 5’-ATGAATGAAGCAGCGGTGG-3’, SEQ ID NO:22) to detect transgenic seedlings at the PCR level ( Figure 2 in C). The PCR system was as follows: Taq polymerase Mix 5 µL; pCAMBIA2306 -R (10 μmol / L) 0.5 µL; BnaA09.BGLU27-pCAMBIA2306-F (10 μmol / L) 0.5µL; gDNA 1 µL; ddH2O 3 µL. The PCR conditions were: total denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, for 34 cycles; total extension at 72°C for 5 min.

[0122] The positive transgenic seedlings of rapeseed obtained by PCR were subjected to qRT-PCR to detect gene expression levels. RNA was extracted from the leaves of the transformed individual plants and cDNA was synthesized (the method was the same as in Example 1). The quantitative primers were designed using Primer 5 software, and the product size was between 80-250 bp. After design, BLAST alignment was performed using the reference sequence to ensure the specificity of the primers BnaBGLU27-RT-F (5’-CCGAAAATGTCTGCGATGTG-3’, SEQ ID NO:23) and BnaBGLU27-RT-R (5’-TAGGAATGAAACATGAGGCCG-3’, SEQ ID NO:24). BnaACTIN7-F (5’-CGCGCCTAGCAGCATGAA-3’, SEQ ID NO:25) and BnaACTIN7-R (5’-GTTGGAAAGTGCTGAGAGATGCA-3’, SEQ ID NO:26) were used as the internal reference primers for rapeseed qRT-PCR (see Zhou et al 2012: BnMs3 is required for tapetal differentiation and degradation, microspore separation, and pollen-wall biosynthesis in Brassica napus for details). The reaction system was: 2 μL of cDNA diluted 10-fold, 0.4 μL of upstream primer (10 μM), 0.4 μL of downstream primer (10 μM), 10 μL of 2×TransStart® Green qPCR SuperMix, and 7.2 μL of ddH2O.

[0123] Reaction procedure: 30 s at 94 °C; 10 s at 94 °C, 15 s at 60 °C, 30 s at 72 °C, 45 cycles; melting curve was plotted. qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System.

[0124] Standardization was carried out according to the internal reference primers, and the quantitative variation between different replicates was calculated using the delta-delta threshold cycle relative quantification (2 -ΔΔCT ). Finally, the relative expression levels of the overexpressed transformed individual plants OE-3 and OE-8 in rapeseed were analyzed ( Figure 2 in D).

[0125] Example 5 Phenotypic analysis of wild type, mutant, and overexpression materials

[0126] Using the SC-G type automatic seed analyzer, the thousand-seed weight of rapeseed harvested at maturity was analyzed to obtain the thousand-seed weight data of wild type, mutant and overexpression materials. The measuring instrument was provided by the National Rapeseed Engineering and Technology Research Center of Huazhong Agricultural University.

[0127] The results of thousand-seed weight analysis showed that the thousand-seed weight of the recipient background material Westar was 3.32 ± 0.32 g, the thousand-seed weights of the mutant materials bglu27-1 and bglu27-2 were 2.91 ± 0.25 g and 2.96 ± 0.31 g respectively, while the thousand-seed weights of the overexpression materials OE-3 and OE-8 were 4.07 ± 0.30 g and 3.99 ± 0.22 g respectively. Statistical analysis showed that the thousand-seed weights of the two mutants were significantly lower than that of the wild type, and the thousand-seed weights of the two overexpressions were significantly higher than that of the wild type ( Figure 3 ). These results indicate that BnaBGLU27 positively regulates the thousand-seed weight of rapeseed.

[0128] In summary, BnaBGLU27 plays an important role in regulating the thousand-seed weight of rapeseed.

[0129] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the BnaBGLU27 gene in any of the following: (1) Application in regulating rapeseed thousand-grain weight; (2) Application in rapeseed breeding; in, The nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. Use of the protein encoded by the BnaBGLU27 gene in any of the following: (1) Application in regulating rapeseed thousand-grain weight; (2) Application in rapeseed breeding; in, The amino acid sequence of the protein is shown in SEQ ID NO:3 or SEQ ID NO:

4.

3. Use of a recombinant vector comprising the BnaBGLU27 gene in any of the following: (1) Application in regulating rapeseed thousand-grain weight; (2) Application in rapeseed breeding; in, The recombinant vector is constructed by connecting the BnaBGLU27 gene and the expression vector, and the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:1 or SEQ ID NO:

2.

4. Use of a host bacterium comprising the recombinant vector according to claim 3 in any of the following: (1) Application in regulating rapeseed thousand-grain weight; (2) Application in rapeseed breeding.

5. The use according to any one of claims 1 to 4, characterized in that: The BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed.

6. A method for regulating rapeseed thousand-grain weight, characterized in that: The method comprises the steps of introducing the BnaBGLU27 gene into rapeseed to regulate the thousand-grain weight of rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:1 or SEQ ID NO:

2.

7. The method according to claim 6, characterized in that The BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed.

8. A breeding method for increasing rapeseed thousand-grain weight, characterized in that: The method comprises the steps of overexpressing the BnaBGLU27 gene in rapeseed to increase the thousand-grain weight of rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

9. A method for cultivating transgenic rapeseed with high thousand-grain weight, characterized in that: The method comprises the steps of overexpressing the BnaBGLU27 gene in rapeseed to obtain transgenic rapeseed with high thousand-grain weight; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:1 or SEQ ID NO:2.

Images