Pharmaceutical composition for resisting tumors
By combining the use of STING antagonist H-151 and endoplasmic reticulum stress inducer and chemotherapy drugs, the problem of poor response to chemotherapy drugs was solved, and a more effective tumor suppression effect was achieved.
Patent Information
- Application Number
- CN202510159559.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-13
- Publication Date
- 2025-06-20
AI Technical Summary
Pancreatic ductal adenocarcinoma (PDAC) is poorly responsive to existing chemotherapy drugs and is prone to resistance, resulting in poor treatment effect.
A pharmaceutical composition is developed to enhance the inhibitory effect on PDAC by combining the STING antagonist H-151 and/or the endoplasmic reticulum stress inducer Thapsgargin or Tunicamycin with a chemotherapeutic drug.
Experimental results show that the combined use of STING antagonist H-151 with chemotherapy drugs can significantly reduce the inflammation level of tumor cells, increase the sensitivity to chemotherapy drugs, and effectively inhibit tumor growth. The use of TG or TM in combination with chemotherapeutic drugs can also significantly enhance the killing effect on tumors.
Smart Images

Figure CN120168642A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pharmaceutical biology and relates to a pharmaceutical composition for anti-tumor treatment. Background Art
[0002] Pancreatic ductal adenocarcinoma (PDAC) is the most common and lethal type of pancreatic cancer and is currently the fourth leading cause of cancer-related deaths globally, with a five-year overall survival rate of only 13%. It is expected that the incidence of PDAC will more than triple in the next decade. Chemotherapy, including the use of drugs such as platinum compounds (e.g., cisplatin, oxaliplatin), fluorouracil (5-FU), gemcitabine, and albumin-bound paclitaxel, is the standard treatment for all stages of PDAC, including adjuvant treatment and treatment for advanced or metastatic disease. However, PDAC usually has a poor response to these treatments and develops drug resistance. Therefore, there is an urgent need to find new strategies to improve the treatment effect.
[0003] Stimulator of interferon genes (STING) is localized on the endoplasmic reticulum of cells and is a protein molecule involved in innate immune signal transduction, playing an important role in antiviral immunity and anti-tumor immunity. Currently, there are many views that the activation of STING can enhance the anti-tumor immune response, but there are also studies showing that for tumor cells with chromosomal instability (CIN), the DNA released into the cytoplasm can continuously activate the cGAS-STING pathway, leading to rewiring of the immune pathway within cancer cells, forming immune suppression and promoting cancer metastasis. In triple-negative breast cancer cells, CIN induces IL-6-STAT3-mediated signal transduction dependent on the cGAS-STING pathway and the non-classical NF-κB pathway. Clinically, the use of tocilizumab targeting the interleukin-6 receptor (IL-6R) can selectively inhibit the growth of triple-negative breast cancer cells, demonstrating the oncogenic characteristics of the cGAS-STING signal in specific tumors. H-151 is an effective, selective, and covalent STING antagonist with significant inhibitory activity against STING in vivo and in vitro. H-151 can reduce TBK1 phosphorylation and inhibit STING palmitoylation, so it can be used in the research of autoinflammatory diseases. As an antagonist of STING, H-151 may also play a certain role in tumor treatment.
[0004] Tumor cells are often exposed to an environment with altered protein homeostasis, resulting in endoplasmic reticulum stress (ERS). To cope with this situation, tumor cells activate an adaptive mechanism to restore protein homeostasis in the endoplasmic reticulum, namely the unfolded protein response (UPR). By IRE1 α, The three major UPR signaling branches initiated by PERK and ATF6 are crucial for tumor growth, invasion, and microenvironment remodeling or treatment resistance. Thapsigargin (TG) is a microsomal Ca 2 + -ATPase inhibitor that can induce endoplasmic reticulum stress. Experimental studies have shown that in esophageal squamous cell carcinoma, melanoma, and adrenocortical carcinoma, TG can induce apoptosis of cancer cells by activating ERS, thereby improving the efficacy of drug treatment. Tunicamycin (TM) is a mixture of N-glycosylation homologous nucleoside antibiotic inhibitors that disrupts protein maturation by blocking the synthesis of oligosaccharides, leading to ERS, and causes cell death through multiple signaling pathways. Studies have shown that TM treatment can increase the sensitivity of lung cancer cells to Cisplatin (Cis), which is due to the deglycosylation of PTX3 mediated by the AKT / NF-κB signaling pathway. Summary of the Invention
[0005] Previous studies by the applicant found that the endoplasmic reticulum protein homeostasis in PDAC was disrupted after chemotherapy, and STING-mediated inflammation increased. Based on these two characteristics, a new combined treatment regimen for PDAC was developed. The object of the present invention is to provide a pharmaceutical composition for anti-tumor, and to study the therapeutic effect after combining the use of STING antagonist H-151 and / or endoplasmic reticulum stress inducer Thapsigargin or Tunicamycin while using chemotherapy drugs to treat tumors, so as to provide a new medication idea for tumor treatment.
[0006] To achieve the above object, the technical solution of the present invention is as follows:
[0007] The present invention provides the use of a STING antagonist and / or an endoplasmic reticulum stress inducer in combination with a chemotherapy drug in the preparation of an anti-tumor drug.
[0008] Preferably, the STING antagonist is H-151 itself, a H-151 precursor or a H-151 metabolite and its pharmaceutically acceptable salt or ester;
[0009] The endoplasmic reticulum stress inducer is thapsigargin or tunicamycin, the thapsigargin is thapsigargin itself, a thapsigargin precursor or a thapsigargin metabolite and its pharmaceutically acceptable salt or ester, and the tunicamycin is tunicamycin itself, a tunicamycin precursor or a tunicamycin metabolite and its pharmaceutically acceptable salt or ester;
[0010] The chemotherapy drug is selected from at least one of the following drugs: alkylating chemotherapy drugs, antimetabolic chemotherapy drugs, antibiotic chemotherapy drugs, animal and plant chemotherapy drugs, and miscellaneous chemotherapy drugs.
[0011] Specifically, the miscellaneous chemotherapeutic drugs include platinum-based chemotherapeutic drugs, and the platinum-based chemotherapeutic drugs are cisplatin, carboplatin or oxaliplatin;
[0012] The antimetabolic chemotherapeutic drugs are 5-fluorouracil, gemcitabine, cytarabine or methotrexate; the alkylating agent chemotherapeutic drugs are cyclophosphamide or ifosfamide; the antibiotic chemotherapeutic drugs are mitomycin, doxorubicin or actinomycin D; the plant chemotherapeutic drugs are etoposide, docetaxel, paclitaxel, vincristine or irinotecan.
[0013] We knocked down the expression of STING protein (STING KO) in pancreatic ductal carcinoma cells (PANC02, KPC) by CRISPR-Cas9 gene editing technology. In vitro immunoblotting experiments and real-time fluorescence quantitative results showed that after treatment with chemotherapeutic drugs, the inflammatory level of STING KO PANC02 cells was significantly lower than that of wild-type cells. In vitro drug resistance experiments found that STING deletion increased the sensitivity of PANC02 cells to chemotherapeutic drugs. In a mouse subcutaneous xenograft tumor model, the growth of tumors inoculated with STING KO PANC02 cells was restricted. After treatment with chemotherapeutic drugs, the growth of STINGKO PANC02 tumors was further inhibited, and the tumor volume was significantly smaller than that of wild-type PANC02 tumors treated with the same chemotherapeutic drugs. Experiments found that the tumor size and weight of the combined treatment group of STING antagonist H-151 and chemotherapeutic drugs were significantly smaller than those of the untreated and single-drug treatment groups. These results indicate that the STING pathway plays an important role in tumor growth, and H-151, as an antagonist of STING, can be used in combination with chemotherapeutic drugs to enhance the inhibitory effect on tumors.
[0014] In previous studies, it was found that after treatment with chemotherapeutic drugs, key proteins in the UPR were significantly downregulated, and the UPR is the main pathway regulating endoplasmic reticulum stress. Through in vitro cell counting experiments (CCK-8), it was found that the combined use of the endoplasmic reticulum stress inducer TG or TM and chemotherapeutic drugs could further promote the death of tumor cells. In addition, in a mouse subcutaneous xenograft tumor model, when the endoplasmic reticulum stress inducer TG or TM was injected around the tumor during chemotherapeutic drug treatment, it was found that the tumor size and weight of the combined treatment group were significantly smaller than those of the untreated group and the single-drug treatment group. These results indicate that the endoplasmic reticulum stress inducer TG or TM can be used in combination with chemotherapeutic drugs to achieve a better inhibitory effect on tumors.
[0015] Based on the above results, a treatment plan combining chemotherapy, STING inhibition, and endoplasmic reticulum stress was developed, and good tumor inhibitory effects were achieved both in vitro and in vivo.
[0016] Preferably, the tumor is pancreatic cancer.
[0017] Preferably, when the STING antagonist is used in combination with a chemotherapeutic drug, the effective concentration of the STING antagonist H-151 is 5-10 mg / kg -1 ; the effective concentration of the chemotherapeutic drug cisplatin is 3-10 mg / kg -1 ; the effective concentration of 5-fluorouracil is 25-50 mg / kg -1 ; the effective concentration of irinotecan is 25-50 mg / kg -1 ;
[0018] More preferably, when the STING antagonist is used in combination with a chemotherapeutic drug, the STING antagonist is H-151 at 5 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3-5 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 ;
[0019] Most preferably, when the STING antagonist is used in combination with a chemotherapeutic drug, the STING antagonist is H-151 at 5 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 .
[0020] Preferably, when the endoplasmic reticulum stress inducer is used in combination with a chemotherapeutic drug, the endoplasmic reticulum stress inducer is thapsigargin at an effective concentration of 0.25-0.5 mg / kg -1 or tunicamycin at an effective concentration of 0.3-0.35 mg / kg -1 , and the effective concentration of the chemotherapeutic drug cisplatin is 3-10 mg / kg -1 ; the effective concentration of 5-fluorouracil is 25-50 mg / kg -1 ; the effective concentration of irinotecan is 25-50 mg / kg -1 ;
[0021] More preferably, when the endoplasmic reticulum stress inducer is used in combination with a chemotherapeutic drug, the endoplasmic reticulum stress inducer is thapsigargin at an effective concentration of 0.3 mg / kg -1 or tunicamycin at an effective concentration of 0.3 mg / kg -1 , and the effective concentration of the chemotherapeutic drug cisplatin is 3-5 mg / kg -1 ; the effective concentration of 5-fluorouracil is 25 mg / kg -1 ; the effective concentration of irinotecan is 25 mg / kg -1 ;
[0022] Most preferably, when the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the endoplasmic reticulum stress inducer is thapsigargin at 0.3 mg / kg -1 or tunicamycin at 0.3 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 .
[0023] Most preferably, when the STING antagonist, the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the STING antagonist is H-151 at 5 mg / kg -1 , the endoplasmic reticulum stress inducer is thapsigargin at 0.3 mg / kg -1 or tunicamycin at 0.3 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 .
[0024] The present invention also provides a pharmaceutical composition for anti-tumor, and the components of the pharmaceutical composition are composed of a STING antagonist and / or an endoplasmic reticulum stress inducer and a chemotherapeutic drug.
[0025] The combined pharmaceutical composition of the present invention can be in the form of a single compound preparation, or a combination of two separate preparations or a combination of three separate preparations; when it is a combination of two separate preparations or a combination of three separate preparations, the administration method can be simultaneous administration or sequential administration. For example, the STING antagonist can be administered first, and the chemotherapeutic drug can be administered after a period of time, or the chemotherapeutic drug can be administered first, and the STING antagonist can be administered after a period of time, or the STING antagonist and the chemotherapeutic drug can be administered simultaneously.
[0026] Preferably, the STING antagonist is H-151 itself, a H-151 precursor or a H-151 metabolite and a pharmaceutically acceptable salt or ester thereof;
[0027] The endoplasmic reticulum stress inducer is thapsigargin or tunicamycin, the thapsigargin is thapsigargin itself, a thapsigargin precursor or a thapsigargin metabolite and a pharmaceutically acceptable salt or ester thereof, and the tunicamycin is tunicamycin itself, a tunicamycin precursor or a tunicamycin metabolite and a pharmaceutically acceptable salt or ester thereof;
[0028] The chemotherapeutic drugs are selected from at least one of the following drugs: alkylating chemotherapeutic drugs, antimetabolic chemotherapeutic drugs, antibiotic chemotherapeutic drugs, animal and plant chemotherapeutic drugs, and miscellaneous chemotherapeutic drugs.
[0029] Specifically, the miscellaneous chemotherapeutic drugs include platinum-based chemotherapeutic drugs, and the platinum-based chemotherapeutic drugs are cisplatin, carboplatin or oxaliplatin;
[0030] The antimetabolic chemotherapeutic drugs are 5-fluorouracil, gemcitabine, cytarabine or methotrexate; the alkylating chemotherapeutic drugs are cyclophosphamide or ifosfamide; the antibiotic chemotherapeutic drugs are mitomycin, doxorubicin or actinomycin D; the plant chemotherapeutic drugs are etoposide, docetaxel, paclitaxel, vincristine or irinotecan.
[0031] Preferably, the tumor is pancreatic cancer.
[0032] Preferably, when the STING antagonist and the chemotherapeutic drug are used in combination, the effective concentration of the STING antagonist H-151 is 5-10 mg / kg -1 ; the effective concentration of the chemotherapeutic drug cisplatin is 3-10 mg / kg -1 ; the effective concentration of 5-fluorouracil is 25-50 mg / kg -1 ; the effective concentration of irinotecan is 25-50 mg / kg -1 ;
[0033] More preferably, when the STING antagonist and the chemotherapeutic drug are used in combination, the STING antagonist is H-151 5 mg / kg -1 , and the chemotherapeutic drug is cisplatin 3-5 mg / kg -1 , 5-fluorouracil 25 mg / kg -1 , irinotecan 25 mg / kg -1 ;
[0034] Most preferably, when the STING antagonist and the chemotherapeutic drug are used in combination, the STING antagonist is H-151 5 mg / kg -1 , and the chemotherapeutic drug is cisplatin 3 mg / kg -1 , 5-fluorouracil 25 mg / kg -1 , irinotecan 25 mg / kg -1 .
[0035] Preferably, when the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the endoplasmic reticulum stress inducer is thapsigargin with an effective concentration of 0.25-0.5 mg / kg -1 or tunicamycin with an effective concentration of 0.3-0.35 mg / kg -1 , and the effective concentration of the chemotherapeutic drug cisplatin is 3-10 mg / kg-1 ; The effective concentration of 5-fluorouracil is 25-50 mg / kg -1 ; The effective concentration of irinotecan is 25-50 mg / kg -1 ;
[0036] More preferably, when the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the endoplasmic reticulum stress inducer is thapsigargin with an effective concentration of 0.3 mg / kg -1 or tunicamycin with an effective concentration of 0.3 mg / kg -1 , and the effective concentration of the chemotherapeutic drug cisplatin is 3-5 mg / kg -1 ; The effective concentration of 5-fluorouracil is 25 mg / kg -1 ; The effective concentration of irinotecan is 25 mg / kg -1 ;
[0037] Most preferably, when the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the endoplasmic reticulum stress inducer is thapsigargin at 0.3 mg / kg -1 or tunicamycin at 0.3 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 ;
[0038] Most preferably, when the STING antagonist, the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the STING antagonist is H-151 at 5 mg / kg -1 , and the endoplasmic reticulum stress inducer is thapsigargin at 0.3 mg / kg -1 or tunicamycin at 0.3 mg / kg -1 , and the chemotherapeutic drug is cisplatin at 3 mg / kg -1 , 5-fluorouracil at 25 mg / kg -1 , irinotecan at 25 mg / kg -1 .
[0039] In the present invention, the administration routes of the combined drug composition include intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration or transdermal administration. Preferably, the combined drug composition is a combined drug composition loaded on a pharmaceutical carrier.
[0040] Preferably, the pharmaceutical carrier includes liposomes, micelles, dendrimers, microspheres or microcapsules.
[0041] Advantages of the present invention:
[0042] In the present invention, H-151, as an antagonist of STING, can be used in combination with chemotherapeutic drugs to enhance the inhibitory effect on tumors. The endoplasmic reticulum stress inducer TG or TM can also be used in combination with chemotherapeutic drugs to achieve a better inhibitory effect on tumors. In addition, the treatment regimen combining chemotherapy, STING inhibition, and endoplasmic reticulum stress has achieved good tumor inhibitory effects both in vitro and in vivo. The present invention provides a new idea for drug use in tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] Figure 1 For the regulation of the growth and chemotherapy response of pancreatic duct tumors by the STING antagonist H-151. Among them, A shows that real-time fluorescence quantitative PCR shows an increase in the expression level of inflammatory genes in pancreatic duct tumor cells after chemotherapy, and the STING inhibitor H-151 significantly reduces the increase in inflammation caused by chemotherapy; B shows that the combination of the STING inhibitor H-151 and chemotherapy further inhibits tumor growth.
[0044] Figure 2 For the influence of the STING gene on the growth and chemotherapy response of pancreatic duct tumors. A shows the knockdown level of STING protein in PANC02 cells verified by immunoblotting, and real-time fluorescence quantitative PCR shows a decrease in the expression level of inflammatory genes after treatment with chemotherapeutic drugs in PANC02 STINGKO; B shows that the CCK-8 experiment detects that STING KO cells are more sensitive to chemotherapy; C-D shows that STING knockout pancreatic duct tumor cells have limited growth in immunodeficient (C) or immunocompetent mice (D) and have a better response to chemotherapy.
[0045] Figure 3 For the enhancement of the killing of tumors by the combination of the endoplasmic reticulum stress inducer TG or TM and chemotherapeutic drugs. Among them, A shows that the CCK-8 experiment detects in vitro that the combination of TG or TM and the chemotherapeutic drug cisplatin (Cis) enhances the killing of tumor cells; B and C show that in the subcutaneous xenograft tumor models of immunodeficient and immunocompetent mice, the combination of TM and chemotherapeutic drugs further enhances the killing of tumors; D shows that in the subcutaneous xenograft tumor model of immunocompetent mice, the combination of TG and chemotherapeutic drugs enhances the killing of tumors; E shows that in the subcutaneous xenograft tumor model of immunodeficient mice, the combination of H-151, TM, and chemotherapeutic drugs further enhances the inhibition of tumor growth. DETAILED DESCRIPTION OF THE INVENTION
[0046] Materials and Methods
[0047] 1) Cell culture
[0048] KPC and PANC02 cells were cultured in McCoy's 5A (Cytiva) or RPMI 1640 (Cytiva) supplemented with 10% fetal bovine serum (Braserum) and 1% penicillin / streptomycin at 37°C in a 5% CO2 environment.
[0049] 2) Western blot assay
[0050] Add RIPA lysis buffer (Beyotime) to a 6-well plate of cultured cells and place it on ice for 30 minutes of lysis. Protease inhibitor (MedChemExpress) needs to be added to the RIPA lysis buffer in advance. After centrifugation at 20,000 g for 10 minutes at 4°C, take the supernatant, measure the protein concentration using a BCA kit (Beyotime), separate proteins of different sizes using an SDS-PAGE gel after protein denaturation, transfer the proteins onto a polyvinylidene difluoride (PVDF) membrane (Millipore), and use antibodies STING (Wuhan Sanying) and tubulin (Wuhan Sanying) to detect changes in the target protein.
[0051] 3) Cell RNA extraction, reverse transcription, and real-time fluorescence quantitative PCR
[0052] Culture cells in a 24-well plate and extract total RNA from the cells using the RNAiso plus kit (Takara). Use the PrimeScript TM RT reagent Kit with gDNA Eraser (Takara) to reverse transcribe it into cDNA. For real-time fluorescence quantitative PCR, use TB Green Premix Ex Taq (Takara) and perform the operation on a QuantStudio TM 5 (Applied Biosystems) instrument.
[0053] 4) CCK-8 assay for cell viability
[0054] Seed PANC02 cells or KPC cells into a 96-well plate at a density of 1×10 4 cells per well. Treat with Cis (20 μM), TG (5, 15, 25, 75, 150, 300 nM), or TM (25, 50, 75, 125 μg / ml) for 24 hours. Remove the medium, and add 100 μl of medium containing 10 μl of CCK-8 reagent (GlpBio) to each well. Incubate in a 37°C incubator for 1 h, and then measure the absorbance at 450 nm.
[0055] 5) Establishment of a mouse subcutaneous xenograft tumor model and treatment protocol
[0056] Nude mice and C57 BL / 6 male mice (6 - 8 weeks old) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. The mice were housed in a room with a temperature of 20 °C and a humidity of 40 - 60%, a 12-hour light cycle, and fed a normal diet (13% fat, 57% carbohydrates, 30% protein, LabDiet 5LOD). After one week of housing the newly arrived mice, 7.0×10 5 KPC cells or 1.0×10 5 PANC02 cells suspended in 100 μl of PBS were subcutaneously injected into the right side of C57 or nude mice. Within 5 - 7 days after tumor cell implantation, mice with similar tumor volumes and body weights were randomly divided into different treatment groups and administered drugs twice a week for 2 consecutive weeks. The chemotherapy treatment group (Chemo) was intraperitoneally injected with Cisplatin (Cis 3 mg / kg, MedChemExpress), 5-fluorouracil (5-FU 25 mg / kg, MedChemExpress), and Irinotecan (Irinotecan 25 mg / kg -1 , MedChemExpress); the H-151 (5 mg / kg -1 , MedChemExpress) treatment group was also administered by intraperitoneal injection; the Thapsigargin (TG 0.3 mg / kg -1 , MedChemExpress) or Tunicamycin (TM 0.3 mg / kg -1 , MedChemExpress) treatment group was subcutaneously injected around the tumor. Subsequently, the tumor growth was observed, and the tumors were removed on the day after the last injection.
[0057] Example 1
[0058] After KPC cells were treated with the chemotherapeutic drug Cis (20 μM) for 6, 12, 24, 48 hours and with the STING antagonist H-151 (4 μg / ml) for 24 hours, the results of real-time fluorescence quantitative analysis showed that the inflammatory level of the cells after Cis treatment increased with the prolongation of the treatment time, and the co-treatment with H-151 during Cis treatment could significantly reduce the increase in the inflammatory level, indicating that H-151 could inhibit STING-mediated inflammation after Cis treatment ( Figure 1 A).
[0059] After establishing a subcutaneous xenograft tumor model using the KPC cell line in nude mice, the chemotherapeutic drugs Cisplatin (Cis 3 mg / kg -1 ), 5-fluorouracil (5-FU 25 mg / kg -1 ), and Irinotecan (Irinotecan 25 mg / kg -1) and STING antagonist H-151 (5 mg / kg -1 ) were intraperitoneally injected into mice, administered twice a week. After two weeks, the tumors subcutaneously in the mice were removed. By comparing the weights and sizes of tumors in different treatment groups, it was found that the tumor size and weight in the group of mice treated with the combination of H-151 and chemotherapeutic drugs (Chemo+H151) were significantly smaller than those in the untreated mice and the group treated only with chemotherapeutic drugs (Chemo). This indicates that the combined use of H-151 and chemotherapeutic drugs enhanced the inhibitory effect on tumor growth( Figure 1 B).
[0060] Example 2
[0061] After designing the sgRNA sequence (CACCGTGAGGGCTACATATTTGGAG / AAACCTCCAAATATGTAGCCCTCAC) of STING (GenBank: KR154221.1) using the website https: / / benchling.com / , the lentiCRISPRv2 plasmid was constructed and Panc02 cells were infected with lentivirus. Western blot experiments verified that the expression level of STING protein in Panc02 cells decreased( Figure 2 A). The results of real-time fluorescence quantitative experiments showed that after Cis treatment, the inflammatory level of the STING protein knockdown cell line was significantly lower than that of the wild-type cell line( Figure 2 A).
[0062] Panc02 wild-type cell line and STING protein knockdown cell line were seeded in 96-well plates at a density of 1×10 4 cells per well. After treating the cells with the chemotherapeutic drug Cis (20 μM) for 24 hours and detecting with CCK-8, it was found that the STING protein knockdown cell line was more sensitive to Cis treatment( Figure 2 B).
[0063] A mouse subcutaneous xenograft tumor model was established using Panc02 wild-type cell line and STING protein knockdown cell line. The results showed that in nude mice or C57 mice, the tumor size and weight in the STING protein knockdown group were significantly smaller than those in the wild-type cell group, indicating that the deletion of STING protein would affect the growth of tumor cells to a certain extent( Figure 2 C and 2D).
[0064] Example 3
[0065] After treatment with the chemotherapeutic drug Cis, the protein levels of UPR-related genes in KPC or PANC02 cells were significantly reduced. KPC cells were treated with the drugs TG (5, 15, 25, 75, 150, 300 nM) or TM (25, 50, 75, 125 μg / ml) that induce endoplasmic reticulum stress and the chemotherapeutic drug Cis (20 μM) for 24 hours. The results showed that the survival rate of tumor cells was lower when the cells were treated with the endoplasmic reticulum stress drugs TG or TM and the chemotherapeutic drug Cis simultaneously ( Figure 3 A).
[0066] Example 4
[0067] A subcutaneous xenograft model of pancreatic cancer was established in nude mice and C57 BL / 6 male mice. While treating the mice with intraperitoneal injection of chemotherapeutic drugs (Chemo), the drug TM (0.3 mg / kg -1 ) that can induce endoplasmic reticulum stress was injected around the subcutaneous tumors twice a week. After two weeks, the tumors were removed and their weights and sizes were measured. The results showed that injecting the drug that induces endoplasmic reticulum stress around the tumor while treating with chemotherapeutic drugs could significantly inhibit tumor growth ( Figure 3 B and 3C).
[0068] Example 5
[0069] A subcutaneous xenograft model of pancreatic cancer was established in C57 BL / 6 male mice. While treating the mice with intraperitoneal injection of chemotherapeutic drugs (Chemo), the drug TG (0.3 mg / kg -1 ) that can induce endoplasmic reticulum stress was injected around the subcutaneous tumors twice a week. After two weeks, the tumors were removed and their weights and sizes were measured. The results showed that injecting the drug TG that induces endoplasmic reticulum stress around the tumor while injecting chemotherapeutic drugs could enhance the killing effect on tumors ( Figure 3 D).
[0070] Example 6
[0071] A subcutaneous xenograft model of pancreatic cancer (KPC) was established in male nude mice. While treating the mice with intraperitoneal injection of chemotherapeutic drugs (Chemo), the drug TM (0.3 mg / kg -1 ) that can induce endoplasmic reticulum stress and the STING antagonist H-151 (5 mg / kg -1 ) were injected around the subcutaneous tumors twice a week. During the treatment, tumor growth was monitored by measuring tumor volume. The results showed that the combination of TM, H-151 and chemotherapeutic drugs further enhanced the inhibition of tumor growth ( Figure 3 E).
Claims
1. Use of STING antagonists and / or endoplasmic reticulum stress inducers combined with chemotherapeutic drugs in the preparation of anti-tumor drugs.
2. The use according to claim 1, characterized in that: The STING antagonist is H-151 itself, H-151 precursor or H-151 metabolite and pharmaceutically acceptable salts or esters thereof; The endoplasmic reticulum stress inducer is thapsigargin or tunicamycin, the thapsigargin is thapsigargin itself, a thapsigargin precursor or a thapsigargin metabolite, and a pharmaceutically acceptable salt or ester thereof, and the tunicamycin is tunicamycin itself, a tunicamycin precursor or a tunicamycin metabolite, and a pharmaceutically acceptable salt or ester thereof; The chemotherapy drug is selected from at least one of the following drugs: alkylating agent chemotherapy drugs, anti-metabolism chemotherapy drugs, antibiotic chemotherapy drugs, animal and plant chemotherapy drugs and miscellaneous chemotherapy drugs.
3. The use according to claim 2, characterized in that: The miscellaneous chemotherapy drugs include platinum chemotherapy drugs, and the platinum chemotherapy drugs are cisplatin, carboplatin or oxaliplatin; The antimetabolite chemotherapy drug is 5-fluorouracil, gemcitabine, cytarabine or methotrexate; the alkylating agent chemotherapy drug is cyclophosphamide or ifosfamide; the antibiotic chemotherapy drug is mitomycin, doxorubicin or dactinomycin D; the plant chemotherapy drug is etoposide, docetaxel, paclitaxel, vincristine or irinotecan.
4. The use according to claim 1, characterized in that: The tumor is pancreatic cancer.
5. The use according to claim 3, characterized in that: When the STING antagonist is used in combination with a chemotherapeutic drug, the effective concentration of the STING antagonist H-151 is 5 to 10 mg kg -1 The effective concentration of the chemotherapy drug cisplatin is 3 to 10 mg kg -1 ; The effective concentration of 5-fluorouracil is 25-50 mg kg -1 The effective concentration of irinotecan is 25-50 mg kg -1 ; When the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the endoplasmic reticulum stress inducer is thapsigargin with an effective concentration of 0.25 to 0.5 mg kg -1 Or the effective concentration of tunicamycin is 0.3-0.35 mg kg -1 The effective concentration of the chemotherapy drug cisplatin is 3 to 10 mg kg -1 ; The effective concentration of 5-fluorouracil is 25-50 mg kg -1 The effective concentration of irinotecan is 25-50 mg kg -1 ; When a STING antagonist, an endoplasmic reticulum stress inducer, and a chemotherapeutic drug are used in combination, the STING antagonist is H-1515 mg kg -1 The endoplasmic reticulum stress inducer is 0.3 mg kg thapsigargin -1 or tunicamycin 0.3 mg kg -1 The chemotherapy drug is cisplatin 3 mg kg -1 , 5-fluorouracil 25 mg kg -1 irinotecan 25 mg kg -1 .
6. A pharmaceutical composition for anti-tumor, characterized in that: The pharmaceutical composition consists of a STING antagonist and / or an endoplasmic reticulum stress inducer and a chemotherapeutic drug.
7. The anti-tumor pharmaceutical composition according to claim 6, characterized in that: The STING antagonist is H-151 itself, H-151 precursor or H-151 metabolite and pharmaceutically acceptable salts or esters thereof; The endoplasmic reticulum stress inducer is thapsigargin or tunicamycin, the thapsigargin is thapsigargin itself, a thapsigargin precursor or a thapsigargin metabolite, and a pharmaceutically acceptable salt or ester thereof, and the tunicamycin is tunicamycin itself, a tunicamycin precursor or a tunicamycin metabolite, and a pharmaceutically acceptable salt or ester thereof; The chemotherapy drug is selected from at least one of the following drugs: alkylating agent chemotherapy drugs, anti-metabolism chemotherapy drugs, antibiotic chemotherapy drugs, animal and plant chemotherapy drugs and miscellaneous chemotherapy drugs.
8. The anti-tumor pharmaceutical composition according to claim 7, characterized in that: The miscellaneous chemotherapy drugs include platinum chemotherapy drugs, and the platinum chemotherapy drugs are cisplatin, carboplatin or oxaliplatin; The antimetabolite chemotherapy drug is 5-fluorouracil, gemcitabine, cytarabine or methotrexate; the alkylating agent chemotherapy drug is cyclophosphamide or ifosfamide; the antibiotic chemotherapy drug is mitomycin, doxorubicin or dactinomycin D; the plant chemotherapy drug is etoposide, docetaxel, paclitaxel, vincristine or irinotecan.
9. The anti-tumor pharmaceutical composition according to claim 6, characterized in that: The tumor is pancreatic cancer.
10. The anti-tumor pharmaceutical composition according to claim 8, characterized in that: When the STING antagonist is used in combination with a chemotherapeutic drug, the effective concentration of the STING antagonist H-151 is 5 to 10 mg kg -1 The effective concentration of the chemotherapy drug cisplatin is 3 to 10 mg kg -1 ; The effective concentration of 5-fluorouracil is 25-50 mg kg -1 The effective concentration of irinotecan is 25-50 mg kg -1 ; When the endoplasmic reticulum stress inducer and the chemotherapeutic drug are used in combination, the effective concentration of the endoplasmic reticulum stress inducer thapsigargin is 0.25 to 0.5 mg kg -1 Or the effective concentration of tunicamycin is 0.3-0.35 mg kg -1 The effective concentration of the chemotherapy drug cisplatin is 3 to 10 mg kg -1 ; The effective concentration of 5-fluorouracil is 25-50 mg kg -1 The effective concentration of irinotecan is 25-50 mg kg -1 ; When a STING antagonist, an endoplasmic reticulum stress inducer, and a chemotherapeutic drug are used in combination, the STING antagonist is H-1515 mg kg -1 The endoplasmic reticulum stress inducer is 0.3 mg kg thapsigargin -1 or tunicamycin 0.3 mg kg -1 The chemotherapy drug is cisplatin 3 mg kg -1 , 5-fluorouracil 25 mg kg, and irinotecan 25 mg kg.
Citation Information
Cited By
Application of poison carotene and doxorubicin in combined treatment of leukemia
CN121818683A