Lactobacillus mucilaginosus and application thereof

Abstract

The invention discloses a lactobacillus mucus fermentation strain and application thereof, the lactobacillus mucus fermentation strain is preserved in Guangdong Microbial Culture Collection Center (GDMCC) on February 21, 2025, and the preservation number is GDMCCNO: 65936. The feruloyl esterase is separated and screened from white sour soup in Kailing in southeast of Guizhou province, has feruloyl esterase activity, and shows good blood fat reducing and fatty liver treating capabilities in a HepG2 high-fat cell model and a high-fat zebra fish model. The compound has a good prospect in the development of products for preventing or treating hyperlipidemia and fatty liver and relieving obesity.

Description

Technical Field

[0001] The present invention relates to the technical field of probiotics, and more specifically, to a Limosilactobacillus fermentum strain and its applications. Background Art

[0002] Hyperlipidemia is a disease caused by lipid metabolism disorders resulting in abnormal blood lipid levels, mainly manifested as increased levels of total cholesterol (TC), triglycerides (TG), and low-density lipoprotein cholesterol (LDL-C) in the blood, as well as decreased levels of high-density lipoprotein cholesterol (HDL-C). In recent years, with the changes in people's lifestyles, including factors such as high-fat diets, irregular work and rest, and lack of exercise, the incidence of this disease has shown an obvious upward trend. This not only affects people's quality of life but also may induce cardiovascular and cerebrovascular diseases such as atherosclerosis and coronary heart disease, seriously threatening human health.

[0003] Currently, the treatment methods for hyperlipidemia mainly include drug treatment and lifestyle adjustments. Among drug treatments, statin drugs are commonly used cholesterol-lowering drugs, but long-term use may cause side effects such as liver damage. In terms of non-drug treatments, foods containing lactic acid bacteria with lipid-lowering functions are considered a safe and effective alternative.

[0004] Lactic acid bacteria are a type of probiotics that can ferment carbohydrates into lactic acid, hence the name. Among them, the genera Lactobacillus, Lactococcus, Streptococcus, Pediococcus, Leuconostoc, and Bifidobacterium are included in the List of Strains that Can Be Used in Foods and have high safety.

[0005] Limosilactobacillus fermentum, also known as Lactobacillus fermentum, has the effects of promoting digestion, enhancing immunity, improving intestinal function, and regulating the intestinal flora. Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a Limosilactobacillus fermentum strain and its applications.

[0007] The first purpose of the present invention is to provide a Limosilactobacillus fermentum strain.

[0008] The second purpose of the present invention is to provide the culture supernatant of the Limosilactobacillus fermentum strain

[0009] The third object of the present invention is to provide a fermentation broth containing bacterial cells of the fermented Limosilactobacillus fermentum.

[0010] The fourth object of the present invention is to provide the bacterial cells of the fermented Limosilactobacillus fermentum.

[0011] The fifth object of the present invention is to provide the use of one or several of the fermented Limosilactobacillus fermentum, the culture supernatant, the fermentation broth and the bacterial cells in the preparation of a preparation having ferulic acid esterase activity.

[0012] The sixth object of the present invention is to provide the use of one or several of the fermented Limosilactobacillus fermentum, the culture supernatant, the fermentation broth and the bacterial cells in the preparation of a product for preventing and treating hyperlipidemia.

[0013] The seventh object of the present invention is to provide the use of one or several of the fermented Limosilactobacillus fermentum, the culture supernatant, the fermentation broth and the bacterial cells in the preparation of a product for preventing and treating fatty liver.

[0014] The eighth object of the present invention is to provide the use of one or several of the fermented Limosilactobacillus fermentum, the culture supernatant, the fermentation broth and the bacterial cells in the preparation of a product for relieving obesity or losing weight.

[0015] The ninth object of the present invention is to provide a bacterial agent.

[0016] The tenth object of the present invention is to provide a preparation.

[0017] In order to achieve the above objects, the present invention is realized by the following technical solutions:

[0018] The present invention claims protection for the following products:

[0019] A strain of Limosilactobacillus fermentum SHY0004, deposited on February 21, 2025 at the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC), with the deposit number GDMCC NO: 65936.

[0020] The culture supernatant of the fermented Limosilactobacillus fermentum.

[0021] The fermentation broth containing bacterial cells of the fermented Limosilactobacillus fermentum.

[0022] The bacterial cells of the fermented Limosilactobacillus fermentum.

[0023] The present invention also claims protection for the following uses:

[0024] Use of one or more of the Lactobacillus mucosae fermentum, the culture supernatant, the fermentation broth, and the bacterial cells in the preparation of a preparation having ferulic acid esterase activity.

[0025] Use of one or more of the Lactobacillus mucosae fermentum, the culture supernatant, the fermentation broth, and the bacterial cells in the preparation of a product for preventing and treating hyperlipidemia.

[0026] Use of one or more of the Lactobacillus mucosae fermentum, the culture supernatant, the fermentation broth, and the bacterial cells in the preparation of a product for preventing and treating fatty liver.

[0027] Use of one or more of the Lactobacillus mucosae fermentum, the culture supernatant, the fermentation broth, and the bacterial cells in the preparation of a product for relieving obesity or losing weight.

[0028] The present invention further claims protection for:

[0029] A bacterial agent containing the Lactobacillus mucosae fermentum or the bacterial cells.

[0030] A preparation containing one or more of the Lactobacillus mucosae fermentum, the culture supernatant, the fermentation broth, and the bacterial cells.

[0031] Preferably, it further contains excipients.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention provides a Lactobacillus mucosae fermentum SHY0004 isolated and screened from the white sour soup in Kaili City, Qiandongnan Prefecture, Guizhou Province, which has ferulic acid esterase activity and shows good ability to reduce blood lipids and treat fatty liver in the HepG2 hyperlipidemic cell model and the hyperlipidemic zebrafish model. It has good prospects in the development of products for preventing or treating hyperlipidemia, fatty liver, and relieving obesity. Description of the Drawings

[0034] Figure 1 Growth and reaction of Lactobacillus mucosae fermentum SHY0004 on MRS agar medium containing ethyl ferulate.

[0035] Figure 2Effect of Lactobacillus mucosae SHY0004 on lipid droplets in the HepG2 high-fat cell model; Figure a is the fluorescence microscope image of normal HepG2 cells (Control), b is the fluorescence microscope image of HepG2 cells induced by sodium oleate for 24 h (Model), c is the fluorescence microscope image of HepG2 cells induced by sodium oleate plus the fermentation supernatant of Lactobacillus mucosae SHY0004 (SHY0004), and d is the comparison of the lipid droplet area fractions of the three groups of Control, Model, and SHY0004. The calculation formula is lipid droplet area fraction = total lipid droplet area of a single cell (μm 2 ) ÷ cytoplasmic area (μm 2 ).

[0036] Figure 3 Effect of Lactobacillus mucosae SHY0004 on liver lipid droplets in the zebrafish high-fat model Detailed implementation manners

[0037] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0038] BODIPYTM 493 / 503 staining solution (10 μM): BODIPYTM 493 / 503 is dissolved in anhydrous DMSO to prepare a stock solution of 5 mM. When in use, the stock solution is diluted 500 times with DPBS to obtain a 10 μM BODIPYTM 493 / 503 staining solution, which is stored in the dark for later use.

[0039] Nuclear staining solution: The NucBlue TM live cell nuclear stain is added dropwise to DPBS at a concentration of 2 drops / mL to obtain the nuclear staining solution, which is then stored in the dark for later use.

[0040] Example 1 Isolation, screening and identification of Lactobacillus mucosae SHY0004

[0041] I. Experimental method

[0042] (1) Isolation and screening of Lactobacillus mucosae SHY0004

[0043] Collect the white sour soup in Kaili City, Qiandongnan Prefecture, Guizhou Province. After shaking the original sample solution evenly, 400 μL of the original solution is taken and added to 3.6 mL of sterile physiological saline, and shaken and mixed evenly to prepare a 10 -1 dilution; perform the same operation until diluted to 10 -5 . 1 0-3 、10-4 、10 -5 Dilution gradients: Take 100 μL of the dilution solution respectively, and evenly coat it on the MRS agar plate using a spreading rod, and culture it at 37 °C for 48 h.

[0044] Select the characteristic colonies on the plate with the number of colonies between 30 and 300, pick up some bacterial cells with a sterile inoculation loop for Gram staining, observe the strain morphology under the oil immersion lens of an optical microscope, and record the shape, size, color, etc. of the strain. Lactobacilli are Gram-positive, so retain the colonies that are Gram-positive and pure.

[0045] For the obtained pure colonies that are Gram-positive, pick up a little bacterial cell with a sterile inoculation loop, smear it on a white ceramic reaction plate, and then add a drop of 3% hydrogen peroxide on it to observe whether there are bubbles generated. The generation of bubbles indicates positive, and the absence of bubbles indicates negative. Lactobacilli are usually negative in the catalase test.

[0046] Pick up the pure colonies that are Gram-positive and negative in the catalase test, pick up the bacterial cells with a sterile inoculation loop and streak-purify them on the MRS agar plate, and culture them at 37 °C for 48 h.

[0047] Obtain a single colony SHY0004, pick up the single colony SHY0004 and expand it in the MRS liquid medium, with an inoculation amount of 2%, and culture it overnight at 37 °C. Transfer the overnight cultured bacterial liquid to a sterile cryopreservation tube containing a protective solution and store it in a -80 °C refrigerator.

[0048] (2) Identification of the strain Lactobacillus fermentum SHY0004

[0049] Extract the genomic DNA of strain SHY0004 using a bacterial genomic DNA extraction kit. The upstream primer is 27F (AGAGTTTGATCCTGGCTCAG), and the downstream primer is 1492R (TACGGCTACCTTGTTACGACTT). Amplify the 16S rDNA sequence to obtain a PCR product. And sequence the PCR product.

[0050] Among them, the PCR reaction system: 20 μL of PCR Mix, 0.8 μL of each of the upstream and downstream primers, 2 μL of DNA template, and 16.4 μL of ddH2O.

[0051] The PCR reaction conditions are: 96 °C for 5 min; 96 °C for 30 s, 56 °C for 30 s, 72 °C for 1 min, 35 cycles; 72 °C for 5 min.

[0052] Detect the PCR product by 1.0% agarose gel electrophoresis and observe the band characteristics. Send the PCR product to Sangon Biotech Co., Ltd. for sequencing.

[0053] II. Experimental Results

[0054] The 16S rDNA sequence of strain SHY0004 obtained by sequencing is shown in SEQ ID No.1. By performing NCBI-BLAST alignment, it was identified as Limosilactobacillus fermentum and named Limosilactobacillus fermentum SHY0004. It was deposited at the Guangdong Provincial Culture Collection of Microorganisms (GDMCC) on February 21, 2025, with the deposit number GDMCC NO:65936 and the taxonomic name Limosilactobacillus fermentum.

[0055] SEQ ID No.1:

[0056] TACATGCAGTCGAACGCGTTGGCCCAATTGATTGATGGTGCTTGCACCTGAT

[0057] TGATTTTGGTCGCCAACGAGTGGCGGACGGGTGAGTAACACGTAGGTAAC

[0058] CTGCCCAGAAGCGGGGGACAACATTTGGAAACAGATGCTAATACCGCATAA

[0059] CAACGTTGTTCGCATGAACAACGCTTAAAAGATGGCTTCTCGCTATCACTTC

[0060] TGGATGGACCTGCGGTGCATTAGCTTGTTGGTGGGGTAACGGCCTACCAAG

[0061] GCGATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACAATGGGACTGA

[0062] GACACGGCCCATACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATG

[0063] GGCGCAAGCCTGATGGAGCAACACCGCGTGAGTGAAGAAGGGTTTCGGCT

[0064] CGTAAAGCTCTGTTGTTAAAGAAGAACACGTATGAGAGTAACTGTTCATAC

[0065] GTTGACGGTATTTAACCAGAAAGTCACGGCTAACTACGTGCCAGCAGCCGC

[0066] GGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGAG

[0067] TGCAGGCGGTTTTCTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAA

[0068] GTGCATCGGAAACTGGATAACTTGAGTGCAGAAGAGGGTAGTGGAACTCC

[0069] ATGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGTGGCGAAGG

[0070] CGGCTACCTGGTCTGCAACTGACGCTGAGACTCGAAAGCATGGGTAGCGA

[0071] ACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGATGAGTGCTAGGTG

[0072] TTGGAGGGTTTCCGCCCTTCAGTGCCGGAGCTAACGCATTAAGCACTCCGC

[0073] CTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGGAATTGACGGGGGCC

[0074] CGCACAAGCGGTGGAGCATGTGGGTTTAATTTCGAAGCTACGCGAAGAAC

[0075] CCTTACCAGGTCTTGACATCTTTGCGCCCAACCCTTAGAGATAGGGCGTTTT

[0076] CCTTTCGGGAACGCCAATGACAGGTGGTGCATGGTCGTTCGTCAGCTCGTGTCGTGAGATGTTGGTTAAGTTCCC。

[0077] Determination of Ferulic Acid Esterase Activity of Lactobacillus mucosae SHY0004 in Example 2

[0078] I. Experimental methods

[0079] Ferulic acid has been fully proven to significantly reduce serum TC, TG, and LDL-C, significantly increase serum HDL-C, and reduce fat deposition in the liver. Ferulic acid mainly binds to polysaccharides, lignin, and proteins in the cell wall through ester bonds to form the structural components of the cell wall. This makes ferulic acid difficult to be digested and utilized. However, ferulic acid esterase can break the ester bond in ferulic acid ester, disrupt the network structure inside the plant cell wall, and release ferulic acid from the plant cell wall, thus playing a role in reducing blood lipids. Therefore, the ferulic acid esterase activity of Limosilactobacillus fermentum SHY0004 was detected. The specific method is as follows:

[0080] Add 6 mL of a solution containing 10% (w / v) ethyl 4-hydroxy-3-methoxycinnamate (ethyl ferulate) dissolved in N,N-dimethylformamide (DMF) to 500 mL of MRS liquid medium and mix gently. Then pour the medium into a sterile Petri dish and solidify it at room temperature to make a plate. Dip a fresh fermentation broth of SHY0004 strain cultured overnight with an inoculation loop and streak it on the ethyl ferulate-MRS plate, and incubate it at 37 °C for 48 h. If a clear zone appears around the colony, it indicates the presence of ferulic acid esterase activity.

[0081] II. Experimental results

[0082] The results are as Figure 1 shown. A large clear zone appears around Limosilactobacillus fermentum SHY0004, indicating that Limosilactobacillus fermentum SHY0004 has high ferulic acid esterase activity.

[0083] Example 3. Effect of Limosilactobacillus fermentum SHY0004 on lipid droplets in the HepG2 high-fat cell model

[0084] I. Experimental methods

[0085] (1) Preparation of fermentation supernatant

[0086] Take the seed liquid of Limosilactobacillus fermentum SHY0004 in the logarithmic phase and inoculate it into 50 mL of MRS liquid medium at an inoculation amount of 2% (v / v), and culture it on a shaker at 37 °C for 15 h. After incubation, count with a microbial cell counter and record the corresponding cell density. The remaining fermentation broth is centrifuged at 6000 rpm for 10 min at 4 °C, and the supernatant is collected. Adjust the pH of the fermentation broth to 7.0 ± 0.1 with 2 M sodium hydroxide solution, and then filter it through a 0.22 μm filter. Take 30 mL of the supernatant and place it in a 50 mL centrifuge tube, and store it at -80 °C for later use.

[0087] After the moisture in the sample is completely frozen, place the centrifuge tube in a vacuum freeze dryer to make freeze-dried powder. Then, make the freeze-dried powder up to 3 mL to prepare a 10-fold concentrated fermentation supernatant concentrate (10-fold concentrated fermentation supernatant) and store it in a -80 °C refrigerator for later use.

[0088] (2) Construction of HepG2 high-fat cell model and intervention with fermentation supernatant of Lactobacillus mucosae SHY0004

[0089] Inoculate HepG2 cells in DMEM medium containing 10% (v:v) fetal bovine serum and 1% triple antibody (penicillin-streptomycin-amphotericin B mixed solution), and culture them in a 37 °C, 5% CO2 cell incubator. When the cells are cultured to 80% - 90%, conduct subsequent experiments.

[0090] Seed HepG2 cells in a 24-well plate at a seeding density of 4×10 4 cells / well and incubate them in a 37 °C, 5% CO2 cell incubator for 12 hours. After incubation, discard the medium and wash once with PBS. Then, set up a control group (Control), a model group (Model), and a supernatant group on the 24-well plate, with three parallels in each group, and incubate them all in a 37 °C, 5% CO2 cell incubator for 24 hours.

[0091] The medium for the model group is: 500 μM sodium oleate + 5% (v:v) sterile water + 95% (v:v) HepG2 cell culture medium;

[0092] The medium for the supernatant group is: 500 μM sodium oleate + 5% (v:v) 10-fold concentrated fermentation supernatant + HepG2 cell culture medium;

[0093] The medium for the control group is: 5% (v:v) sterile water + HepG2 cell culture medium.

[0094] After incubation, discard the medium, wash twice with Dulbecco's Phosphate-Buffered Saline (DPBS), then add 500 μL of BODIPYTM 493 / 503 staining solution (10 μM) and incubate at 37 °C for 15 min. After incubation, discard the staining solution, wash twice with DPBS, then add 500 μL of nuclear staining solution and incubate at 37 °C for 30 min. After incubation, discard the staining solution, wash twice with DPBS. Then, add 500 μL of Hank's balanced salt solution (BHSS).

[0095] Cell images were captured on a high-content cell imaging analysis system, and the images were analyzed and calculated using Harmony software. SPSS 27.0 software was used for statistical processing of the data. The experimental data were all expressed as x±SD, and one-way ANOVA was used. Compared with the control group: p<0.001, compared with the model group: **P<0.001.

[0096] II. Experimental Results

[0097] The results are as Figure 2 shown. According to Figure 2 a and b in Figure 2 it can be found that the lipid droplets (green fluorescence) in HepG2 cells of the model group increased significantly. According to

[0098] a and d in Figure 2 it can be found that compared with the control group (lipid droplet area fraction: 0.031±0.001), the lipid droplet area fraction of HepG2 cells in the model group (0.309±0.010) increased significantly (P<0.001), indicating that the establishment of the HepG2 high-fat cell model was successful this time. Figure 2 According to b and c in

[0099] Figure 2

[0100] Example 4 Effect of Lactobacillus mucosae SHY0004 on liver lipid droplets in a zebrafish high-fat model

[0101] I. Experimental Methods

[0102] (1) Sample Preparation

[0103] Take the seed liquid of Lactobacillus mucosae SHY0004 in the logarithmic phase, inoculate it into 5 mL of MRS liquid medium at an inoculation amount of 2% (v:v), and culture it in a shaker at 37°C for 12 h. The fermentation broth was centrifuged at 6000 rpm for 10 min at 4°C, and the supernatant was discarded. The bacterial cell precipitate was washed twice with sterile normal saline, and then resuspended with 5 mL of sterile normal saline. The bacterial suspension was counted using a microbial cell counter, and the corresponding bacterial density was recorded. The bacterial density was adjusted to 1×10 9 cells / mL and placed in a refrigerator at 4°C for standby.

[0104] (2) Construction of zebrafish hyperlipidemia model and treatment with Lactobacillus fermentum mucosum SHY0004

[0105] The zebrafish broodstock used was the AB strain introduced from the National Zebrafish Resource Center. 5-day post-fertilization (dfp) larvae treated with phenylthiourea (PTU) to remove body color were used as experimental fish.

[0106] The experimental group, blank control group, positive drug group (fenofibrate, 1.5 mg / L), and model group were set up, with 60 zebrafish in each group.

[0107] Blank group: Cultured with E3 culture water.

[0108] Model group: Cultured with E3 culture water containing 0.1% egg yolk powder;

[0109] Positive drug group: Cultured with E3 culture water containing 1.5 mg / L fenofibrate and 0.1% egg yolk powder;

[0110] Experimental group: Cultured with E3 culture water containing Lactobacillus fermentum mucosum SHY0004 (1×107 cells / mL) and 0.1% egg yolk powder.

[0111] Among them, E3 culture water contains 5 mM sodium chloride, 0.17 mM potassium chloride, 0.33 mM calcium chloride, 0.33 mM magnesium sulfate, and is prepared with ultrapure water.

[0112] After treatment until 7 dfp, it was fixed with 4% paraformaldehyde, and then stained with Oil Red O for 2 h and then eluted. Each group of zebrafish embryos was photographed under a microscope, 40 tails were photographed in each group, the light intensity of the zebrafish liver area was collected using imageJ, and the difference in the average brightness values of each group was tested for significance. The experimental data were statistically processed using SPSS 27.0 software. The experimental data were all expressed as x±SD. One-way ANOVA was used. Compared with the control group: p<0.001, compared with the model group: ***P<0.001.

[0113] II. Experimental results

[0114] The results are as Figure 3 shown. The results showed that the mean liver brightness of the positive drug (fenofibrate) group of zebrafish (98.378±15.009) was significantly different from that of the model group (mean liver brightness: 115.257±8.431) (P<0.001). Therefore, fenofibrate has a lipid-lowering effect, which is consistent with the clinical results.

[0115] The mean liver brightness of the Lactobacillus mucosae SHY0004 intervention group (experimental group) was 89.115 ± 16.049, showing a significant difference compared with the model group (mean liver brightness: 115.257 ± 8.431) (P < 0.001). Therefore, the above results indicate that Lactobacillus mucosae SHY0004 has the effects of reducing blood lipid and preventing and treating fatty liver, and is more effective than the positive drug.

Claims

1. A strain of Limosilactobacillus fermentum, characterized in that: It was deposited in Guangdong Provincial Microbiological Culture Collection Center on February 21, 2025, with the deposit number GDMCC NO:65936.

2. The culture supernatant of the fermented mucilaginous lactobacillus according to claim 1.

3. The fermentation liquid containing the bacterial cells of the fermented Lactobacillus mucilaginosus according to claim 1.

4. The bacterial cell of the fermented Lactobacillus mucilaginosus according to claim 1.

5. Use of one or more of the fermented mucoid Lactobacillus according to claim 1, the culture supernatant according to claim 2, the fermentation broth according to claim 3 and the bacterial cells according to claim 4 in the preparation of a preparation having ferulic acid esterase activity.

6. Use of one or more of the fermented mucus lactobacillus according to claim 1, the culture supernatant according to claim 2, the fermentation liquid according to claim 3 and the bacterial cells according to claim 4 in the preparation of products for preventing and treating hyperlipidemia.

7. Use of one or more of the fermented mucus lactobacillus according to claim 1, the culture supernatant according to claim 2, the fermentation liquid according to claim 3 and the bacterial cells according to claim 4 in the preparation of products for preventing and treating fatty liver.

8. Use of one or more of the fermented mucus lactobacillus according to claim 1, the culture supernatant according to claim 2, the fermentation liquid according to claim 3 and the bacterial cells according to claim 4 in the preparation of products for alleviating obesity or losing weight.

9. A bacterial agent, characterized in that Contains the fermented mucus lactobacillus according to claim 1 or the bacterial cell according to claim 4.

10. A preparation, characterized in that Contains one or more of the fermented mucus lactobacillus according to claim 1, the culture supernatant according to claim 2, the fermentation liquid according to claim 3 and the bacterial cells according to claim 4.

Images