Method for constructing novel fish germplasm with low fat deposition rate based on Ppargamma gene knockout

Abstract

The invention discloses a method for constructing a novel low-fat-deposition-rate fish germplasm based on Ppargamma gene knockout, which comprises the following steps: specifically knocking out a fish Ppargamma gene by using a CRISPR / Cas9 gene editing technology, constructing a fish Ppargamma deletion mutant, screening a novel low-fat grass carp germplasm, reducing the fat deposition rate of a fish body, and culturing a novel low-fat-content fish variety. The problems of accumulation of mesenteric fat of the grass carp, excessive accumulation of body fat of nutritional fatty liver and the like are effectively solved. The grass carp Ppargamma gene is directionally edited through a gene editing technology, support is provided for molecular mechanism research of fish nutrition, the important scientific research value is achieved, the function of the Ppargamma gene in fish fat metabolism can be deeply analyzed, the remarkable industrial application value is achieved, sustainable development of the aquaculture industry can be promoted, and the application prospect is wide. The requirements of the market on low-fat and high-nutritional-value fish products are met. The low-fat grass carp new germplasm cultivated by the method can provide a new technical approach and germplasm resources for fish nutrition improvement and healthy cultivation.

Description

Technical Field

[0001] The present invention relates to the fields of aquaculture and molecular biology, and particularly relates to a method for constructing a new germplasm of fish with a low fat deposition rate based on Pparγ gene knockout. Background Art

[0002] With the increasing attention of people to healthy diets, the demand for aquatic products with low fat content is growing day by day. Fish are an important source of protein for humans. In view of the problems of excessive body fat accumulation such as mesenteric fat accumulation and nutritional fatty liver, and obesity of germplasm in bulk cultured fish under intensive farming mode, and the high fat content in some fish, which does not meet the requirements of modern healthy diets. Traditional fish breeding methods are difficult to quickly and effectively reduce the fat content in fish bodies. Summary of the Invention

[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for constructing a new germplasm of fish with a low fat deposition rate based on Pparγ gene knockout. This method uses the CRISPR / Cas9 gene editing technology to specifically knockout the Pparγ gene of fish, construct a Pparγ deletion mutant of grass carp, screen a new germplasm of low-fat grass carp, reduce the fat deposition rate in fish bodies, and cultivate new germplasm fish with a low fat content; effectively solve the problems of excessive body fat accumulation such as mesenteric fat accumulation and nutritional fatty liver in grass carp.

[0004] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0005] The present invention provides a method for constructing a new germplasm of fish with a low fat deposition rate based on Pparγ gene knockout, including the following steps:

[0006] 1) Synthesize the sgRNA target site sequence: Analyze the Pparγ gene sequence of fish, clone the Pparγ gene sequence from the target fish genome, and perform bioinformatics analysis to determine the sgRNA target site of the Pparγ gene, and synthesize the sgRNA target site sequence;

[0007] 2) In vitro transcription of Pparγ-gRNA: Use the sgRNA target site sequence to transcribe Pparγ-gRNA in vitro;

[0008] 3) In vitro microinjection of Pparγ-gRNA: Collect the eggs and sperm of mature fish parents, perform in vitro artificial insemination, and then perform gene editing on fish fertilized eggs by microinjecting a CRISPR / Cas9 vector system containing Pparγ-gRNA; after injection, incubate; wherein, the CRISPR / Cas9 vector system is prepared by mixing Pparγ-gRNA and zCas9mRNA.

[0009] 4) Knockout effect analysis: Genomic DNA was extracted from the fin rays of surviving grass carp individuals. The gene sequence where the target site is located was amplified using the target site detection primers and subjected to electrophoresis. Individuals with non-single bands in the electrophoresis or non-unimodal results in the target site sequencing were detected and screened. The knockout effect of the Pparγ gene target site was verified using whole-body fat quantitative analysis, and Pparγ deletion mutants were screened, which are new germplasms of fish with low fat deposition rate.

[0010] Further, in the step 1), the sgRNA target site sequence is any one of the following three sequences:

[0011] Pparγ-E2: GGGGTTGGGTCGTTCTGTGT, as shown in SEQ ID NO:1;

[0012] Pparγ-E3: GGAGGATGAAGACGGATCTT, as shown in SEQ ID NO:2;

[0013] Pparγ-E4: GGCTTCAGGCGAATCGTCCT, as shown in SEQ ID NO:3.

[0014] Still further, in the step 1), the sgRNA target site sequence is Pparγ-E4: GGCTTCAGGCGAATCGTCCT.

[0015] Still further, in the step 1), when the sgRNA target site sequence is Pparγ-E2, the sgRNA sequence primer Pparγ-E2sgRNA was synthesized:

[0016] CCTCTAATACGACTCACTATAGGGGTTGGGTCGTTCTGTG TGTTTTAGAGCTAGA, as shown in SEQ ID NO:4;

[0017] When the sgRNA target site sequence is Pparγ-E3, the sgRNA sequence primer Pparγ-E3sgRNA was synthesized:

[0018] CCTCTAATACGACTCACTATAGGAGGATGAAGACGGATCT TCGTTTTAGAGCTAGA, as shown in SEQ IDNO:5;

[0019] When the sgRNA target site sequence is Pparγ-E4, the sgRNA sequence primer Pparγ-E4sgRNA was synthesized:

[0020] CCTCTAATACGACTCACTATAGGCTTCAGGCGAATCGTCC TGGTTTTAGAGCTAGA, as shown in SEQ ID NO:6.

[0021] Furthermore, in the step 1), the PCR amplification reaction system for synthesizing the sgRNA sequence:

[0022] Max buffer 12.5 μL 2.5 mM dNTP Mix 0.5 μL target (i.e., primer for synthesizing sgRNA sequence, 10 μm) 5 μL scaffold (10 μm) 5 μL Phusion DNA Polymerase 0.5 μL Make up the volume to 25 μL

[0023] PCR steps: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 15 s, for 45 cycles; and finally extension at 72°C for 5 min.

[0024] Furthermore, in the step 3), the in vitro transcription reaction system of the sgRNA:

[0025] transription buffer 5 μL 10 mM NTPS 2.5 μL T7 RNA Polymerase 1 μL RNA inhibitor 1.5 μL Purified PCR product (DNA containing sgRNA target site sequence) 500 ng Make up the volume to 25 μL

[0026] Incubate the prepared system in a water bath at 37°C for 1.5 h.

[0027] Furthermore, in the step 3), in the CRISPR / Cas9 vector system, the final concentration of Pparγ-gRNA is 200 ng / μl, and the final concentration of zCas9mRNA is 500 ng / μl.

[0028] Furthermore, in the step 4), the primers for quantitatively analyzing and verifying the Pparγ gene target sites are respectively:

[0029] Pparγ-E2-F: TGTTCTGGCCTGTAGATGGG, as shown in SEQ ID NO:7,

[0030] Pparγ-E2-R: TTCTCCACGCTCGACTACAG, as shown in SEQ ID NO:8;

[0031] Pparγ-E3-F: TGAACGCCGTAATGAAACCC, as shown in SEQ ID NO:9,

[0032] Pparγ-E3-R: TCGTCTTTCCGTTTGCTGTG, as shown in SEQ ID NO:10;

[0033] Pparγ-E4-F: TTCTTGTGTATGCGGCAGTG, as shown in SEQ ID NO:11,

[0034] Pparγ-E4-R: GTGTGTGTGTGTTCAGCCTT, as shown in SEQ ID NO:12.

[0035] Furthermore, the fish is grass carp.

[0036] Principle of the present invention:

[0037] Pparγ (peroxisome proliferator-activated receptor γ) is a key gene regulating adipocyte differentiation and fat deposition. By using gene editing technology to knockout the Pparγ gene, construct mutants at the target gene locus, and preliminarily screen F0 generation mutants with certain phenotypic characteristics, new germplasm fish with low fat content can be cultivated.

[0038] Beneficial effects of the present invention:

[0039] In the present invention, the Pparγ gene of grass carp is directionally edited by gene editing technology. Under normal growth and development conditions, new germplasm grass carp with a low fat deposition rate is obtained. This grass carp with a low fat deposition rate can reproduce normally to expand the population, and the traits can be stably inherited, effectively solving the problems of excessive accumulation of body fat such as mesenteric fat accumulation and nutritional fatty liver in grass carp. The present invention not only has important scientific research value and can deeply analyze the function of the Pparγ gene in fish fat metabolism, but also has significant industrial application value, can promote the sustainable development of the aquaculture industry, and meet the market demand for fish products with low fat and high nutritional value. The new germplasm of low-fat grass carp cultivated by this method will provide a new technical approach and germplasm resources for fish nutrition improvement and healthy aquaculture. The method of the present invention provides technical support for improving fish nutrition by gene editing of grass carp, and also provides an important reference for precise design of other cultured fish. Brief description of the drawings

[0040] Figure 1 It is the agarose gel electrophoresis diagram of PCR amplification of the target site of grass carp Pparγ gene;

[0041] Figure 2 It is the sequence schematic diagram of the target site and mutation site of grass carp Pparγ gene;

[0042] Figure 3 It is the Nile red fluorescence staining of body fat (left figure) of wild-type grass carp and F0 generation mutant grass carp and the schematic diagram of the corresponding fluorescence quantitative results (right figure);

[0043] In the figure, PPARγ+ / + represents wild-type grass carp without knockout, and PPAR- / - is the knockout F0 generation mutant grass carp;

[0044] Figure 4 It is the schematic diagram of the whole body fat content of wild-type grass carp and F0 generation mutant grass carp;

[0045] In the figure, PPARγ+ / + represents wild-type grass carp without knockout, and PPAR- / - is the F0 generation mutant grass carp with knockout. Specific implementation methods

[0046] The present invention will be further described in detail below in conjunction with specific embodiments for those skilled in the art to understand.

[0047] Example 1

[0048] A method for constructing a new germplasm 1 of fish with low fat deposition rate based on Pparγ gene knockout, comprising the following steps:

[0049] 1. Synthesize the sgRNA target site sequence of the Pparγ gene:

[0050] Download the DNA sequence of the grass carp Pparγ gene on NCBI (https: / / www.ncbi.nlm.nih.gov / gene / ), then design the target site at the exon using the CRISPR / Cas9 online tool (https: / / www.crisprscan.org), and synthesize the sgRNA target site sequence using the following primers. The specific primers are as follows:

[0051] Pparγ-E2sgRNA:

[0052] CCTCTAATACGACTCACTATAGGGGTTGGGTCGTTCTGTG TGTTTTAGAGCTAGA

[0053] PCR amplification reaction system for synthesizing sgRNA template:

[0054] Max buffer 12.5 μL 2.5 mM dNTP Mix 0.5 μL target (i.e., Pparγ-E2 sgRNA 10 μm) 5 μL scaffold (10 μm) 5 μL Phusion DNA Polymerase 0.5 μL Make up the volume to 25 μL

[0055] PCR steps: Pre-denature at 98°C for 30 s; denature at 98°C for 10 s, anneal at 60°C for 10 s, extend at 72°C for 15 s, for 45 cycles; finally extend at 72°C for 5 min.

[0056] Take 3 μL of the synthesized PCR product and perform 2.5% agarose gel electrophoresis to detect a single target band; obtain the sgRNA target site sequence, which is specifically as follows:

[0057] Pparγ-E2: GGGGTTGGGTCGTTCTGTGT;

[0058] 2. In vitro transcription of Pparγ-gRNA:

[0059] In vitro transcription reaction system of Pparγ-gRNA:

[0060] transription buffer 5 μL 10 mM NTPS 2.5 μL T7 RNA Polymerase 1 μL RNA inhibitor 1.5 μL Purified PCR product (DNA containing Pparγ-E2) 500 ng Make up the volume to 25 μL

[0061] Incubate the configured system in a water bath at 37 °C for 1.5 h. Take 3 μL of the PCR product obtained by transcription and perform 2.5% agarose gel electrophoresis to detect a single target band.

[0062] Purify the PCR product using ZYMO's RNA kit (product number: R1013) according to the operating instructions, and use a NanoDrop 2000 instrument (Thermo Scientific) of a micro-spectrophotometer to detect the concentration of the purified product. Make a good record and store it at -80 °C for the next embryo injection experiment.

[0063] 3Pparγ-gRNA microinjection:

[0064] Collect the eggs and sperm of mature grass carp parents, and complete microinjection within 40 min after in vitro artificial insemination. Prepare an injection system by mixing Pparγ-gRNA and zCas9 mRNA. Among them, the final concentration of Pparγ-gRNA is 200 ng / μl, and the final concentration of zCas9 mRNA is 500 ng / μl. At the same time, add phenol red with a final concentration of 0.2% as an indicator; use a Picoliter Microinjector (Warner, PL-100A, USA) to inject the experimental sample into the fertilized eggs of grass carp at the I-cell stage that are laid flat in a culture dish. Every 5 μl of the mixed reagent can inject 1000 - 2000 fertilized eggs. After injection, place the fertilized eggs in aerated water with a water temperature of 23 - 28 °C for incubation.

[0065] Example 2

[0066] A method for constructing a new germplasm 2 of fish with a low fat deposition rate based on Pparγ gene knockout, comprising the following steps:

[0067] 1. Synthesize the sgRNA target site sequence of the Pparγ gene:

[0068] Download the DNA sequence of the grass carp Pparγ gene on NCBI (https: / / www.ncbi.nlm.nih.gov / gene / ), and then use the CRISPR / Cas9 online tool (https: / / www.crisprscan.org) to design corresponding target sites at the exon, and use the following primers to synthesize the sgRNA target site sequence respectively. The specific primers are as follows:

[0069] Pparγ-E3sgRNA:

[0070] CCTCTAATACGACTCACTATAGGAGGATGAAGACGGATCT TCGTTTTAGAGCTAGA

[0071] PCR amplification reaction system for synthesizing sgRNA template:

[0072] Max buffer 12.5 μL 2.5 mM dNTP Mix 0.5 μL target (i.e., Pparγ-E3 sgRNA) 5 μL scaffold (10 μm) 5 μL Phusion DNA Polymerase 0.5 μL Make up the volume to 25 μL

[0073] PCR steps: Pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 15 s, 45 cycles; the last step is extension at 72°C for 5 min.

[0074] Take 3 μL of the synthesized PCR product and perform 2.5% agarose gel electrophoresis to detect a single target band; obtain the sgRNA target site sequence, which is as follows:

[0075] Pparγ-E3: GGAGGATGAAGACGGATCTT;

[0076] 2. In vitro transcription of Pparγ-gRNA:

[0077] In vitro transcription reaction system of Pparγ-gRNA:

[0078] transription buffer 5 μL 10 mM NTPS 2.5 μL T7 RNA Polymerase 1 μL RNA inhibitor 1.5 μL Purified PCR product (DNA containing Pparγ-E3) 500 ng Make up the volume to 25 μL

[0079] Incubate the prepared system in a water bath at 37°C for 1.5 h. Take 3 μL of the transcribed PCR product and perform 2.5% agarose gel electrophoresis to detect a single target band;

[0080] Purify the PCR product using ZYMO's RNA kit (product number: R1013) according to the operating instructions, and detect the concentration of the purified product using a NanoDrop 2000 instrument (Thermo Scientific). Make a record and store it at -80°C for the next embryo injection experiment.

[0081] 3 Microinjection of Pparγ-gRNA:

[0082] Collect the eggs and sperm of mature grass carp parents, and perform microinjection within 40 minutes after in vitro artificial insemination. Prepare an injection system by mixing Pparγ-gRNA and zCas9 mRNA. Among them, the final concentration of Pparγ-gRNA is 200 ng / μl, the final concentration of zCas9 mRNA is 500 ng / μl, and phenol red with a final concentration of 0.2% is added as an indicator at the same time; use a Picoliter Microinjector (Warner, PL-100A, USA) to inject the experimental sample into the fertilized eggs of grass carp that are in the I-cell stage and spread out in a culture dish. Every 5 μl of the mixed reagent can inject 1000 - 2000 fertilized eggs. After the injection is completed, place the fertilized eggs in aerated water with a water temperature of 23 - 28 °C for incubation.

[0083] Example 3

[0084] A method for constructing a new germplasm 3 of fish with a low fat deposition rate based on Pparγ gene knockout, comprising the following steps:

[0085] 1. Synthesize the sgRNA target site sequence of the Pparγ gene:

[0086] Download the DNA sequence of the grass carp Pparγ gene on NCBI (https: / / www.ncbi.nlm.nih.gov / gene / ), then use the CRISPR / Cas9 online tool (https: / / www.crisprscan.org) to design corresponding target sites at the exons, and synthesize the sgRNA target site sequence using the following primers. The specific primers are as follows:

[0087] parγ-E4sgRNA:

[0088] CCTCTAATACGACTCACTATAGGCTTCAGGCGAATCGTCC TGGTTTTAGAGCTAGA

[0089] PCR amplification reaction system for synthesizing the sgRNA template:

[0090] Max buffer 12.5 μL 2.5 mM dNTP Mix 0.5 μL target (i.e., parγ-E4 sgRNA 10 μm) 5 μL scaffold (10 μm) 5 μL Phusion DNA Polymerase 0.5 μL Make up the volume to 25 μL

[0091] PCR steps: Pre-denature at 98 °C for 30 s; denature at 98 °C for 10 s, anneal at 60 °C for 10 s, extend at 72 °C for 15 s, for 45 cycles; finally extend at 72 °C for 5 min.

[0092] Take 3 μL of the synthesized PCR product, perform 2.5% agarose gel electrophoresis to detect a single target band; obtain the sgRNA target site sequence, which is specifically as follows:

[0093] Pparγ-E4: GGCTTCAGGCGAATCGTCCT;

[0094] 2. In vitro transcription of Pparγ-gRNA:

[0095] In vitro transcription reaction system of Pparγ-gRNA:

[0096] transription buffer 5 μL 10 mM NTPS 2.5 μL T7 RNA Polymerase 1 μL RNA inhibitor 1.5 μL Purified PCR product (DNA containing Pparγ-E4) 500 ng Make up the volume to 25 μL

[0097] Incubate the prepared system in a water bath at 37 °C for 1.5 h. Take 3 μL of the PCR product obtained by transcription and perform 2.5% agarose gel electrophoresis to detect a single target band;

[0098] Purify the PCR product using the RNA kit from ZYMO (product number: R1013) according to the operating instructions, and detect the concentration of the purified product using a NanoDrop 2000 micro-spectrophotometer (Thermo Scientific). Make a record and store it at -80 °C for the next embryo injection experiment.

[0099] 3 Microinjection of Pparγ-gRNA:

[0100] Collect the eggs and sperm of mature grass carp parents, and complete microinjection within 40 min after in vitro artificial insemination. Prepare an injection system by mixing Pparγ-gRNA and zCas9 mRNA. Among them, the final concentration of Pparγ-gRNA is 200 ng / μl, the final concentration of zCas9 mRNA is 500 ng / μl, and at the same time, add phenol red with a final concentration of 0.2% as an indicator;

[0101] Use a Picoliter Microinjector (Warner, PL-100A, USA) to inject the experimental sample into the fertilized eggs of grass carp at the I-cell stage and laid flat in a culture dish. Every 5 μl of the mixed reagent can inject 1000 - 2000 fertilized eggs. After injection, place the fertilized eggs in aerated water with a water temperature of 23 - 28 °C for incubation.

[0102] Verify the target site knockout of the grass carp individuals obtained in Examples 1 - 3 respectively:

[0103] 1 Quantitative analysis verification

[0104] Extract the genomic DNA of the surviving grass carp individuals, and use the target site detection primers to amplify the gene sequences near the target site for PCR verification:

[0105] Pparγ-E2-F: TGTTCTGGCCTGTAGATGGG,

[0106] Pparγ-E2-R: TTCTCCACGCTCGACTACAG;

[0107] Pparγ-E3-F: TGAACGCCGTAATGAAACCC,

[0108] Pparγ-E3-R: TCGTCTTTCCGTTTGCTGTG;

[0109] Pparγ-E4-F: TTCTTGTGTATGCGGCAGTG,

[0110] Pparγ-E4-R: GTGTGTGTGTGTTCAGCCTT;

[0111] Among them, the PCR reaction system is as follows:

[0112] PCR Master Mix (Yeasen, Shanghai) 10 μL Forward primer 0.5 μL Reverse primer 0.5 μL Genomic DNA template 2 μL Sterile water 7 μL Total volume 20 μL

[0113] The PCR reaction conditions are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 30 s, for 35 cycles; and further extension at 72°C for 5 min.

[0114] After the amplification is completed, take 3 μL of the PCR product for 2.5% agarose gel electrophoresis, extract the DNA and perform PCR amplification on the three knockout targets. It is found that there are double bands at two targets (E2, E4) (such as Figure 1 ).

[0115] Subsequently, expand the reaction system, ligate the PCR amplification product to the pCE2 TA / Bront Zero vector, and then transform it into competent Escherichia coli DH5α cells. Further expand the culture of a single colony, perform further PCR amplification on the bacterial solution, and then analyze it by Sanger sequencing for further verification. Detect whether the band corresponding to the target gene is a double band. Send the PCR product corresponding to the individual with double bands to Tsingke Biotechnology Co., Ltd. for sequencing to obtain a sequencing chromatogram. Use the Snap Gene Viewer software to read the DNA sequence and compare it with the read wild-type DNA sequence. If there are double peaks near the target (such as Figure 2 ), it proves that the grass carp individuals obtained by the method of Example 1 are false positives, and the Pparγ gene is successfully knocked out by the method of Example 3. The Pparγ deletion mutant obtained by this method is the grass carp F0 generation mutant.

[0116] Analysis of the knockout effect of the grass carp F0 generation mutant obtained in the above Example 3:

[0117] (1) Nile red fluorescence staining:

[0118] In Example 3, the change in the fat deposition rate of the F0 generation mutant grass carp was observed. The fat content of the adult fish after knockout was measured, and neutral lipid staining of the grass carp was observed using Nile red dye. The Nile red dye was dissolved in acetone to prepare a stock solution with a concentration of 1 mg / mL and stored at -20 °C. When using Nile red staining, it was diluted to a working concentration of 1 μg / mL with system water, and the grass carp was soaked in the dark for 10 - 12 h. After staining, the grass carp was rinsed once with system water, anesthetized with MS-222, and then fluorescence images were collected using the excitation light with a wavelength of 488 nm of an Olympus SZX16FL stereomicroscope.

[0119] It was observed that the accumulation of visceral adipose tissue (VAT) in the F0 generation mutant grass carp was significantly reduced compared to that of the wild-type grass carp ( Figure 3 ).

[0120] (2) Body fat quantification

[0121] The total lipid content (percentage of dry weight) of the F0 generation mutant grass carp was measured using the chloroform-methanol method. The specific steps are as follows:

[0122] a) The F0 generation mutant fish was frozen at -80 °C for 24 h, then freeze-dried in a vacuum freeze dryer for 24 h. After that, the dry weight was weighed and it was cut into pieces and put into a 5 mL glass tube;

[0123] b) 5 mL of chloroform / methanol (2:1, vol / vol) extraction solution was added to the glass tube, and extraction was carried out at room temperature for ≥2 h. The extraction solution was centrifuged at 500 g / min for 5 min, and then the supernatant was transferred to a new pre-weighed glass tube. Again, 2 mL of chloroform / methanol extraction solution was added to the precipitate, vortexed and centrifuged, and the supernatant was aspirated into the aforementioned weighed glass tube;

[0124] c) 0.4% calcium chloride was added to the supernatant glass tube, vortexed and mixed evenly, and the upper aqueous phase was aspirated and discarded;

[0125] d) Finally, the lower organic phase was dried to a constant weight at 75 °C, and the total lipid content percentage of the whole fish was calculated by dividing the total fat weight by the dry weight.

[0126] Using the above chloroform-methanol method to measure the whole body fat content of wild-type grass carp and F0 mutant grass carp, it was found that compared with wild-type grass carp, the total body fat content of F0 mutant grass carp was significantly reduced by 36.75% ( Figure 4 ).

[0127] Other parts not described in detail are all prior arts. Although the above embodiments have described the present invention in detail, they are only some embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for constructing a new fish germplasm with low fat deposition rate based on Pparγ gene knockout, characterized in that: The following steps are involved: 1) Synthesis of sgRNA target site sequence: Analysis of fish Pparγ gene sequence: Clone the Pparγ gene sequence from the target fish genome, perform bioinformatics analysis, determine the Pparγ gene sgRNA target site, and synthesize the sgRNA target site sequence; 2) Pparγ-gRNA in vitro transcription: Pparγ-gRNA was obtained by in vitro transcription using the sgRNA target site sequence; 3) Pparγ-gRNA in vitro microinjection: Collect eggs and sperm from mature fish parents, and perform gene editing in fish fertilized eggs after in vitro artificial insemination by microinjecting the CRISPR / Cas9 vector system containing Pparγ-gRNA; incubate after injection; wherein the CRISPR / Cas9 vector system is a mixture of Pparγ-gRNA and zCas9mRNA; 4) Knockout effect analysis: The knockout effect of the Pparγ gene target site was verified using whole-body body fat quantitative analysis, and the Pparγ deletion mutant was screened out, which is a new fish germplasm with a low fat deposition rate effect.

2. The method according to claim 1, characterized in that: In step 1), the sgRNA target site sequence is any one of the following three sequences: Pparγ-E2:GGGGTTGGGTCGTTCTGTGT, Pparγ-E3:GGAGGATGAAGACGGATCTT, Pparγ-E4: GGCTTCAGGCGAATCGTCCT.

3. The method according to claim 2, characterized in that: In the step 1), the sgRNA target site sequence Pparγ-E4: GGCTTCAGGCGAATCGTCCT.

4. The method according to claim 2, characterized in that: In the step 1), when the sgRNA target site sequence is Pparγ-E2, the sgRNA sequence primer Pparγ-E2sgRNA is synthesized: CCTCTAATACGACTCACTATAGGGGTTGGGTCGTTCTGTGTGTTTTAGAGCTAGA; When the sgRNA target site sequence is Pparγ-E3, synthesize the sgRNA sequence primer Pparγ-E3sgRNA: CCTCTAATACGACTCACTATAGGAGGATGAAGACGGATCTTCGTTTTAGAGCTAGA; When the sgRNA target site sequence is Pparγ-E4, synthesize the sgRNA sequence primer Pparγ-E4sgRNA: CCTCTAATACGACTCACTATAGGCTTCAGGCGAATCGTCCTGGTTTTAGAGCTAGA.

5. The method according to claim 1, characterized in that: In step 1), the PCR amplification reaction system for synthesizing the sgRNA sequence is: Max buffer 12.5μL, 2.5mM dNTP Mix 0.5μL, target 5μL, scaffold 5μL, PhusionDNA Polymerase 0.5μL, add water to 25μL; PCR steps: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 15 s, 45 cycles; the last step was extension at 72°C for 5 min.

6. The method according to claim 1, characterized in that: In step 3), the sgRNA in vitro transcription reaction system: Transription buffer 5μL, 10mM NTPS 2.5μL, T7 RNA Polymerase 1μL, RNA inhibitor 1.5μL, purified PCR product 500ng, add water to 25μL; The prepared system was placed in a water bath at 37°C for 1.5 h.

7. The method according to claim 1, characterized in that: In the step 3), in the CRISPR / Cas9 vector system, the final concentration of Pparγ-gRNA is 200 ng / μL, and the final concentration of zCas9mRNA is 500 ng / μL.

8. The method according to claim 1, characterized in that: In step 4), the primers for quantitative analysis and verification of the Pparγ gene target site are: Pparγ-E2-F:TGTTCTGGCCTGTAGATGGG, Pparγ-E2-R: TTCTCCAGCTCGACTACAG; Pparγ-E3-F:TGAACGCCGTAATGAAACCC, Pparγ-E3-R:TCGTCTTTCCGTTTGCTGTG; Pparγ-E4-F:TTCTTGTGTATGCGGCAGTG, Pparγ-E4-R:GTGTGTGTGTGTTCAGCCTT.

9. The method according to claim 1, characterized in that: The fish is grass carp.

Images