Real-time fluorescence PCR detection kit and detection method for H10N7 avian influenza virus

Abstract

This application relates to the field of virus detection technology, specifically disclosing a real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus. The kit includes sample lysis extract, sample washing solution I, sample washing solution II, and reaction premix for detecting H10N7 subtype avian influenza virus; the detection method is an integrated detection method. This application achieves simultaneous detection of H10 and N7 subtype AIVs by designing specific primers and probes. The kit prepared using these primers and probes not only improves detection efficiency but also significantly enhances sensitivity and specificity. The combined use of MAOPA technology and real-time quantitative PCR technology further improves the accuracy of the detection results, making this kit of this application of significant application value in avian influenza prevention and control.

Description

Technical Field

[0001] This application relates to the field of virus detection technology, and more specifically, it relates to a real-time fluorescent PCR detection kit and detection method for H10N7 avian influenza virus. Background Technology

[0002] Avian influenza (avian influenza) is an acute infectious disease caused by type A influenza viruses, affecting both humans and birds. Avian influenza viruses can be classified into highly pathogenic and low pathogenic avian influenza viruses based on their pathogenicity. Highly pathogenic avian influenza spreads rapidly, causes severe illness, and has a high mortality rate. Influenza viruses are classified into 15 H subtypes (H1–H15) and 9 N subtypes (N1–N9) based on the antigenicity of their hemagglutinin (H) and neuraminidase (N). Among them, the H10 and N7 subtypes of AIV are low pathogenic avian influenza viruses; although their pathogenicity is low, they pose a potential risk of cross-species transmission. Epidemiological surveys show that mixed infections of different AIV subtypes have frequently occurred in recent years. Traditional detection techniques for mixed infections of AIV include quantitative RT-PCR and multiplex PCR; however, due to the easy degradation of viral RNA, the accuracy and sensitivity of detection results are often low, seriously hindering the prevention and control of avian influenza outbreaks.

[0003] Magnetic bead-mediated integrated polymerase amplification (MAOPA) technology integrates nucleic acid extraction and amplification, enabling magnetic beads to be used throughout the entire nucleic acid detection process. This overcomes the shortcomings of traditional methods where nucleic acids are gradually lost during extraction, elution, and amplification. It features a fully closed process, high sensitivity, strong stability, intelligent result output, and remote monitoring visualization. Combining MAOPA technology with real-time quantitative PCR technology to develop a microfluidic fluorescent PCR detection kit for avian influenza virus based on MAOPA technology can provide a more efficient detection method for AIV prevention and control. Based on the above, this application proposes a real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus. Summary of the Invention

[0004] To address the problem of low accuracy and sensitivity of viral RNA during extraction in traditional detection techniques, this application provides a real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus.

[0005] Firstly, this application provides an integrated detection method for a real-time fluorescent PCR detection kit for H10N7 avian influenza virus, specifically including the following steps:

[0006] S1. Store the sample lysis extract in the first compartment of the integrated test kit; store sample washing solution I in the second compartment of the integrated test kit; store sample washing solution II in the third compartment of the integrated test kit; and store the reaction premix in the fourth compartment of the integrated test kit.

[0007] S2. Add 600 μL of the sample to be tested and 10 μL of magnetic beads to the integrated detection reagent card, seal the card, and proceed with the following reaction step by step within the integrated detection reagent card:

[0008] (1) The sample to be tested was lysed, and magnetic beads were used to adsorb the RNA of H10 subtype avian influenza virus, N7 subtype avian influenza virus, and the RNA of internal control gene;

[0009] (2) The magnetic beads adsorb H10 subtype avian influenza virus RNA, N7 subtype avian influenza virus RNA and internal standard gene RNA for directional movement, and wash away impurities, proteins and other non-nucleic acid samples on the magnetic beads;

[0010] (3) The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and under the action of reverse transcriptase, the RNA is reverse transcribed into the corresponding cDNA, and then a real-time PCR reaction is performed.

[0011] (4) Analyze the fluorescence curve to determine whether the sample to be tested is infected with H10N7 subtype avian influenza virus.

[0012] Secondly, this application provides a real-time fluorescent PCR detection kit for H10N7 avian influenza virus, comprising sample lysis extract, sample washing solution I, sample washing solution II, and reaction premix for detecting H10N7 subtype avian influenza virus.

[0013] Preferably, in step S1, the sample lysis extraction solution has a volume of 1200 μL and includes the following components: protein denaturant, NP-40, Triton-X10, KCl, ethanol, EDTA, and phosphate buffer.

[0014] Preferably, in step S1, the sample lysis extraction solution comprises the following components: 2M protein denaturant, 3% NP-40, 2% Triton-X10, 0.8M KCl, 30% ethanol, 0.5mM EDTA, and 12mM phosphate buffer; the protein denaturant is composed of guanidine hydrochloride, sodium dodecyl sulfate, and dimethyl sulfoxide mixed in a mass ratio of 1:1:0.1-0.5.

[0015] Preferably, in step S1, the volume of sample washing solution I is 150 μL, comprising the following components: guanidine isothiocyanate, phosphate buffer, EDTA, KCl, NP-40 and ethanol.

[0016] Preferably, in step S1, the sample washing solution I comprises the following components: 1M guanidine isothiocyanate, 12mM phosphate buffer, 1mM EDTA, 0.5M KCl, 2% NP-40 and 50% ethanol.

[0017] Preferably, in step S1, the volume of sample washing solution II is 150 μL, comprising the following components: 70% ethanol and 3% Tween 20.

[0018] Preferably, in step S1, the reaction premix volume is 40 μL, comprising H10-specific primer and probe combination, N7-specific primer and probe combination, internal standard gene-specific primer and probe combination, RNA-direct real-time PCR master mix, and Mn. 2+ .

[0019] Preferably, the H10-specific primer combination and probe comprises a forward F primer, a reverse R primer, and a probe, with the following nucleotide sequences:

[0020] H10-F: CAAGTGAATGGTCAAAGTGGG (SEQ ID NO. 1);

[0021] H10-R: GCCAAGTCCTCTCCCTTTTAG (SEQ ID NO.2);

[0022] H10-probe: TGGATTAATAGCACCCAGCAGAGTGAG (SEQ ID NO.3);

[0023] The fluorescent reporter group of the H10-probe is FAM, and the fluorescent quencher group of the H10-probe is BHQ1.

[0024] Preferably, the N7-specific primer combination and probe comprises a forward F primer, a reverse R primer, and a probe, with the following nucleotide sequences:

[0025] N7-F: GTTGGATGGTCAAGCACAAC (SEQ ID NO.4);

[0026] N7-R: CTGTAGCGTTGTCATTGTTTCC (SEQ ID NO.5);

[0027] N7-probe: CTTGCCATGATGGTATCGGTAGGATGAC (SEQ ID NO.6);

[0028] The fluorescent reporter group of the N7-probe is VIC, and the fluorescent quencher group of the N7-probe is BHQ2.

[0029] Preferably, the internal standard gene-specific primer combination and probe includes a forward F primer, a reverse R primer, and a probe, with the following nucleotide sequences:

[0030] 18S-F: TCAACACGGGAAACCTCAC (SEQ ID NO. 7);

[0031] 18S-R: CCCACGGAATCGAGAAAGAG (SEQ ID NO. 8);

[0032] 18S-probe: CGGACACGGACAGGATTGACAGAT (SEQ ID NO.9);

[0033] The fluorescent reporter group of the 18S-probe is ROX, and the fluorescent quencher group of the 18S-probe is BHQ2.

[0034] Preferably, the reaction premix comprises H10-F 0.5 μM, H10-R 0.5 μM, H10-probe 0.3 μM, N7-F 0.5 μM, N7-R 0.5 μM, N7-probe 0.3 μM, 18S-F 0.5 μM, 18S-R 0.5 μM, 18S-probe 0.3 μM, 1×RNA-direct realtime PCR master mix, and 1.5 mM Mn 2+ .

[0035] In summary, this application has the following beneficial effects:

[0036] 1. The real-time fluorescent PCR detection kit for H10N7 avian influenza virus in this application is used in combination with MAOPA integrated detection technology, which integrates nucleic acid extraction and nucleic acid amplification into one. On the basis of simplifying the operation steps, it greatly reduces the degradation of viral RNA during the extraction process, realizes a fully enclosed, pollution-free, integrated reaction, reduces the impact of human operation errors, and effectively improves detection efficiency and accuracy.

[0037] 2. This application optimizes and screens the design of optimal specific primers and probes. The real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus prepared with the optimal specific primers and probes have high sensitivity, with a detection sensitivity of 10 copies / mL for both H10 subtype AIV and N7 subtype AIV. It also has high specificity, producing amplification curves with obvious peaks only for H10 subtype AIV and N7 subtype AIV, while other subtype AIV and common avian pathogens do not produce amplification.

[0038] 3. The real-time fluorescent PCR detection kit and detection method for H10N7 avian influenza virus of this application have coefficients of variation of less than 5% within and between groups, indicating good reproducibility. Attached Figure Description

[0039] Figure 1 The results show the specific detection results of the real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus in Example 2. (1: H10 subtype AIV; 2: N7 subtype AIV; 3-10: other subtypes of AIV and common avian pathogens; 11-20: internal control genes).

[0040] Figure 2 The results show the sensitivity of the real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus in Example 3. (1-5: 1×10⁻⁶) 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 H10 subtype AIV pseudovirus standard at 6 copies / mL; 6-10: 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 N7 subtype AIV pseudovirus standard at copies / mL; 11-15: 1×10 3 (Copies / mL of internal standard gene pseudovirus standard).

[0041] Figure 3 The results show the sensitivity detection of H10 and N7 subtype avian influenza viruses using conventional RT-qPCR reagents in Example 3. (Figure A: 1-5 are 1×10⁻⁵) 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 H10 subtype AIV pseudovirus standard at copies / mL; Figure B: 6-10 is 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 (N7 subtype AIV pseudovirus standard, copies / mL). Detailed Implementation

[0042] The present application will be further described in detail below with reference to the embodiments.

[0043] Example 1

[0044] 1. Design of pathogen primers and probes

[0045] Published HA gene sequences for H10 subtype avian influenza and NA gene sequences for N7 subtype avian influenza were searched in GenBank. Conserved regions were identified through multiple sequence alignment, and multiple primer and probe pairs were designed. After analysis and comparison, the primers and probes with the best detection performance were selected, as shown in Table 1. The optimal primers were amplified and ligated into the pET-32a-MS2 plasmid. Finally, H10 subtype AIV positive pseudovirus standards and N7 subtype AIV positive pseudovirus standards were prepared.

[0046] Table 1

[0047]

[0048] 2. Design of internal standard primers and probes

[0049] 18S rRNA is a conserved sequence widely found in many species, making it an ideal internal standard. Multiple sequence alignment analysis was performed on the full-length 18S rRNA sequences of humans, chickens, gorillas, cattle, deer, horses, gibbons, ducks, mice, camels, sheep, guinea pigs, macaques, rabbits, pigs, and whales published in GenBank. A conserved region was selected for primer and probe design, and an optimal combination was determined, as shown in Table 2. The optimal primers were amplified and ligated into the pET-32a-MS2 plasmid to prepare a positive pseudovirus standard for the internal standard gene.

[0050] Table 2

[0051]

[0052] 3. Instructions for using the test reagent card

[0053] Open the test reagent card cap, then open the sealing film. Add 10 μL of magnetic beads, 20 μL of internal standard gene pseudovirus standard, and 600 μL of the sample to be tested in that order. Mix well with a pipette and then tighten the cap.

[0054] 4. Reaction system and reaction conditions

[0055] The optimal reaction mixture is as follows: H10-F 0.5 μM, H10-R 0.5 μM, H10-probe 0.3 μM, N7-F 0.5 μM, N7-R 0.5 μM, N7-probe 0.3 μM, 18S-F 0.5 μM, 18S-R 0.5 μM, 18S-probe 0.3 μM, 1×RNA-directrealtime PCR master mix, and 1.5 mM Mn 2+ .

[0056] The optimal reaction conditions were: 95℃ for 30s, 60℃ for 20min (reverse transcription), 95℃ for 10s; 95℃ for 15s, 60℃ for 30s, for 40 cycles.

[0057] 5. Result Determination

[0058] After the detection procedure is completed, the instrument will automatically report the detection results of H10 subtype AIV (FAM), N7 subtype AIV (VIC), and internal standard gene (ROX).

[0059] If the H10 subtype AIV (FAM) and N7 subtype AIV (VIC) results show a clear S-shaped amplification curve (including an S-curve with a clear exponential phase but not yet reaching the plateau phase), and Ct ≤ 38, then the corresponding results are considered positive. The ROX fluorescence channel detection result for the internal control gene should also show a clear S-shaped amplification curve (including an S-curve with a clear exponential phase but not yet reaching the plateau phase). If both fluorescence channels (FAM and VIC) are negative and the internal control gene (ROX) Ct ≤ 38, the experimental results are valid. Otherwise, resampling and retesting are required.

[0060] Example 2

[0061] Specific detection of H10N7 avian influenza virus using real-time fluorescent PCR detection kit and method.

[0062] Using H10 subtype AIV pseudovirus standards, N7 subtype AIV pseudovirus standards, other AIV subtypes (H5N1 subtype AIV, H9N2 subtype AIV), and common avian pathogens (Newcastle disease virus, novel goose plague virus, goose parvovirus, duck parvovirus, duck astrovirus, and chicken infectious laryngotracheitis virus) (corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) as templates, and adding internal standard gene pseudovirus standards (internal standard genes 11-20 correspond to the positive pathogen nucleic acids of 1-10, respectively) to each reagent card as internal quality control, the fluorescence quantitative PCR amplification reaction was performed according to the detection method described in Example 1.

[0063] The results are as follows Figure 1As shown, the amplification curves of the H10 subtype AIV pseudovirus standard, the N7 subtype AIV pseudovirus standard, and the internal standard gene pseudovirus standard all showed obvious peaks; while the amplification curves of other subtype AIV and common avian pathogen nucleic acids did not produce obvious peaks. This indicates that the kit and detection method of this application do not produce non-specific amplification curves and have high specificity.

[0064] Example 3

[0065] A comparison of the sensitivity of a real-time fluorescent PCR detection kit and method for H10N7 avian influenza virus with that of conventional RT-qPCR reagents.

[0066] H10 subtype AIV pseudovirus standard diluted 10-fold (concentration 1×10⁻⁶) 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 The N7 subtype AIV pseudovirus standard (concentration 1×10⁻⁵ copies / mL, corresponding to 1-5 respectively) was serially diluted 10-fold. 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 5 copies / mL, corresponding to 6-10 and a concentration of 1×10⁻⁶ respectively. 3 Using a pseudovirus standard of 11-15 copies / mL as a template, the detection was performed by real-time PCR according to the detection method described in Example 1.

[0067] The results of the reagent kit and detection method in this application are as follows: Figure 2 As shown, the detection sensitivity for both H10 subtype AIV pseudovirus standards and N7 subtype AIV pseudovirus standards is 10 copies / mL; the detection results of conventional RT-qPCR reagents are as follows. Figure 3 As shown, the detection sensitivity for both H3 and N2 subtype AIV pseudovirus standards is 1×10⁻⁶. 3 The copy / mL indicates that the kit and detection method of this application can detect trace amounts of virus, have high sensitivity, and can promptly control the development of the epidemic in its early stages.

[0068] Example 4

[0069] Repeatability testing of real-time fluorescent PCR detection kit and detection method for H10N7 avian influenza virus.

[0070] Take a concentration of 1×10 3copies / mL, 1×10 4 copies / mL and 1×10 5 Intra-batch repeatability experiments were conducted using H10 subtype AIV and N7 subtype AIV pseudovirus standards at concentrations of [copy / mL]. Three replicates were performed for each sample. Quantitative real-time PCR was performed according to the detection method described in Example 1. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated, and the results are shown in Table 3.

[0071] Table 3

[0072]

[0073] Take a concentration of 1×10 3 copies / mL, 1×10 4 copies / mL and 1×10 5 Inter-batch repeatability experiments were conducted using H10 subtype AIV and N7 subtype AIV pseudovirus standards at / mL, with three replicates for each sample. Quantitative real-time PCR detection was performed according to the method described in Example 2, and two additional replicate experiments were conducted at different time points. The mean Ct value, standard deviation, and coefficient of variation of the reaction results were calculated, and the results are shown in Table 4.

[0074] Table 4

[0075]

[0076] According to Tables 3 and 4, the coefficient of variation within groups ranges from 0.49% to 2.02%, and the coefficient of variation between groups ranges from 0.81% to 2.96%. Both the coefficients of variation within and between groups are less than 5%, indicating good repeatability within and between groups.

[0077] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A real-time fluorescent PCR detection kit for H10N7 avian influenza virus, characterized in that, It contains sample lysis extract for detecting H10N7 avian influenza virus, sample washing solution I, sample washing solution II, and reaction premix; The reaction premix includes H10-specific primer and probe, N7-specific primer and probe, internal standard gene-specific primer and probe, RNA-direct real-time PCR master mix, and Mn. 2+ ; The H10-specific primer and probe combination consists of one forward F primer, one reverse R primer, and one probe, with the following nucleotide sequences: H10-F: CAAGTGAATGGTCAAAGTGGG (SEQ ID NO. 1); H10-R: GCCAAGTCCTCTCCCTTTTAG (SEQ ID NO.2); H10-probe: TGGATTAATAGCACCCAGCAGAGTGAG (SEQ ID NO.3); The fluorescent reporter group of the H10-probe is FAM, and the fluorescent quencher group of the H10-probe is BHQ1; The N7-specific primer and probe combination consists of one forward F primer, one reverse R primer, and one probe, with the following nucleotide sequences: N7-F: GTTGGATGGTCAAGCACAAC (SEQ ID NO.4); N7-R: CTGTAGCGTTGTCATTGTTTCC (SEQ ID NO.5); N7-probe: CTTGCCATGATGGTATCGGTAGGATGAC (SEQ ID NO.6); The fluorescent reporter group of the N7-probe is VIC, and the fluorescent quencher group of the N7-probe is BHQ2; The sample washing solution I comprises the following components: guanidine isothiocyanate, phosphate buffer, EDTA, KCl, NP-40, and ethanol; The sample washing solution II comprises the following components: ethanol and Tween 20.

2. The real-time fluorescent PCR detection kit for H10N7 avian influenza virus according to claim 1, characterized in that, The sample lysis extract comprises the following components: protein denaturant, NP-40, Triton-X10, KCl, ethanol, EDTA, and phosphate buffer.

3. The real-time fluorescent PCR detection kit for H10N7 avian influenza virus according to claim 2, characterized in that, The protein denaturant is composed of guanidine hydrochloride, sodium dodecyl sulfate, and dimethyl sulfoxide in a mass ratio of 1:1:0.1-0.

5.

4. The real-time fluorescent PCR detection kit for H10N7 avian influenza virus according to claim 1, characterized in that, The internal standard gene-specific primer combination and probe include one forward F primer, one reverse R primer, and one probe, with the following nucleotide sequences: 18S-F: TCAACACGGGAAACCTCAC (SEQ ID NO. 7); 18S-R: CCCACGGAATCGAGAAAGAG (SEQ ID NO. 8); 18S-probe: CGGACACGGACAGGATTGACAGAT (SEQ ID NO.9); The fluorescent reporter group of the 18S-probe is ROX, and the fluorescent quencher group of the 18S-probe is BHQ2.

Images