Materials and methods for engineering low immunogenicity
By genetically modifying specific genes of human cells to reduce their expression, low immunogenic cells are produced, which solves the problems of immune response and cell stability in cell therapy, and improves the safety and effectiveness of cell therapy.
Patent Information
- Application Number
- CN202380076610.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-08
- Filing Date
- 2023-08-30
- Publication Date
- 2025-06-24
AI Technical Summary
Cell therapy methods face challenges such as chemical and molecular interference of immune cells, intercellular interference, nutritional competition, cell depletion, apoptosis and manufacturing methodology, resulting in lack of approval.
The expression of these genes encoded proteins is reduced by genetically modifying human cells' regulatory factor X (RFX) gene, class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene and CD58 gene, thereby producing low immunogenic cells.
The generated low immunogenic cells have reduced immunogenicity and immune response in allogeneic or non-MHC-matched subjects, reduce the cytotoxicity of allogeneic T cells, and improve the safety and effectiveness of cell therapy.
Smart Images

Figure CN120202016A_ABST
Abstract
Description
[0001] 1. Cross - Reference to Related Applications
[0002] This application claims the benefit of each of U.S. Patent Serial No. 63 / 403,608, filed on September 2, 2023; U.S. Patent Serial No. 63 / 403,612, filed on September 2, 2023; U.S. Patent Serial No. 63 / 403,617, filed on September 2, 2023; U.S. Patent Serial No. 63 / 431,410, filed on December 9, 2022; and U.S. Patent Serial No. 63 / 450,714, filed on March 8, 2023. The entire disclosure of each of the above - mentioned patents is incorporated herein by reference in its entirety.
[0003] 2. Sequence Listing
[0004] This application contains a sequence listing that has been electronically submitted in XML file format and is hereby incorporated by reference in its entirety. The XML copy, created on August 29, 2023, is named 253505_000360_SL.xml and is 352,320 bytes in size. 3. Technical Field
[0005] Specifically provided herein are low - immunogenicity methods, such as bioengineering methodologies and materials, including low - immunogenicity (such as engineered low - immunogenicity) methodologies and materials that can be used, for example, for genetic modification and / or otherwise altering at least one target gene or gene product, methods for producing low - immunogenicity cells (such as engineered low - immunogenicity cells), the manufacture of low - immunogenicity cell compositions (such as engineered low - immunogenicity cell compositions), low - immunogenicity cell systems (such as engineered low - immunogenicity cell systems), and their uses. 4. Background Art
[0006] Cell therapy methods are emerging and evolving, and some of these methods are dedicated to effectively targeting and neutralizing complex diseases in various forms and locations within the host body, such as different types of tumor formation, cancer, and tumors. See "Studies Test CAR T-Cell Therapies Designed to Overcome Key Limitations", National Cancer Institute, available online (www dot cancer dot gov / news-events / cancer-currents-blog / 2023 / car-t-cell-therapies-overcoming-limitations), February 8, 2023, by Sharon Reynolds. Challenges are also reported to stem from, for example, chemical and molecular interference of immune cells, cell-cell interference, nutrient competition, cell exhaustion, apoptosis, and manufacturing methodologies. Even so, the approvals of cell therapies remain scarce. See News&Analysis, 2022 FDA Approvals, Asher Mullard, Nature Reviews Drug Discovery, Volume 22, February 2023, pages 83-88. 5. Summary of the Invention
[0007] The present inventors specifically provide herein hypoimmunogenic methods, such as bioengineered materials and methodologies, including hypoimmunogenic (such as engineered hypoimmunogenic) materials and methodologies that can be used, for example, to genetically modify and / or otherwise alter at least one target gene or gene product, methods for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), the manufacture of hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell systems (such as engineered hypoimmunogenic cell systems), and their uses. In one aspect, provided herein are hypoimmunogenic (such as engineered hypoimmunogenic) methods, comprising: a) genetically modifying the regulatory factor X (RFX) gene of at least one immunogenic human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cell of a), to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell); c) placing the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) in an immune system; and d) determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered as compared to the immunogenic human cell in which the RFX gene has not been genetically modified, optionally wherein step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene of the immunogenic human cell.
[0008] In one aspect, provided herein are hypoimmunogenic (such as engineered hypoimmunogenic) methods, comprising: a) reprogramming an immunogenic human cell to produce an induced pluripotent stem (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor containing a gamma chain and a delta chain; b) genetically modifying the regulatory factor X (RFX) gene of the iPS human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS human cell; c) forming at least one embryoid body from the cell of step b), to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell); d) placing the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) in an immune system; and e) determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered as compared to the iPS human cell in which the RFX gene has not been genetically modified, optionally wherein step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene of the iPS human cell.
[0009] In one aspect, the present disclosure provides methods for low immunogenicity, such as engineered low immunogenicity, including: a) genetically modifying the regulatory factor X (RFX) gene of an immunogenic human cell to produce a low immunogenic cell (such as an engineered low immunogenic cell), wherein genetically modifying the RFX gene reduces the expression of the RFX protein in the immunogenic human cell; b) placing the low immunogenic cell (such as an engineered low immunogenic cell) in the immune system; and c) determining the immunogenicity of the low immunogenic cell (such as an engineered immunogenic low immunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the RFX gene has not been genetically modified, optionally wherein step a) further includes genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and the CD58 gene of the immunogenic human cell.
[0010] In one aspect, the present disclosure provides methods for producing low immunogenic cells (such as engineered low immunogenic cells) from immunogenic cells, including: (i) genetically modifying the regulatory factor X (RFX) gene in the immunogenic cell, wherein genetically modifying the RFX gene reduces the expression of the RFX protein in the cell, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and the CD58 gene in the immunogenic cell, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the immunogenic cell, wherein the method produces the low immunogenic cell (such as an engineered low immunogenic cell) having one or more of the following properties: a) reduced immunogenicity compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell (such as an engineered low immunogenic cell) is present in an allogeneic or non-MHC-matched subject; b) a reduced immune response compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell (such as an engineered low immunogenic cell) is present in an allogeneic or non-MHC-matched subject; and c) reduced cytotoxicity of alloreactive T cells compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell (such as an engineered low immunogenic cell) is present in an allogeneic or non-MHC-matched subject.
[0011] In one aspect, the present disclosure provides methods for generating hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells, comprising: a) reprogramming the immunogenic cells to generate induced pluripotent stem (iPS) cells; b) (i) genetically modifying the regulatory factor X (RFX) gene in the iPS cells generated in step (a), wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS cells, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and the CD58 gene in the iPS cells, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the iPS cells; and c) optionally, differentiating the cells generated in step (b); wherein the method generates the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) having one or more of the following properties: 1) when the hypoimmunogenic cells such as engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject, they have reduced immunogenicity compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c); 2) when the hypoimmunogenic cells such as the engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject, they elicit a reduced immune response compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c); 3) when the hypoimmunogenic cells such as the engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject, they elicit reduced cytotoxicity of alloreactive T cells compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c).
[0012] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise a T cell receptor (TCR) containing a gamma chain and a delta chain.
[0013] In some embodiments, the immunogenic cell or human immunogenic cell is an immune cell, optionally selected from T cells, natural killer (NK) cells, B cells, and hematopoietic stem cells (HSCs).
[0014] In some embodiments, the reduced immunogenicity of a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) includes one or more of the following: i) a reduced or ablated myeloid cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; ii) a reduced or ablated T cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; iii) a reduced or ablated natural killer (NK) cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; iv) a reduced or ablated neutralizing antibody response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; v) a reduced or ablated MHC class II-mediated response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; vi) a reduced or ablated neutralizing MHC class I-mediated response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but ungenetically modified cell; and vii) a reduced or ablated allogeneic host rejection of the graft when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic subject, as compared to a cell corresponding to a modified but ungenetically modified cell.
[0015] In some embodiments, the immunogenic cell is a human cell.
[0016] In some embodiments, in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell): i) the expression of HLA class II molecules is reduced or ablated; ii) the expression of HLA-A, HLA-B, and / or HLA-C is reduced; and iii) the expression of HLA-E is reduced but still detectable.
[0017] In some embodiments, the method includes forming at least one embryoid body or multicellular body from a genetically modified cell to produce a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0018] In some embodiments, the method further comprises determining the immunogenicity of low immunogenic cells, such as engineered low immunogenic cells.
[0019] In some embodiments, the method further comprises administering low immunogenic cells, such as engineered low immunogenic cells, to an allogeneic or non-MHC matched subject.
[0020] In some embodiments, the immunogenicity of low immunogenic cells, such as engineered low immunogenic cells, is altered as compared to immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, wherein the only difference between the low immunogenic cells, such as engineered low immunogenic cells, and the immunogenic cells or the immunogenic human cells or the iPS human cells or the iPS cells is that one or more genes among the RFX gene and optionally the CIITA gene, B2M gene, and CD58 gene in the immunogenic cells or the immunogenic human cells or the iPSC human cells or the iPS cells are not genetically modified.
[0021] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA matched or non-MHC matched to the cells, receptors, or polypeptides of the recipient subject's immune system.
[0022] In some embodiments, altering the immunogenicity comprises balancing, reducing, or neutralizing the immunogenicity, such as reducing or neutralizing the immunogenicity. In some embodiments, altering the immunogenicity comprises reducing or neutralizing the myeloid cell response for low immunogenic cells, such as engineered low immunogenic cells. In some embodiments, altering the immunogenicity comprises reducing or neutralizing the T cell response for low immunogenic cells, such as engineered low immunogenic cells. In some embodiments, altering the immunogenicity comprises reducing or neutralizing the natural killer cell response for low immunogenic cells, such as engineered low immunogenic cells. In some embodiments, altering the immunogenicity comprises reducing or neutralizing the antibody response for low immunogenic cells, such as engineered low immunogenic cells. In some embodiments, altering the immunogenicity comprises reducing or neutralizing the allogeneic host's rejection of the graft.
[0023] In some embodiments, altering the immunogenicity comprises causing one or more of the following in low immunogenic cells, such as engineered low immunogenic cells: a) reduced or ablated expression of HLA class II molecules; b) reduced expression of HLA-A, HLA-B, and / or HLA-C; and c) reduced but still detectable expression of HLA-E.
[0024] In some embodiments, altering immunogenicity includes reducing or ablating MHC class II-mediated responses for hypoimmunogenic cells such as engineered hypoimmunogenic cells. In some embodiments, altering immunogenicity includes reducing or neutralizing MHC class I-mediated responses for hypoimmunogenic cells such as engineered hypoimmunogenic cells.
[0025] In some embodiments, the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.
[0026] In some embodiments, the methods disclosed herein further include genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces the expression of the CD58 protein. In some embodiments, genetically modifying the CD58 gene reduces or ablates costimulatory immune cell responses and / or weakens the formation of the immunological synapse.
[0027] In some embodiments, the methods disclosed herein further include genetically modifying the B2M gene, wherein genetically modifying the B2M gene reduces or ablates the expression of HLA class I molecules on hypoimmunogenic cells such as engineered hypoimmunogenic cells, optionally the HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-E, and combinations thereof.
[0028] In some embodiments, the methods disclosed herein further include genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene reduces or ablates the expression of HLA class II molecules on hypoimmunogenic cells such as engineered hypoimmunogenic cells.
[0029] In some embodiments, genetically modifying the RFX gene includes: (i) modifying the DNA sequence of the RFX gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of RFX mRNA by an RNAi system, optionally the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or combinations thereof; or (iii) reducing or ablating the transcription of the RFX gene, optionally by recruiting or directing a transcriptional repressor to the RFX gene.
[0030] In some embodiments, genetic modification of the CIITA gene and / or the B2M gene and / or the CD58 gene comprises: (i) modifying the DNA sequence of the CIITA gene and / or the B2M gene and / or the CD58 gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of the CIITA gene and / or the B2M gene and / or the CD58 gene by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or a combination thereof; or (iii) reducing or ablating the transcription of the CIITA gene and / or the B2M gene and / or the CD58 gene, optionally by recruiting or directing a transcriptional repressor to the CIITA gene and / or the B2M gene and / or the CD58 gene.
[0031] In some embodiments, the method further comprises genetically modifying at least one gene selected from the group consisting of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.
[0032] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells produced by the methods disclosed herein.
[0033] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells that comprise a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces the expression of RFX protein, and the hypoimmunogenic human cells are generated from embryoid bodies; optionally the hypoimmunogenic human cells further comprise one or more genes selected from the group consisting of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified β-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.
[0034] In one aspect, provided herein is a composition that comprises the hypoimmunogenic human cells disclosed herein.
[0035] In one aspect, provided herein are gamma-delta T cell-derived induced pluripotent stem (iPS) human cells that comprise a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces the expression of RFX protein; optionally the iPS human cells further comprise one or more genes selected from the group consisting of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified β-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.
[0036] In one aspect, provided herein is a composition that comprises the iPS human cells disclosed herein.
[0037] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of genetically modifying the function of the regulatory factor X (RFX) gene of at least one immunogenic cell, such as an immunogenic human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic cell, such as an immunogenic human cell; b) performing the step of forming at least one embryoid body or multicellular body from the cell of a), to produce at least one low immunogenic cell, such as an engineered low immunogenic cell; c) performing the step of placing the low immunogenic cell, such as an engineered low immunogenic cell, in the immune system; and d) performing the step of determining the immunogenicity of the low immunogenic cell, such as an engineered low immunogenic cell, wherein the immunogenicity is altered as compared to an immunogenic cell, such as an immunogenic human cell, in which the RFX gene has not been genetically modified, optionally wherein step a) further comprises performing the step of genetically modifying the function of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and / or CD58 gene of the immunogenic human cell.
[0038] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of reprogramming an immunogenic human cell to produce an induced pluripotent stem (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) performing the step of genetically modifying the function of the regulatory factor X (RFX) gene of the iPS human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS human cell; c) performing the step of forming at least one embryoid body from the cell of step b), to produce at least one low immunogenic cell, such as an engineered low immunogenic cell; d) performing the step of placing the low immunogenic cell, such as an engineered low immunogenic cell, in the immune system; and e) performing the step of determining the immunogenicity of the low immunogenic cell, such as an engineered low immunogenic cell, wherein the immunogenicity is altered as compared to the iPS human cell in which the RFX gene has not been genetically modified, optionally wherein step b) further comprises performing the step of genetically modifying the function of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and / or CD58 gene of the iPS human cell.
[0039] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing a step of genetically modifying the regulatory factor X (RFX) gene of an immunogenic human cell to produce a function of a low immunogenicity cell (such as an engineered low immunogenicity cell), wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic human cell; b) performing a step of placing the low immunogenicity cell (such as an engineered low immunogenicity cell) in the immune system; and c) performing a step of determining the immunogenicity of the low immunogenicity cell (such as an engineered low immunogenicity cell), wherein the immunogenicity is altered as compared to the immunogenic human cell in which the RFX gene is not genetically modified, optionally wherein step a) further comprises performing a step of genetically modifying the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and / or the CD58 gene of the immunogenic human cell.
[0040] In one aspect, the present disclosure provides non-naturally occurring low immunogenic human cells (such as engineered low immunogenicity cells) that comprise a construct that reduces RFX protein expression by a genetically modified RFX gene, and / or a construct that alters the immunogenicity of the low immunogenic human cell (such as an engineered low immunogenicity cell) by the immune system as compared to the immunogenic human cell in which the RFX gene is not genetically modified; optionally wherein the low immunogenic human cell (such as an engineered low immunogenicity cell) further comprises a construct that reduces CIITA protein, B2M protein, and / or CD58 protein expression by a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified CD58 gene.
[0041] In one aspect, the present disclosure provides gamma-delta T cell-derived induced pluripotent stem (iPS) human cells that comprise a construct that reduces RFX protein expression by a genetically modified RFX gene, and / or a construct that alters the immunogenicity of the iPS human cell by the immune system as compared to the iPS human cell in which the RFX gene is not genetically modified; optionally wherein the iPS human cell further comprises a construct that reduces CIITA protein, B2M protein, and / or CD58 protein expression by a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified CD58 gene.
[0042] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) reprogramming immunogenic human cells to produce induced pluripotent (iPS) human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) genetically modifying the beta-2-microglobulin (B2M) gene of the iPS human cells, wherein genetically modifying the B2M gene reduces the expression of the B2M protein by the iPS human cells; c) forming at least one embryoid body or multicellular body from the cells of step b) to produce at least one low immunogenic cell (such as an engineered low immunogenic cell); d) placing the low immunogenic cell (such as an engineered low immunogenic cell) in an immune system; and e) determining the immunogenicity of the low immunogenic cell (such as an engineered low immunogenic cell), wherein the immunogenicity is altered as compared to iPS human cells in which the B2M gene has not been genetically modified, optionally wherein step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and CD58 gene of the iPS human cells.
[0043] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) genetically modifying the beta-2-microglobulin (B2M) gene of at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces the expression of the B2M protein by the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one low immunogenic cell (such as an engineered low immunogenic cell); c) placing the low immunogenic cell (such as an engineered low immunogenic cell) in an immune system; and d) determining the immunogenicity of the low immunogenic cell (such as an engineered low immunogenic cell), wherein the immunogenicity is altered as compared to immunogenic human cells in which the B2M gene has not been genetically modified, optionally wherein step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and CD58 gene of the immunogenic human cell.
[0044] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) genetically modifying the β-2-microglobulin (B2M) gene of an immunogenic human cell to produce a low immunogenic cell, such as an engineered low immunogenic cell, wherein genetically modifying the B2M gene reduces the expression of B2M protein by the immunogenic human cell; b) placing the low immunogenic cell, such as the engineered low immunogenic cell, in an immune system; and c) determining the immunogenicity of the low immunogenic cell, such as the engineered low immunogenic cell, wherein the immunogenicity is altered as compared to an immunogenic human cell in which the B2M gene has not been genetically modified, optionally wherein step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and CD58 gene of the immunogenic human cell.
[0045] In one aspect, the present disclosure provides methods of producing low immunogenic cells, such as engineered low immunogenic cells, from immunogenic cells, comprising: (i) genetically modifying the β-2-microglobulin (B2M) gene in the immunogenic cell, wherein genetically modifying the B2M gene reduces the expression of B2M protein in the cell, and (ii) optionally further genetically modifying one or more genes selected from the group consisting of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and CD58 gene in the immunogenic cell, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the immunogenic cell, wherein the method produces the low immunogenic cell, such as the engineered low immunogenic cell, having one or more of the following properties: a) reduced immunogenicity as compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell, such as the engineered low immunogenic cell, is present in an allogeneic or non-MHC-matched subject; b) reduced immune response as compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell, such as the engineered low immunogenic cell, is present in an allogeneic or non-MHC-matched subject; and c) reduced cytotoxicity of alloreactive T cells as compared to the corresponding immunogenic cell not genetically modified by (i) and (ii) when the low immunogenic cell, such as the engineered low immunogenic cell, is present in an allogeneic or non-MHC-matched subject.
[0046] In one aspect, provided herein are methods for generating hypoimmunogenic cells, such as engineered hypoimmunogenic cells, from immunogenic cells, comprising: a) reprogramming the immunogenic cells to generate induced pluripotent stem (iPS) cells; b) (i) genetically modifying the β-2-microglobulin (B2M) gene in the iPS cells, wherein genetically modifying the B2M gene reduces the expression of B2M protein in the iPS cells, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and CD58 gene in the iPS cells, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the iPS cells; and c) optionally, differentiating the cells generated in step (b); wherein the method generates the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, having one or more of the following properties: 1) reduced immunogenicity compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject; 2) reduced immune response compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject; and 3) reduced cytotoxicity of alloreactive T cells compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject.
[0047] In some embodiments, the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, comprise a T cell receptor (TCR) comprising a gamma chain and a delta chain.
[0048] In some embodiments, the immunogenic cell or human immunogenic cell is an immune cell, optionally selected from T cells, natural killer (NK) cells, B cells, and hematopoietic stem cells (HSCs).
[0049] In some embodiments, the reduced immunogenicity of a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) includes one or more of the following: i) a reduced or ablated myeloid cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; ii) a reduced or ablated T cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; iii) a reduced or ablated natural killer (NK) cell response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; iv) a reduced or ablated neutralizing antibody response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; v) a reduced or ablated MHC class II-mediated response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; vi) a reduced or ablated neutralizing MHC class I-mediated response when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject, compared to a cell corresponding to a modified but ungenetically modified cell; and vii) a reduced or ablated allogeneic host rejection of the graft when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic subject, compared to a cell corresponding to a modified but ungenetically modified cell.
[0050] In some embodiments, the immunogenic cell is a human cell.
[0051] In some embodiments, in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell): i) the expression of HLA class II molecules is reduced or ablated; ii) the expression of HLA-A, HLA-B, and / or HLA-C is reduced; and iii) the expression of HLA-E is reduced but still detectable.
[0052] In some embodiments, the method includes forming at least one embryoid body or multicellular body from a genetically modified cell to produce a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0053] In some embodiments, the method further comprises determining the immunogenicity of low immunogenic cells, such as engineered low immunogenic cells.
[0054] In some embodiments, the method further comprises administering low immunogenic cells, such as engineered low immunogenic cells, to an allogeneic or non-MHC matched subject.
[0055] In some embodiments, the immunogenicity of low immunogenic cells, such as engineered low immunogenic cells, is altered as compared to immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, wherein the only difference between the low immunogenic cells, such as engineered low immunogenic cells, and the immunogenic cells or the immunogenic human cells or the iPS human cells or the iPS cells is that the CD58 gene and optionally one or more genes of the RFX gene, the CIITA gene, and the B2M gene in the immunogenic cells or the immunogenic human cells or the iPS human cells or the iPS cells are not genetically modified.
[0056] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA matched or non-MHC matched to cells, receptors, or polypeptides of the immune system of the recipient subject.
[0057] In some embodiments, altering the immunogenicity comprises balancing, reducing, or neutralizing the immunogenicity, such as reducing or neutralizing the immunogenicity.
[0058] In some embodiments, altering the immunogenicity comprises reducing or neutralizing the myeloid cell response for low immunogenic cells, such as engineered low immunogenic cells.
[0059] In some embodiments, altering the immunogenicity comprises reducing or neutralizing the T cell response for low immunogenic cells, such as engineered low immunogenic cells.
[0060] In some embodiments, altering the immunogenicity comprises reducing or neutralizing the natural killer cell response for low immunogenic cells, such as engineered low immunogenic cells.
[0061] In some embodiments, altering the immunogenicity comprises reducing or neutralizing the antibody response for low immunogenic cells, such as engineered low immunogenic cells.
[0062] In some embodiments, altering the immunogenicity comprises reducing or neutralizing the rejection of the graft by the allogeneic host.
[0063] In some embodiments, altering the immunogenicity comprises reducing or ablating the expression of HLA class I molecules on low immunogenic cells, such as engineered low immunogenic cells.
[0064] In some embodiments, the methods disclosed herein further comprise genetically modifying an RFX gene, wherein the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.
[0065] In some embodiments, genetically modifying an RFX gene results in one or more of the following in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell): a) reduced or ablated expression of HLA class II molecules; and / or b) reduced expression of HLA-A, HLA-B, and / or HLA-C.
[0066] In some embodiments, genetically modifying an RFX gene reduces or ablates MHC class II-mediated responses in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0067] In some embodiments, genetically modifying an RFX gene reduces or neutralizes MHC class I-mediated responses in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0068] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene reduces or ablates the expression of HLA class II molecules on a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0069] In some embodiments, the methods disclosed herein further comprise genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces the expression of CD58.
[0070] In some embodiments, genetically modifying the CD58 gene reduces or ablates co-stimulatory immune cell responses and / or weakens the formation of immunological synapses.
[0071] In some embodiments, genetically modifying the B2M gene comprises: (i) modifying the DNA sequence of the B2M gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of B2M mRNA by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, or miR-adapted shRNA; or (iii) reducing or ablating the transcription of the B2M gene, optionally by recruiting or directing a transcriptional repressor to the B2M gene.
[0072] In some embodiments, genetic modification of the CIITA gene and / or the RFX gene and / or the CD58 gene comprises: (i) modifying the DNA sequence of the CIITA gene and / or the RFX gene and / or the CD58 gene, optionally by a CRISPR-Cas system; (ii) inhibiting transcription or translation of the CIITA gene and / or the RFX gene and / or the CD58 gene by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or a combination thereof; or (iii) reducing or ablating transcription of the CIITA gene and / or the RFX gene and / or the CD58 gene, optionally by recruiting or directing a transcriptional repressor to the CIITA gene and / or the RFX gene and / or the CD58 gene.
[0073] In some embodiments, the methods disclosed herein further comprise genetically modifying at least one gene selected from the group consisting of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.
[0074] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods disclosed herein.
[0075] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) that comprises a genetically modified B2M gene, wherein the genetically modified B2M gene reduces the expression of B2M protein, and the hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) is generated from embryoid bodies; optionally, the hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) further comprises one or more genes selected from the group consisting of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.
[0076] In one aspect, provided herein is a composition comprising the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) disclosed herein.
[0077] In one aspect, provided herein are γδ T cell-derived induced pluripotent stem (iPS) human cells that comprise a genetically modified B2M gene, wherein the genetically modified B2M gene reduces the expression of B2M protein; optionally, the iPS human cells further comprise one or more genes selected from the group consisting of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.
[0078] In one aspect, provided herein is a composition that comprises the iPS human cells disclosed herein.
[0079] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of genetically modifying the function of the B2M gene of at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces the expression of B2M protein in the immunogenic human cell; b) performing the step of forming at least one embryoid body or multicellular body from the cells of a) to produce at least one low immunogenicity cell, such as an engineered low immunogenicity human cell; c) performing the step of placing the low immunogenicity cell, such as an engineered low immunogenicity human cell, in the immune system; and d) performing the step of determining the immunogenicity of the low immunogenicity cell, such as an engineered low immunogenicity cell, wherein the immunogenicity is altered compared to an immunogenic human cell in which the B2M gene has not been genetically modified, optionally wherein step a) further comprises performing the step of genetically modifying the function of the RFX gene, CIITA gene, and / or CD58 gene of the immunogenic human cell.
[0080] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of reprogramming an immunogenic human cell to produce an induced pluripotent stem (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) performing the step of genetically modifying the function of the B2M gene of the iPS human cell, wherein genetically modifying the B2M gene reduces the expression of B2M protein in the iPS human cell; c) performing the step of forming at least one embryoid body from the cells of step b) to produce at least one low immunogenicity cell, such as an engineered low immunogenicity cell; d) performing the step of placing the low immunogenicity cell, such as an engineered low immunogenicity cell, in the immune system; and e) performing the step of determining the immunogenicity of the low immunogenicity cell, such as an engineered low immunogenicity cell, wherein the immunogenicity is altered compared to an iPS human cell in which the B2M gene has not been genetically modified, optionally wherein b) further comprises performing the step of genetically modifying the function of the RFX gene, CIITA gene, and / or CD58 gene of the iPS human cell.
[0081] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the function of genetically modifying the B2M gene of an immunogenic human cell to produce a low immunogenic cell (such as an engineered low immunogenic cell), wherein genetically modifying the B2M gene reduces the expression of B2M protein by the immunogenic human cell; b) performing the function of placing the low immunogenic cell (such as an engineered low immunogenic cell) in the immune system; and c) performing the function of determining the immunogenicity of the low immunogenic cell (such as an engineered low immunogenic cell), wherein the immunogenicity is altered as compared to an immunogenic human cell in which the B2M gene has not been genetically modified, optionally wherein step a) further comprises performing the function of genetically modifying the RFX gene, the CIITA gene, and / or the CD58 gene of the immunogenic human cell.
[0082] In one aspect, the present disclosure provides non-naturally occurring low immunogenic human cells (such as engineered low immunogenic human cells) that comprise a construct that reduces B2M protein expression by a genetically modified B2M gene, and / or a construct that alters the immunogenicity of the low immunogenic human cell (such as an engineered low immunogenic human cell) by the immune system as compared to an immunogenic human cell in which the B2M gene has not been genetically modified; optionally wherein the low immunogenic human cell (such as an engineered low immunogenic human cell) further comprises a construct that reduces RFX protein, CD58 protein, and / or CIITA protein expression by a genetically modified RFX gene, a genetically modified CD58 gene, and / or a genetically modified CIITA gene.
[0083] In one aspect, the present disclosure provides gamma-delta T cell-derived induced pluripotent stem (iPS) human cells that comprise a construct that reduces B2M protein expression by a genetically modified B2M gene, and / or a construct that alters the immunogenicity of the iPS human cell by the immune system as compared to an iPS human cell in which the B2M gene has not been genetically modified; optionally wherein the iPS human cell further comprises a construct that reduces RFX protein, CD58 protein, and / or CIITA protein expression by a genetically modified RFX gene, a genetically modified CD58 gene, and / or a genetically modified CIITA gene.
[0084] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) genetically modifying the CD58 gene of at least one immunogenic human cell, wherein genetically modifying the CD58 gene reduces the expression of CD58 protein by the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one low immunogenic cell (such as an engineered low immunogenic cell); c) placing the low immunogenic cell (such as an engineered low immunogenic cell) in an immune system; and d) determining the immunogenicity of the low immunogenic cell (such as an engineered low immunogenic cell), wherein the immunogenicity is altered as compared to an immunogenic human cell in which the CD58 gene has not been genetically modified, optionally wherein step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and beta-2-microglobulin (B2M) gene of the immunogenic human cell.
[0085] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) reprogramming an immunogenic human cell to produce an induced pluripotent (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) genetically modifying the CD58 gene of the iPS human cell, wherein genetically modifying the CD58 gene reduces the expression of CD58 protein by the iPS human cell; c) forming at least one embryoid body from the cells of step b) to produce at least one low immunogenic cell (such as an engineered low immunogenic cell); d) placing the low immunogenic cell (such as an engineered low immunogenic cell) in an immune system; and e) determining the immunogenicity of the low immunogenic cell (such as an engineered low immunogenic cell), wherein the immunogenicity is altered as compared to an iPS human cell in which the CD58 gene has not been genetically modified, optionally wherein step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and beta-2-microglobulin (B2M) gene of the iPS human cell.
[0086] In one aspect, the present disclosure provides methods for low immunogenicity, such as engineered low immunogenicity, including: a) genetically modifying the CD58 gene of immunogenic human cells to produce low immunogenicity cells (such as engineered low immunogenicity cells), wherein genetically modifying the CD58 gene reduces the expression of the CD58 protein in the immunogenic human cells; b) placing the low immunogenicity cells (such as engineered low immunogenicity cells) in the immune system; and c) determining the immunogenicity of the low immunogenicity cells (such as engineered low immunogenicity cells), wherein the immunogenicity is altered compared to the immunogenic human cells in which the CD58 gene has not been genetically modified, optionally wherein step a) further includes genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and beta-2-microglobulin (B2M) gene of the immunogenic human cells.
[0087] In one aspect, the present disclosure provides methods for producing low immunogenicity cells (such as engineered low immunogenicity cells) from immunogenic cells, including: (i) genetically modifying the CD58 gene in the immunogenic cells, wherein genetically modifying the CD58 gene reduces the expression of the CD58 protein in the cells, and (ii) optionally further genetically modifying one or more genes selected from the group consisting of the class II major histocompatibility complex transactivator (CIITA) gene, regulator of factor X (RFX) gene, and beta-2-microglobulin (B2M) gene in the immunogenic cells, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the immunogenic cells, wherein the method produces the low immunogenicity cells (such as engineered low immunogenicity cells) having one or more of the following properties: a) when the low immunogenicity cells (such as engineered low immunogenicity cells) are present in an allogeneic or non-MHC-matched subject, the immunogenicity is reduced compared to the corresponding immunogenic cells not genetically modified by (i) and (ii); b) when the low immunogenicity cells (such as engineered low immunogenicity cells) are present in an allogeneic or non-MHC-matched subject, a reduced immune response is elicited compared to the corresponding immunogenic cells not genetically modified by (i) and (ii); and c) when the low immunogenicity cells (such as engineered low immunogenicity cells) are present in an allogeneic or non-MHC-matched subject, the cytotoxicity of alloreactive T cells is reduced compared to the corresponding immunogenic cells not genetically modified by (i) and (ii).
[0088] In one aspect, the present disclosure provides methods for generating hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells, comprising: a) reprogramming the immunogenic cells to generate induced pluripotent stem (iPS) cells; b) (i) genetically modifying the CD58 gene in the iPS cells, wherein the genetic modification of the CD58 gene reduces the expression of CD58 protein in the iPS cells, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and beta-2-microglobulin (B2M) gene in the iPS cells, wherein the genetic modification of the gene reduces the expression of the corresponding protein in the iPS cells; and c) optionally, differentiating the cells generated in step (b); wherein the method generates the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that have one or more of the following characteristics: 1) reduced immunogenicity compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells such as engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject; 2) reduced immune response compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells such as the engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject; and 3) reduced cytotoxicity of alloreactive T cells compared to the corresponding iPS cells not genetically modified in step (b) or the cells corresponding to the cells generated in step (c) when the hypoimmunogenic cells such as engineered hypoimmunogenic cells are present in an allogeneic or non-MHC-matched subject.
[0089] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise a T cell receptor (TCR) containing a gamma chain and a delta chain.
[0090] In some embodiments, the immunogenic cell or human immunogenic cell is an immune cell, optionally selected from T cells, natural killer (NK) cells, B cells, and hematopoietic stem cells (HSCs).
[0091] In some embodiments, the reduced immunogenicity of a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) includes one or more of the following: i) a reduced or ablated myeloid cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; ii) a reduced or ablated T cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; iii) a reduced or ablated natural killer (NK) cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; iv) a reduced or ablated neutralizing antibody response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; v) a reduced or ablated MHC class II-mediated response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; vi) a reduced or ablated neutralizing MHC class I-mediated response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; and vii) a reduced or ablated allogeneic host rejection of the graft compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic subject.
[0092] In some embodiments, the immunogenic cell is a human cell.
[0093] In some embodiments, in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell): i) the expression of HLA class II molecules is reduced or ablated; ii) the expression of HLA-A, HLA-B, and / or HLA-C is reduced; and iii) the expression of HLA-E is reduced but still detectable.
[0094] In some embodiments, the method includes forming at least one embryoid body or multicellular body from the genetically modified cell to produce a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).
[0095] In some embodiments, the method further includes determining the immunogenicity of low immunogenicity cells, such as engineered low immunogenicity cells.
[0096] In some embodiments, the method further includes administering low immunogenicity cells, such as engineered low immunogenicity cells, to an allogeneic or non-MHC matched subject.
[0097] In some embodiments, the immunogenicity of low immunogenicity cells, such as engineered low immunogenicity cells, is altered compared to immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, wherein the only difference between the low immunogenicity cells, such as engineered low immunogenicity cells, and the immunogenic cells or the immunogenic human cells or the iPS human cells or the iPS cells is that one or more genes among the B2M gene and optionally the RFX gene, the CIITA gene, and the CD58 gene in the immunogenic cells or the immunogenic human cells or the iPS human cells or the iPS cells are not genetically modified.
[0098] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA matched or non-MHC matched to the cells, receptors, or polypeptides of the recipient subject's immune system.
[0099] In some embodiments, altering the immunogenicity includes balancing, reducing, or neutralizing the immunogenicity, such as reducing or neutralizing the immunogenicity.
[0100] In some embodiments, altering the immunogenicity includes reducing or neutralizing the myeloid cell response for low immunogenicity cells, such as engineered low immunogenicity cells.
[0101] In some embodiments, altering the immunogenicity includes reducing or neutralizing the T cell response for low immunogenicity cells, such as engineered low immunogenicity cells.
[0102] In some embodiments, altering the immunogenicity includes reducing or neutralizing the natural killer cell response for low immunogenicity cells, such as engineered low immunogenicity cells.
[0103] In some embodiments, altering the immunogenicity includes reducing or neutralizing the rejection of the graft by the allogeneic host.
[0104] In some embodiments, altering the immunogenicity includes reducing or ablating the co-stimulatory immune cell response and / or weakening the formation of the immunological synapse.
[0105] In some embodiments, the methods disclosed herein further comprise genetically modifying an RFX gene, wherein the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.
[0106] In some embodiments, genetically modifying the RFX gene causes one or more of the following in a low immunogenic cell (such as an engineered low immunogenic cell): a) reduced or ablated expression of HLA class II molecules; b) reduced expression of HLA-A, HLA-B, and / or HLA-C; and c) reduced but still detectable expression of HLA-E.
[0107] In some embodiments, genetically modifying the RFX gene reduces or ablates MHC class II-mediated responses in a low immunogenic cell (such as an engineered low immunogenic cell). In some embodiments, genetically modifying the RFX gene reduces or neutralizes MHC class I-mediated responses in a low immunogenic cell (such as an engineered low immunogenic cell).
[0108] In some embodiments, the methods disclosed herein further comprise genetically modifying the B2M gene, wherein genetically modifying the B2M gene reduces or ablates the expression of HLA class I molecules.
[0109] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene reduces or ablates the expression of HLA class II molecules.
[0110] In some embodiments, genetically modifying the CD58 gene comprises: (i) modifying the DNA sequence of the CD58 gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of CD58 mRNA by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, or miR-adapted shRNA; or (iii) reducing or ablating the transcription of the CD58 gene, optionally by recruiting or directing a transcriptional repressor to the CD58 gene.
[0111] In some embodiments, genetic modification of the CIITA gene and / or the B2M gene and / or the RFX gene comprises: (i) modifying the DNA sequence of the CIITA gene and / or the B2M gene and / or the RFX gene, optionally by means of a CRISPR-Cas system; (ii) inhibiting transcription or translation of the CIITA gene and / or the B2M gene and / or the RFX gene by means of an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or a combination thereof; or (iii) reducing or ablating transcription of the CIITA gene and / or the B2M gene and / or the RFX gene, optionally by recruiting or directing a transcriptional repressor to the CIITA gene and / or the B2M gene and / or the RFX gene.
[0112] In some embodiments, the methods disclosed herein further comprise genetically modifying at least one gene selected from the group consisting of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.
[0113] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods disclosed herein.
[0114] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) that comprises a genetically modified CD58 gene, wherein the genetically modified CD58 gene reduces the expression of CD58 protein, and the hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) is generated from embryoid bodies; optionally, the hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell) further comprises one or more genes selected from the group consisting of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified B2M gene.
[0115] In one aspect, provided herein is a composition comprising the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) disclosed herein.
[0116] In one aspect, provided herein are γδ T cell-derived induced pluripotent stem (iPS) human cells that comprise a genetically modified CD58 gene, wherein the genetically modified CD58 gene reduces the expression of CD58 protein; optionally, the iPS human cells further comprise one or more genes selected from the group consisting of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified B2M gene.
[0117] In one aspect, provided herein is a composition that comprises the iPS human cells disclosed herein.
[0118] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of genetically modifying the function of the CD58 gene of at least one immunogenic human cell, wherein genetically modifying the CD58 gene reduces the expression of CD58 protein in the immunogenic human cell; b) performing the step of forming at least one embryoid body or multicellular body from the cell of a) to produce at least one low immunogenic cell, such as an engineered low immunogenic cell; c) performing the step of placing the low immunogenic cell, such as an engineered low immunogenic cell, in the immune system; and d) performing the step of determining the immunogenicity of the low immunogenic cell, such as an engineered low immunogenic cell, wherein the immunogenicity is altered as compared to the immunogenic human cell in which the CD58 gene is not genetically modified, optionally wherein step a) further comprises performing the step of genetically modifying the function of the RFX gene, CIITA gene, and / or B2M gene of the immunogenic human cell.
[0119] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, comprising: a) performing the step of reprogramming an immunogenic human cell to produce an induced pluripotent stem (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) performing the step of genetically modifying the function of the CD58 gene of the iPS human cell, wherein genetically modifying the CD58 gene reduces the expression of CD58 protein in the iPS human cell; c) performing the step of forming at least one embryoid body from the cell of step b) to produce at least one low immunogenic cell, such as an engineered low immunogenic cell; d) performing the step of placing the low immunogenic cell, such as an engineered low immunogenic cell, in the immune system; and e) performing the step of determining the immunogenicity of the low immunogenic cell, such as an engineered low immunogenic cell, wherein the immunogenicity is altered as compared to the iPS human cell in which the B2M gene is not genetically modified, optionally wherein b) further comprises performing the step of genetically modifying the function of the RFX gene, CIITA gene, and / or B2M gene of the iPS human cell.
[0120] In one aspect, the present disclosure provides methods of low immunogenicity, such as engineered low immunogenicity, including: a) performing a step of genetically modifying the CD58 gene of an immunogenic human cell to produce a function of a low immunogenicity cell (such as an engineered low immunogenicity cell), wherein genetically modifying the CD58 gene reduces the expression of the CD58 protein by the immunogenic human cell; b) performing a step of placing the low immunogenicity cell (such as an engineered low immunogenicity cell) in the immune system; and c) performing a step of determining the immunogenicity of the low immunogenicity cell (such as an engineered low immunogenicity cell), wherein the immunogenicity is altered as compared to the immunogenic human cell in which the CD58 gene is not genetically modified, optionally wherein step a) further includes performing a step of genetically modifying the RFX gene, the CIITA gene, and / or the B2M gene of the immunogenic human cell.
[0121] In one aspect, the present disclosure provides non-naturally occurring low immunogenicity human cells (such as engineered low immunogenicity human cells) that include a construct that reduces CD58 protein expression by a genetically modified CD58 gene, and / or a construct that alters the immunogenicity of the low immunogenicity human cell (such as an engineered low immunogenicity human cell) by the immune system as compared to an immunogenic human cell in which the CD58 gene is not genetically modified; optionally wherein the low immunogenicity human cell (such as an engineered low immunogenicity human cell) further includes a construct that reduces the expression of CIITA protein, B2M protein, and / or RFX protein by a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified RFX gene.
[0122] In one aspect, the present disclosure provides γδT cell-derived induced pluripotent stem (iPS) human cells that include a construct that reduces CD58 protein expression by a genetically modified CD58 gene, and / or a construct that alters the immunogenicity of the iPS human cell by the immune system as compared to an iPS human cell in which the CD58 gene is not genetically modified; optionally wherein the iPS human cell further includes a construct that reduces the expression of CIITA protein, B2M protein, and / or RFX protein by a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified RFX gene. 6. BRIEF DESCRIPTION OF THE DRAWINGS
[0123] Figure 1 Shows gene knockout strategies for preventing HLA surface expression. The upper figure shows an overview of the process for generating HLA-altered T cells. The lower figure shows CD4 +Results of flow cytometry measurement of HLA class I and HLA class II expression in T cells from human donor D149399, which were edited by CRISPR / Cas9 to knockout the indicated genes. Knockout of B2M resulted in cells lacking HLA class I expression, while HLA class II expression was unchanged. Knockout of CIITA resulted in cells lacking HLA class II expression, while HLA class I expression was unchanged. Single knockout of RFX5, RFXANK, or RFXAP resulted in cells lacking HLA class II surface expression and having reduced but not abolished HLA class I expression. Combinatorial knockout of B2M and RFX5, B2M and RFXANK, B2M and RFXAP, or B2M and CIITA resulted in cells completely lacking HLA class I and II expression. Primary T cells were analyzed 14 - 15 days after CRISPR editing and CD3 / CD28 activation. With CD8 + T cells yielded similar results. The lower right panel shows HLA-E expression on unedited, B2M-deficient, and RFX5-deficient pan-T cells from human donor D149399. T cells edited with RFXANK and RFXAP yielded similar results for HLA-E expression.
[0124] Figure 2 Shown that RFX knockout T cells from additional human donors also downregulated HLA class I and class II molecules. The left and right panels show CD4 + T cells and CD8 + Results of flow cytometry measurement of HLA class I and HLA class II expression in T cells from human donor D149399, which were edited by CRISPR / Cas9 to knockout the indicated genes. The study shows results from two human donors (D151100, top row, and D144786, bottom row). NTC = unedited T cells.
[0125] Figure 3 Shown that RFX5 knockout T cells using CRISPR / Cas12a downregulated HLA class I and class II molecules. The experimental protocol is shown in Figure 1 the upper panel in. Shown are the results of flow cytometry measurement of HLA class I and HLA class II expression in D147297 pan-T cells (combination of CD4 + and CD8 + ) which were edited by CRISPR / Cas12a to knockout the indicated genes. NTC = unedited.
[0126] Figure 4 Shown the CD4 +Stability of reduced HLA surface expression in T cells. Fourteen days after generating HLA class I- and class II-altered T cells from two human donors (D151100 and D144786), the cells were cryopreserved, thawed, and then stimulated as indicated with IFN-γ or the CD3 / CD28 stimulation method (TransAct). Twenty-four hours later, the cells were analyzed for surface expression of pan-HLA class I (top) and class II (bottom) on CD4 + T cells. The upper left panel shows HLA class I expression on D151100-CD4 + T cells. The upper right panel shows HLA class I expression on D144786-CD4 + T cells. The lower left panel shows HLA class II expression on D151100-CD4 + T cells. The lower right panel shows HLA class II expression on D144786-CD4 + T cells.
[0127] Figure 5 Shows the stability of reduced HLA surface expression in CD8 + T cells. Fourteen days after generating HLA class I- and class II-altered T cells from two human donors (D151100 and D144786), the cells were cryopreserved, thawed, and then stimulated as indicated with IFN-γ or the CD3 / CD28 stimulation method (TransAct). Twenty-four hours later, the cells were analyzed for surface expression of pan-HLA class I (upper panel) and class II (lower panel) on CD8 + T cells. The upper left panel shows HLA class I expression on D151100-CD8 + T cells. The upper right panel shows HLA class I expression on D144786-CD8 + T cells. The lower left panel shows HLA class II expression on D151100-CD8 + T cells. The lower right panel shows HLA class II expression on D144786-CD8 + T cells.
[0128] Figure 6 Shows that HLA-altered T cells avoid allogeneic effector T cell responses. The upper panel shows the method steps for generating allogeneic effector T cells. The lower panel shows degranulation (CD107a + ) of allogeneic effector CD8 + T cells and CD4 高 T cells after 4-hour stimulation with pan-T cells with the indicated genetic modifications. The positive control is CD3 / CD28 stimulation.
[0129] Figure 7It is shown that RFX knockout T cells have a moderate protective effect against the attack of allogeneic T cells and NK cells. This study shows the survival of pan-T cells with the indicated genetic modifications after co-culture with allogeneic effector T cells (upper panel) or resting primary NK cells (lower panel). Compared with unedited (NTC) T cells, HLA-altered T cells (D151100) showed enhanced ability to survive when attacked by allogeneic effector T cells. Among HLA-altered T cells, RFX knockout T cells showed the strongest survival ability when attacked by primary NK cells.
[0130] Figure 8 It shows the expansion of allogeneic sensitized effector cells against human donor 147297 (donor 297). Figure 6 It shows the method steps for generating allogeneic effector T cells and presents the characterization of such cells generated from two human donors (500 and 996, upper panel) against the stimulating donor 297 (lower panel). These figures show the HLA class I and HLA class II surface characteristics of HLA-altered pan-T cells from human donor 297 used in subsequent co-culture assays.
[0131] Figure 9 It is shown that for all tested allogeneic effector cells, RFX5 knockout from human donor 297 survived better or equally well compared to B2M knockout. Figure 9 It shows the survival of pan-T cells with the indicated genetic modifications after co-culture with unpurified allogeneic effector cells (upper left and upper middle panels), purified allogeneic effector T cells (lower left panel), purified allogeneic effector NK cells (lower middle panel), or resting primary NK cells from two human donors (upper right and lower right panels). The viability of all co-culture samples was normalized against target cells without effector (dashed line = 1). Effectors: T-297-500R mixture = PBMC from donor 500, amplified for 2 weeks after priming with irradiated PBMC from donor 297 (containing 87% T cells, 10% NKT cells, <2% NK cells); T-297-996R mixture = PBMC from donor 996, amplified for 2 weeks after priming with irradiated PBMC from donor 297 (containing 72% T cells, 3% NKT cells, 22% NK cells), the T-297-996R mixture was separated into T-297-996R separated T cells (97% T cells and <2% NK cells and NKT cells) and separated NK cells (94% NK cells, 3% NKT cells, 3% T cells); EN021 and NK697 naïve NK cells = unsensitized NK cells isolated from PBMC of two random human donors.
[0132] Figure 10It is shown that RFX5 knockout limits allogeneic-induced T cell activation (CD3 + CD8 + and CD3 + CD4 + allogeneic effector cells). Figure 10 Shows the activation (41BB + ) of allogeneic effector CD8 + T cells (left panel) and CD4 + T cells (right panel) from two human donors (donor 500 and donor 996) after 24-hour stimulation with pan-T cells with the indicated genetic modifications, with different E:T ratios from left to right being 1:10, 1:5, 1:2, 1:1, 2:1, 5:1, 10:1, 20:1. The negative control is autologous pan-T cells from effector human donors.
[0133] Figure 11 Shows the expansion of D149399 T cells after CRISPR knockout, with no harmful effects of RFX, CIITA, or B2M knockout. The data show the viability, mean diameter, and fold expansion of HLA-altered T cells during production and expansion. CRISPR editing and CD3 / CD28 activation were performed on day 1.
[0134] Figure 12 Shows the expansion of D151100 T cells after CRISPR knockout, with no harmful effects of RFX or B2M knockout. The data show the viability, mean diameter, and fold expansion of HLA-altered T cells during production and expansion. CRISPR editing and CD3 / CD28 activation were performed on day 1.
[0135] Figure 13 Shows the expansion of D144786 T cells after CRISPR knockout, with no harmful effects of RFX or B2M knockout. The data show the viability, mean diameter, and fold expansion of HLA-altered T cells during production and expansion. CRISPR editing and CD3 / CD28 activation were performed on day 1.
[0136] Figure 14 It is shown that PGP1 iPSCs were edited by CRISPR / Cas12a to generate B2M-disrupted cells using B2M-2crRNA. B2M expression was shown relative to control unedited iPSCs. In combination with Table 2, it is shown that CRISPR / Cas12a can be used to edit B2M, RFX5, RFXANK, RFXAP, or CIITA in PGP1 iPSCs and B2M or RFX5 in γδ T cell-derived iPSCs.
[0137] Figure 15Shows the generation and phenotype of B2M and costimulatory knockout T cells from human donor RD01000079 (donor 079). Results of the gene editing process to generate B2M knockout pan T cells with additional costimulatory gene knockouts are shown. Flow cytometry phenotyping was performed 11 days after CRISPR editing and expansion.
[0138] Figure 16 Shows the generation and phenotype of B2M and costimulatory knockout T cells (from human donor D327084, "donor 084"). Results of the gene editing process to generate B2M knockout pan T cells with additional costimulatory gene knockouts are shown. Flow cytometry phenotyping was performed 11 days after CRISPR editing and expansion.
[0139] Figure 17 Shows that when HLA-altered T cells are co-cultured with resting NK cells, CD58 knockout in combination with B2M knockout causes less specific lysis and improved cell viability compared to B2M knockout alone. Specific lysis (left panel) and normalized viability (right panel) of pan T cells with the indicated genetic modifications from two human donors (D327084 and RD01000079) after co-culture with resting primary NK cells are shown. Effector: NK079, Targets: D327084 and RD01000079.
[0140] Figure 18 Shows that knockout of various costimulatory molecules in combination with B2M knockout in T cells reduces specific lysis by NK cells. Reduction in specific lysis of pan T cells with the indicated genetic modifications from one human donor (D327084) after co-culture with resting primary NK cells at E:T = 1 is shown. Reduction in specific lysis is normalized relative to pan T cells with B2M knockout alone. Effector donors: NK021 and NK079.
[0141] Figure 19 Shows the generation of RFX5 and CD58 knockout T cells. Figure 19 Results of the gene editing process to generate RFX5, CD58, and RFX5 / CD58 knockout T cells are shown. Flow cytometry phenotyping performed 14 days after CRISPR editing and expansion is shown. NTC = unedited control.
[0142] Figure 20It is shown that CD58 knockout improved viability in co - culture with alloreactive effector T cells compared to unedited T cells. Survival of pan - T cells with the indicated genetic modifications after 24 - hour co - culture with alloreactive effector T cells from two human donors (D146500 and D151200) is shown. Autologous indicator target cells are unedited, expanded pan - T cells from the same human donors used as effectors.
[0143] Figure 21 It is shown that CD58 knockout plus RFX5 knockout in T cells induced less alloreactive CD4 + T cell activation (CD137 + ) Figure 21 Activation of alloreactive CD4 + T cells from two human donors (D146500 and D151200) after 24 - hour co - culture with pan - T cells containing the indicated genetic modifications is shown. Bars for each ratio condition represent, from left to right: RFX5 knockout, RFX knockout / CD58 knockout, CD58 knockout, and NTC, which is a non - targeted (unedited) control. The effector alone is shown at the end of the bar graph.
[0144] Figure 22 It is shown that CD58 knockout plus RFX5 knockout in T cells induced less alloreactive CD8 + T cell activation (CD137 + ) Figure 28A to Figure 28B Activation of alloreactive CD8 + T cells from two human donors (D146500 and D151200) after 24 - hour co - culture with pan - T cells containing the indicated genetic modifications is shown. Bars for each ratio condition represent, from left to right: RFX5 knockout, RFX knockout / CD58 knockout, CD58 knockout, and NTC, which is a non - targeted (unedited) control. The effector alone is shown at the end of the bar graph.
[0145] Figure 28A It is shown that CD58 knockout plus RFX5 knockout in T cells improved viability compared to RFX5 knockout in co - culture with NK cells. Figure 28B Survival of pan - T cells with the indicated genetic modifications or K562 cells (positive control) after 24 - hour co - culture with resting NK cells from two human donors (NK079 and NK567) is shown.
[0146] Figure 29 It is shown that CD58 knockout plus RFX5 knockout in T cells induced less NK cell (CD137+ ) Activation. Figure 30 Shows activation of NK cells from two donors (NK079 and NK567) after 24 hours of co - culture with pan - T cells containing the indicated genetic modifications. The bars for each ratio condition represent, from left to right: RFX5 knockout, RFX5 knockout / CD58 knockout, CD58 knockout, NTC, and K562. Single effectors are shown at the end of the bar graph.
[0147] Figure 31 Shows that CD58 shRNA tested in Jurkat cells and primary T cells shows knockdown of CD58 surface protein. Figure 32 Shows CD58 expression measured by flow cytometry in primary human pan - T cells (upper panel) and Jurkat cells (lower panel) transduced with lentivirus containing CD58 shRNA. Figure 33 SEQ ID NO:60 - 67 and SEQ ID NO:60 - 67 are disclosed in the order in which they appear.
[0148] Figure 34 Shows the B2M editing efficiency using Cas12a and WT MAD7 in iPSCs. Cas12a (upper panel) or MAD7 (lower panel) RNPs are formed with gRNA B2M_12A_2. The shown flow cytometry plots are obtained by gating on live single cells. Signal reference: E082949.
[0149] Figure 35 Shows a RFX5 gRNA tiling screen in iPSCs. The editing efficiency of each tested gRNA for knocking out the RFX5 gene is shown. Signal reference: E085286.
[0150] Figure 36 Shows the optimization of the RFX gRNA structure. The editing efficiency of the top two RFX5 gRNAs optimized for the gRNA structure is shown. Specifically, Figure 37 Shows the editing efficiency of the RFX5 Exon9 gRNA2 sequence, and Figure 38 Shows the editing efficiency of the RFX5 Exon10 gRNA1 sequence. Three replicates as well as 20bp and 21bp spacer sequence lengths were tested. Signal reference: E110898.
[0151] Figure 39A to Figure 39B Shows a CD58 gRNA tiling screen in iPSCs. The editing efficiency of each tested gRNA for knocking out the CD58 gene is shown. Signal reference: E127262.
[0152] Figure 39AShows the pulse-coding optimization of the editing efficiency with gRNA RFX5_Exon9_gRNA 220bp in three γδT-iPSC clones. Signal reference: E152036.
[0153] Figure 39B Shows the knock-in of CAR into RFX5 with gRNA RFX5_Exon10_gRNA1 20bp. The editing efficiency of CAR knock-in with gRNA RFX5_Exon10_gRNA1 20bp is shown. Four independent reactions were performed using a DNA donor template with 300bp or 500bp homologous arms and with or without M3814 added. The shown flow cytometry plots were obtained by gating on live single cells, and CAR-positive cells were determined by comparing the edited samples with a negative control without RNP. Signal reference: E145675.
[0154] Figure 40A to Figure 40B Shows the knock-in of CAR into RFX5 with gRNA RFX5_Exon9_gRNA 2 20bp. The editing efficiency of CAR knock-in with gRNA RFX5_Exon9_gRNA 2 20bp is shown, using a DNA donor template with 500bp homologous arms and with or without M3814 added. The shown flow cytometry plots were obtained by gating on live single cells, and CAR-positive cells were determined by comparing the edited samples with a negative control without RNP. Signal reference: E145675.
[0155] Figure 40A Shows the pulse-coding optimization of the knock-in of CAR into RFX5. The editing efficiency of CAR knock-in is shown and was achieved with two pulse codings on a Lonza Nucleofector, using RNA RFX5_Exon9_gRNA 2 20bp and with or without M3814 added. The shown flow cytometry plots were obtained by gating on live single cells. Signal reference: E150713.
[0156] Figure 40B Shows the iPSC HLA class I expression in cells edited with MAD7 and gRNA RFX5_Exon9_gRNA 2 20bp. Edited cells (left panel) have reduced HLA class I expression compared to unedited cells (right panel). The shown flow cytometry plots were obtained by gating on live single cells. Signal reference: E154516.
[0157] Figure 41Shows iPSC CD58 expression in cells edited with MAD7 and gRNA CD58_Exon2_gRNA 9 21bp. Edited cells (left panel) have reduced CD58 expression compared to unedited cells (right panel). The shown flow cytometry plots were obtained by gating on live single cells. Signal reference: E132854.
[0158] Figure 42 Shows the generation of CAR knock-in RFX5 clonal cells. Knock-in of CAR into RFX5 was achieved using gRNA RFX5_Exon9_gRNA 220bp. A large number of edited cells were sorted by single cell to generate clonal CAR cells that maintain high expression of pluripotency markers SSEA-3, SSEA-4, OCT3 / 4 and SOX2. + Cells. Surface markers SSEA-1 and CD34, which are not expressed in iPSCs, remained low expressed after editing and cloning. The shown flow cytometry plots were obtained by gating on live single cells. By flow cytometry, a representative clone (clone D5) has near 100% CAR expression. Clone D5 has a 12bp deletion. Signal references: E150740 and E164103.
[0159] Figure 43 Shows the generation of CAR knock-in RFX5 clonal cells. Knock-in of CAR into RFX5 was achieved using gRNA RFX5_Exon9_gRNA 220bp. A large number of edited cells were sorted by single cell to generate clonal CAR cells that maintain high expression of pluripotency markers SSEA-3, SSEA-4, OCT3 / 4 and SOX2. + Cells. Surface markers SSEA-1 and CD34, which are not expressed in iPSCs, remained low expressed after editing and cloning. The shown flow cytometry plots were obtained by gating on live single cells. By flow cytometry, a representative clone (clone C3) has near 100% CAR expression. Clone C3 has a 15bp deletion. Signal references: E150740 and E164103.
[0160] Figure 44 Shows the editing efficiency of MAD7 gRNA split into crRNA and tracrRNA. Split gRNA was formed by adding an equimolar mixture of split tracrRNA and the relevant crRNA and incubating for 15 minutes at room temperature before RNP formation. The indel frequencies of MAD7 using unmodified crRNA, AltR-modified crRNA and split gRNAs 3, 4 and 5 targeting two loci, RFX5 and CD58, are shown. Signal reference: E164852.
[0161] Figure 45 It is shown that CD58 knockout improves the ability of RFX5 knockout cells to evade alloreactive effector T cells. In an overnight cytotoxicity assay, gene-edited T cells or control T cells (target cells) were co-cultured with alloreactive effector T cells at the indicated E:T. Normalized target cell viability was calculated as: % live target cells at E:T / % live target cells only, where a value of 1.0 indicates complete evasion of cytotoxicity. The upper panel ( Figure 46A to Figure 46C ) shows data from a representative experiment from a single human donor. The lower panel ( Figure 46A to Figure 46C ) shows the pooled data at E:T = 10 from multiple experiments with multiple target human donors and effector human donors.
[0162] Figure 46A It is shown that CD58 knockout improves the ability of RFX5 knockout cells to evade primary NK cells. In an overnight cytotoxicity assay, gene-edited T cells or control T cells (targets) were co-cultured with primary NK cells at the indicated E:T. Normalized target cell viability was calculated as: % live target cells at E:T / % live target cells only, where a value of 1.0 indicates complete evasion of cytotoxicity. The upper panel ( Figure 46B to Figure 46C ) shows data from a representative experiment from a single human donor. The lower panel ( 7.1 Definitions ) shows the pooled data at E:T = 10 from multiple experiments with multiple target human donors and effector human donors.
[0163] 7.2 Abbreviations A schematic of the CAR and CD58 miR-shRNA dual-expression system is shown, which is a single vector in which a single pol II promoter drives the expression of a transcript encoding both the CAR and the knockdown of endogenous CD58 via CD58 miR-shRNA. The CD58 miR-shRNA will be processed by Drosha and Dicer for RNAi and then loaded into the RISC (RNA-induced silencing complex) for the silencing of the endogenous CD58 gene. The CAR portion will be translated into a protein for the expression of the CAR molecule.
[0164] Table 1. Abbreviations A FAC gating strategy for assessing CAR expression and knockdown of endogenous CD58 using 55 different CAR and CD58 miR-shRNA dual constructs is shown.
[0165] 7.3 Cells Engineered for Low ImmunogenicityShown is the assessment of transduction of different CD58 miR-shRNA constructs and CD58 knockdown. The upper panel shows the primary screening of 55 different miR-shRNA constructs and a control CAR (without miR-shRNA). CD58% is the MFI of CD58 of each construct / MFI of CD58 of the control CAR. The lower panel shows the subsequent screening results of the top 5 miR-shRNAs transduced into RFX5 knockout primary T cells and 5 control conditions. The percentages above the bars are the knockdown efficiencies, calculated as (CAR + CD58 MFI / (CAR + CD58 MFI NTC CAR-CAR + CD58 MFI CD58 knockout_RFX5 knockout)).
[0166] Isolation / Enrichment of Donor Cells Shown that the first two CAR and CD58 miR-shRNA dual expression systems caused efficient CAR expression and knockdown of endogenous CD58, as measured by surface flow cytometry staining. Enrich CAR + cells prior to flow cytometry analysis and gate on live cells.
[0167] 7.4 Methods for Low Immunogenicity Shown is the flow cytometry gating strategy for analyzing the 7.4.1 Target Genes co-culture experiments shown in.
[0168] 7.4.2 Immunogenic Cells and Immunogenic Human Cells Shown that CD58 knockdown improved the survival of RFX5 knockout cells when attacked with alloreactive effector T cells or NK cells. The upper panel ( 7.4.3 iPS Cells and iPS Human Cells ) shows data from a representative experiment of co-culture of a single target human donor with a single allogeneic effector T cell donor. The lower panel ( 7.4.4 Low Immunogenicity ) shows summary data of the area under the curve (AUC) calculations from multiple experiments with multiple target human donors and effector human donors. 7. Detailed Description
[0169] Cell-based therapies continue to face numerous challenges that limit their clinical application. Such challenges include, for example, as outlined in Bashor et al., Nature Reviews Drug Discovery (2022):21;655-675, “Engineering the next generation of cell-based therapeutics”. This disclosure addresses these and other challenges in the field of cell therapy for the first time.
[0170] The present inventors specifically provide herein low immunogenicity methods, such as bioengineering methodologies and materials, including low immunogenicity (such as engineered low immunogenicity) methodologies and materials that can be used, for example, for genetically modifying and / or otherwise altering at least one target gene or gene product, methods for producing engineered low immunogenicity cells, the manufacture of engineered low immunogenicity cell compositions, and their uses. The present disclosure provides, in part, a method of engineering low immunogenicity, including genetically modifying at least one target gene of a human cell or cells (e.g., regulatory factor X (RFX), B2M gene, CD58 gene, CIITA gene) to reduce the expression of the protein encoded by the target gene in or within the human cell, and forming at least one embryoid body to produce at least one engineered low immunogenicity cell. In some embodiments, the human cell is an immunogenic human cell. In some embodiments, the human cell is an induced pluripotent stem (iPS) human cell, e.g., an iPS human cell produced by reprogramming immunogenic γδ T cells. In some embodiments, the cell is a rodent, porcine, primate, monkey, ape, or human cell. In some embodiments, the cell is an immunogenic rodent, porcine, primate, monkey, ape, or human cell. In some embodiments, the cell is an immunogenic human cell. In some embodiments, the cell is an induced pluripotent stem (iPS) cell, e.g., an iPS cell produced by reprogramming immunogenic γδ T cells. The present disclosure is based, in part, on the discovery that the engineered low immunogenicity cells disclosed herein are capable of evading the immune response of an allogeneic host to the graft.
[0171] 7.4.5 Chimeric Antigen Receptor (CAR) Knock-in System
[0172] As used herein, the terms “about” or “approximately” mean that a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length varies by up to 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% relative to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. A range of quantities, levels, values, numbers, frequencies, percentages, dimensions, sizes, amounts, weights, or lengths can be ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% with respect to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. The term “about” associated with a reference numerical value can include the numerical value itself and a range of values, e.g., ±10% of the numerical value. In some embodiments, the amount “about 10” includes 10 and any amount from 9 to 11. In some cases, numerical values disclosed throughout the text can be “about” that numerical value even if the term “about” is not explicitly recited.
[0173] Unless otherwise specified, the terms "at least", "at most", or "about" preceding a series of elements shall be understood to refer to each element in the series.
[0174] The singular forms "a", "an", and "the" as used in the specification and the appended claims include plural referents unless the context clearly dictates otherwise.
[0175] As used herein, and unless expressly stated to the contrary, "or" means an inclusive "or" and not an exclusive "or". For example, the condition A or B is satisfied by any one of the following: A is true (or present) and B is false (or absent), A is false (or absent) and B is true (or present), and both A and B are true (or present).
[0176] As used herein, the conjunctive term "and / or" between a plurality of recited elements is understood to include both individual and combined options. For example, in the case where two elements are joined by "and / or", the first option means that the first element applies in the absence of the second element. The second option means that the second element applies in the absence of the first element. The third option means that the first and second elements are suitable for use together. Any one of these options is understood to fall within the meaning and thus satisfy the requirements of the term "and / or" as used herein. The parallel applicability of more than one option is also understood to fall within the meaning and thus satisfy the requirements of the term "and / or".
[0177] As used herein, the term "MHC molecule" refers to the major histocompatibility complex (MHC) found on the cell surface that presents peptide fragments of non-self proteins. MHC class I molecules and MHC class II molecules are two types of MHC molecules commonly found on antigen-presenting cells. MHC class I molecules consist of two polypeptide chains. The α chain consists of 3 polypeptides called the α-1, α-2, and α-3 domains. The α chain is non-covalently linked to a β chain consisting of β-2 microglobulin (B2M) through the α-3 domain. The α chain is polymorphic and is encoded in humans by HLA genes (i.e., HLA-A, HLA-B, and HLA-C), while β-2 microglobulin is not polymorphic and is encoded by the B2M gene. MHC class II molecules are transmembrane αβ heterodimers. In humans, there are three MHC class II isotypes: HLA-DR, HLA-DP, and HLA-DQ, which are encoded by α and β chain genes within the human leukocyte antigen (HLA) locus on chromosome 6.
[0178] As used herein, the terms "deletion" or "knockout" refer to a genetic modification in which a locus or region of genomic DNA is removed by any molecular biology method (e.g., the methods described herein), such as by delivering an endonuclease and at least one gRNA to the locus of the genomic DNA. The terms "deletion" or "knockout" include deletion of all or a portion of a target polynucleotide sequence in a manner that interferes with the function of the target polynucleotide sequence. In some embodiments, a "deletion" or "knockout" can result in a complete or partial loss of expression of the target gene. Any number of nucleotides can be deleted. In some embodiments, the deletion involves removal of at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, or more than at least 25 nucleotides. In some embodiments, the deletion involves removal of 10 to 50, 25 to 75, 50 to 100, 50 to 200, or more than 100 nucleotides. In some embodiments, the deletion involves removal of an entire target gene, such as an RFX gene. In some embodiments, the deletion involves removal of a portion of a target gene, such as all or a portion of the promoter and / or coding sequence of an RFX gene. In some embodiments, the deletion involves removal of a transcriptional regulatory factor of a target gene, such as a promoter region. In some embodiments, the deletion involves removal of all or a portion of a coding region such that the product normally expressed by the coding region is no longer expressed, is expressed as a truncated form, or is expressed at a low level. In some embodiments, the deletion results in a decrease in gene expression relative to an unmodified cell. In some embodiments, a knockout can be achieved by altering a target polynucleotide sequence by inducing an indel in the target polynucleotide sequence in a functional domain (e.g., a DNA binding domain) of the target polynucleotide sequence. The terms "disruption" or "disrupted" refer to a change that results in a gene product not exhibiting wild-type function and / or activity levels. In some aspects, disruption refers to an alteration of a gene that results in the production of such a non-wild-type gene product due to the disrupted gene. As used herein, "disruption" refers to RNA interference, which includes disruption of the mRNA transcript of a gene by expression of an introduced miR-adapted shRNA.
[0179] In some embodiments, the disruption truncates a gene (e.g., the B2M gene). In some embodiments, the disruption deletes a gene (e.g., the B2M gene). In some embodiments, the disruption results in the gene producing an inactive protein. In some embodiments, the disruption disrupts the reading frame of B2M through multiple out-of-frame deletions. In some embodiments, the disruption disrupts the reading frame of B2M through a single out-of-frame deletion. In some embodiments, the disruption results in the insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that changes the reading frame of a gene (e.g., B2M)). In some embodiments, the disruption disrupts the reading frame of B2M. In a specific embodiment, the gene is the B2M gene, and the disruption results in the B2M gene producing an inactive B2M protein. In some embodiments, the disruption results in a reduced amount of gene product expressed by the gene, e.g., a reduced amount of B2M polypeptide. In a specific embodiment, the gene is the B2M gene, and the disruption results in a reduced amount of B2M protein expressed by the B2M gene. In some embodiments, the disruption results in an undetectable amount of gene product expressed by the gene, e.g., an undetectable amount of B2M protein. In some embodiments, the gene is the B2M gene and the disruption results in an undetectable amount of B2M protein expressed by the B2M gene. The disrupted gene, e.g., the disrupted B2M gene, can refer to a gene that contains an insertion, deletion, or substitution relative to the corresponding wild-type gene such that, relative to the expression of the wild-type gene, the disrupted gene expresses a reduced amount (e.g., an undetectable amount) of a functional protein. A gene can be disrupted, for example, by inserting, deleting, or substituting at least one nucleotide / nucleic acid in the endogenous gene, thereby reducing or inhibiting the expression of a functional protein by the endogenous gene. In some embodiments, the substitution is performed by a base editor, wherein the base editor converts one nucleotide to another by modifying the chemical structure of the nucleotide. In some embodiments, the terms "disruption", "disrupted", "knockout", or "deletion" may be used interchangeably in the present disclosure. In some embodiments, the at least one gRNA is complementary and / or hybridizes to a sequence on a target polynucleotide sequence, wherein the target polynucleotide sequence contains the B2M gene. In some embodiments, the target polynucleotide sequence contains the sequence shown in SEQ ID NO:253. In some embodiments, the gRNA contains the repeat sequence shown in SEQ ID NO:129 (UAAUUUCUACUCUUGUAGAU), optionally in combination with the spacer sequence shown in SEQ ID NO:251 (AGUGGGGGUGAAUUCAGUGUA). In some embodiments, the gRNA contains the sequence shown in SEQ IDNO:252.
[0180] In some embodiments, the gRNA targeting B2M is a discontinuous or "split" RNA.
[0181] In some embodiments, the disruption truncates a gene (e.g., the RFX gene). In some embodiments, the disruption deletes a gene (e.g., the RFX gene). In some embodiments, the disruption results in the production of an inactive protein from the gene. In some embodiments, the disruption results in the disruption of the reading frame of RFX by multiple out-of-frame deletions. In some embodiments, the disruption results in the disruption of the reading frame of RFX by a single out-of-frame deletion. In some embodiments, the disruption results in the insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that changes the reading frame of a gene (e.g., RFX)). In some embodiments, the disruption results in the disruption of the reading frame of RFX. In a specific embodiment, the gene is the RFX gene and the disruption results in the production of an inactive RFX protein from the RFX gene. In some embodiments, the disruption results in a reduced amount of gene product expressed by the gene, e.g., a reduced amount of RFX polypeptide. In a specific embodiment, the gene is the RFX gene and the disruption results in a reduced amount of RFX protein expressed by the RFX gene. In some embodiments, the disruption results in an undetectable amount of gene product expressed by the gene, e.g., an undetectable amount of RFX protein. In some embodiments, the gene is the RFX gene and the disruption results in an undetectable amount of RFX protein expressed by the RFX gene. A disrupted gene, e.g., a disrupted RFX gene, can refer to a gene that contains an insertion, deletion or substitution relative to the corresponding wild-type gene such that, relative to the expression of the wild-type gene, the disrupted gene expresses a reduced amount (e.g., an undetectable amount) of functional protein. A gene can be disrupted, for example, by a method of inserting, deleting or substituting at least one nucleotide / nucleic acid in the endogenous gene, thereby reducing or inhibiting the expression of a functional protein by the endogenous gene. In some embodiments, the substitution is performed by a base editor, wherein the base editor converts one nucleotide into another by modifying the chemical structure of the nucleotide. In some embodiments, the terms "disruption", "disrupted", "knockout" or "deletion" may be used interchangeably in the present disclosure. In some embodiments, the at least one gRNA is complementary and / or hybridizes to a sequence on a target polynucleotide sequence, wherein the target polynucleotide sequence contains the RFX gene.In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 184 (RFX5_Exon9_gRNA 2; AGGAUCCGCUCUGCCCAGUCA), SEQ ID NO: 193 (RFX5_Exon10_gRNA 1; GAUGACCGUUCCCGAGGUGCA), SEQ ID NO: 202 (RFX5_Exon10_gRNA4; GAGAACCCAGAGGGUGGAGCC), SEQ ID NO: 205 (RFX5_Exon10_gRNA 5; GUACCUCUGCAGAAGAGGACG), SEQ ID NO: 223 (RFX5_Exon11_gRNA 8; AGGGCACCUGAAGAAAGCCUG), SEQ ID NO: 239 (RFX5_Exon9_gRNA 2; AGGAUCCGCUCUGCCCAGUC) or SEQ ID NO: 246 (RFX5_Exon10_gRNA 1; GAUGACCGUUCCCGAGGUGC). In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 239 or 246. In some embodiments, the target polynucleotide sequence comprises the sequence of SEQ ID NO: 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 241, 241 or 248. In some embodiments, the gRNA comprises the repeat sequence shown in SEQ ID NO: 129, 235 or 237. In some embodiments, the gRNA further comprises the spacer sequence shown in SEQ ID NO: 130, 133, 136, 139, 142, 145, 148, 151, 154, 157, 160, 163, 166, 169, 172, 175, 178, 181, 184, 187, 190, 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 239 or 246.In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 131, 134, 137, 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 238, 240, 242, 243, 244, 245, 247, 249 or 250. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 141, 186, 195, 204, 207, 225, 241 or 248. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 129, 235 or 237. In some embodiments, the gRNA further comprises a spacer sequence shown in SEQ ID NO: 139, 184, 193, 202, 205, 223, 239 or 246. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 140, 185, 194, 203, 206, 224, 236, 238, 240, 242, 243, 244, 245, 247, 249 or 250.
[0182] In some embodiments, the gRNA targeting RFX5 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence shown in SEQ ID NO: 377, 378, 379, 380, 381, 382, 383, 384 or 385.
[0183] In some embodiments, the disruption truncates a gene (e.g., the CD58 gene). In some embodiments, the disruption deletes a gene (e.g., the CD58 gene). In some embodiments, the disruption results in the production of an inactive protein by the gene. In some embodiments, the disruption results in the disruption of the reading frame of CD58 via multiple out-of-frame deletions. In some embodiments, the disruption results in the disruption of the reading frame of CD58 via a single out-of-frame deletion. In some embodiments, the disruption results in the insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that alters the reading frame of a gene (e.g., CD58)). In some embodiments, the disruption results in the disruption of the reading frame of CD58. In a specific embodiment, the gene is the CD58 gene, and the disruption results in the production of an inactive CD58 protein by the CD58 gene. In some embodiments, the disruption results in a reduced amount of gene product expressed by the gene, e.g., a reduced amount of CD58 polypeptide. In a specific embodiment, the gene is the CD58 gene, and the disruption results in a reduced amount of CD58 protein expressed by the CD58 gene. In some embodiments, the disruption results in an undetectable amount of gene product expressed by the gene, e.g., an undetectable amount of CD58 protein. In some embodiments, the gene is the CD58 gene and the disruption results in an undetectable amount of CD58 protein expressed by the CD58 gene. The disrupted gene, e.g., the disrupted CD58 gene, can refer to a gene that contains an insertion, deletion, or substitution relative to the corresponding wild-type gene such that, relative to the expression of the wild-type gene, the disrupted gene expresses a reduced amount (e.g., an undetectable amount) of a functional protein. A gene can be disrupted, for example, by inserting, deleting, or substituting at least one nucleotide / nucleic acid in the endogenous gene, thereby reducing or inhibiting the expression of a functional protein by the endogenous gene. In some embodiments, the substitution is performed by a base editor, wherein the base editor converts one nucleotide to another by modifying the chemical structure of the nucleotide. In some embodiments, the terms "disruption", "disrupted", "knockout", or "deletion" can be used interchangeably in the present disclosure. In some embodiments, the at least one gRNA is complementary and / or hybridizes to a sequence on a target polynucleotide sequence, wherein the target polynucleotide sequence contains the CD58 gene. In some embodiments, the target polynucleotide sequence contains SEQ ID NO: 256, 259, 262, 265, 268, 271, 274, 277, 280, 283, 286, 289, 292, 295, 298, 301, 304, 307, 310, 313, 316, 319, 322, 325, 328, 331, 334, 337, 340, 343, 346, 349, 352, 355, 358, 361, 364, 367, 370, 373, or 376.In some embodiments, the gRNA comprises the repeat sequence shown in SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence, which comprises the sequence of SEQ ID NO: 254, 257, 260, 263, 266, 269, 272, 275, 278, 281, 284, 287, 290, 293, 296, 299, 302, 305, 308, 311, 314, 317, 320, 323, 326, 329, 332, 335, 338, 341, 344, 347, 350, 353, 356, 359, 362, 365, 368, 371 or 374. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, 309, 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372 or 375. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 271, 274, 280, 304 or 328. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence, which comprises the sequence of SEQ ID NO: 254, 269, 272, 278, 302 or 326. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 270, 273, 279 or 327.
[0184] In some embodiments, the gRNA targeting CD58 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence shown in SEQ ID NO: 377, 378, 379, 386, 387 or 388.
[0185] In some embodiments, the gRNA both disrupts a gene (e.g., by forming indels, resulting in non-functional expression of the gene) and introduces another polynucleotide, such as a gene of a chimeric antigen receptor (CAR) and / or miR-adapted shRNA. In some embodiments, the gRNA targets RFX5. In some embodiments, the gRNA is used to knock in a transgene containing a promoter and a CAR into a target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene), resulting in the expression of the CAR on the surface of low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells that can be detected by flow cytometry. In some embodiments, the gRNA is used to knock in a miR-adapted shRNA targeting CD58. In some embodiments, the miRNA comprises a sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0186] In some embodiments, the shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO: 60, 63, or 64.
[0187] As used herein, the term "endonuclease" generally refers to an enzyme that cleaves phosphodiester bonds within a polynucleotide. In some embodiments, the endonuclease specifically cleaves phosphodiester bonds within a DNA polynucleotide. In some embodiments, the endonuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a homing endonuclease (HE), a meganuclease, a MegaTAL, or a CRISPR (clustered regularly interspaced short palindromic repeats)-associated endonuclease. A CRISPR cluster contains spacers, sequences complementary to previous mobile elements, and targets invading nucleic acids. The CRISPR cluster is transcribed and processed into CRISPR RNA (crRNA). In some embodiments, the endonuclease is an RNA-guided endonuclease. In certain aspects, the RNA-guided endonuclease is a CRISPR nuclease, such as a type II CRISPR Cas9 endonuclease or a type V CRISPR Cpf1 (or Cas12a) endonuclease. CRISPR-Cas systems can be characterized as class 1 or class 2 systems. Class 1 systems are characterized by multi-subunit effectors; i.e., they contain multiple Cas proteins. Class 1 systems can be further characterized as type I, type III, and type IV. Class 2 systems are characterized by a single effector protein with multiple domains. Class 2 systems can be further characterized as type II, type V, and type VI. For example, class 2 type II systems contain Cas9, while class 2 type V systems contain Cpf1 (Cas12a). Other examples of Cas proteins include, but are not limited to, Cas9 protein, Cas9-like proteins encoded by Cas9 orthologs, Cas9-like synthetic proteins, Cpf1 protein, proteins encoded by Cpf1 orthologs, Cpf1-like synthetic proteins, C2c1 protein, C2c2 protein, C2c3 protein, and variants and modifications thereof. In some embodiments, the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1 (also known as Cas12a), MAD7, MAD2 endonucleases, or homologs thereof, recombinants of their naturally occurring molecules, codon-optimized versions thereof or modified versions thereof, or combinations thereof.Examples of Cas proteins include, but are not limited to, MAD7, MAD2, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c. Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c. In some embodiments, the endonuclease may introduce one or more single-strand breaks (SSBs) and / or one or more double-strand breaks (DSBs).
[0188] As used herein, the term "Cas12" or "Cas12 protein" refers to any Cas12 protein, including but not limited to Cas12 proteins such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e. In some embodiments, the Cas12 protein has an amino acid sequence that is at least 85% (or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%) identical to the amino acid sequence of a functional Cas12 protein. In some embodiments, the Cas12 protein can be a Cas12 polypeptide that is substantially identical to a protein found in nature, or a Cas12 polypeptide that has at least about 85% sequence identity (or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 96% sequence identity, or at least about 97% sequence identity, or at least about 98% sequence identity, or at least about 99% sequence identity) to a Cas12 protein found in nature and has substantially the same biological activity. Examples of Cas12a proteins include but are not limited to FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, or Lb4Cas12a. Examples of Cas12b proteins include but are not limited to AacCas12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b, and AcCas12b.
[0189] In some embodiments, the term "Cpf endonuclease" refers to an RNA-guided DNA endonuclease associated with CRISPR that cleaves a target DNA sequence when coupled with a guide RNA. The Cpf endonuclease is guided by the guide RNA to recognize and cleave a specific target site in double-stranded DNA in the cellular genome. In some embodiments, the CRISPR-Cpf system uses the Cpf1 endonuclease from Acidaminococcus species, the Cpf1 endonuclease from Lachnospiraceae sp., or the Cpf1 endonuclease from Francisella novicida, or variants thereof. The Cpf1-crRNA complex cleaves the target DNA by recognizing the protospacer adjacent motif (PAM) 5'-TTTN for the Cpf1 endonuclease from Acidaminococcus species and the Cpf1 endonuclease from Lachnospiraceae sp., and the PAM sequence 5'-TTN for the Cpf1 endonuclease from Francisella novicida. After recognizing the PAM, Cpf1 introduces a sticky-end DNA double-strand break with a 4- to 5-nucleotide overhang distal to the 3'-end of the targeted PAM, which is then repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR). It should be understood that the term "Cpf1 endonuclease" encompasses its variants.
[0190] As is known to those of ordinary skill in the art, the term "Mad endonuclease" refers to an RNA-guided DNA endonuclease associated with CRISPR that cuts a target DNA sequence when coupled with a guide RNA. The Mad endonuclease is guided by the guide RNA to recognize and cut a specific target site in double-stranded DNA in the cell genome. The CRISPR-Mad system is closely related to type V (Cpf1-like) of the class 2 family of CAS enzymes. In some embodiments, the CRISPR-Mad system employs the Eubacterium rectale MAD7 endonuclease or variants thereof. In some embodiments, MAD7 is a class 2 V-A CRISPR family identified in Eubacterium rectale. The MAD7-crRNA complex cuts the target DNA by recognizing the protospacer adjacent motif (PAM) 5'-YTTN. After recognizing the PAM, MAD7 introduces a sticky-end DNA double-strand break with a 4- to 5-nucleotide overhang at the 3' end of the targeted PAM, which is then repaired by non-homologous end joining (NHEJ) or homology-directed repair (HDR). It should be understood that the term "Mad endonuclease" encompasses its variants. In some embodiments, the B2M target motif recognized or used by the CRISPR-Cpf1 (Cas12a) system is the same B2M target motif as when using MAD7. In some embodiments, the same guide nucleic acid or guide RNA can be used with Cpf1 (or Cas12a) and the MAD7 nuclease.
[0191] As used herein, the term "guide RNA" or "gRNA" generally refers to a short ribonucleic acid that can interact (e.g., bind) with an endonuclease and bind or hybridize to a target genomic locus or region. In some embodiments, the gRNA is a single molecule guide RNA (sgRNA). In some embodiments, the gRNA can comprise a spacer extension region. In some embodiments, the gRNA can comprise a tracrRNA extension region. In some embodiments, the gRNA is single-stranded. In some embodiments, the gRNA comprises naturally occurring nucleotides. In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA is a gRNA comprising at least one nucleotide having a chemical modification (e.g., 2'-O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises 2'-O-methyl-thiophosphate residues. In some embodiments, the gRNA can be pre-complexed with a DNA endonuclease. In some embodiments, the gRNA sequence comprises AltR1 and / or AltR2. In some embodiments, AltR1 and AltR2 are proprietary (IDT) modifications for increasing the stability of short RNAs (e.g., gRNAs). For example, modifications of nucleic acids such as RNA and gRNA are described in U.S. Patent No. 9,840,702, which is incorporated herein by reference. The gRNA can be constructed as a single RNA oligonucleotide that is a combination of a repeat sequence followed by a spacer sequence, where specificity for a genomic target location is conferred by complementary binding of the spacer to genomic DNA. A split gRNA can be constructed as two RNA oligonucleotides consisting of a tracrRNA and a crRNA, where the tracrRNA contains a portion of the repeat sequence and the crRNA contains a portion of the repeat sequence followed by, for example, a spacer sequence.
[0192] As used herein, the term "genetic modification" generally refers to the genetic editing or manipulation of a gene, the genomic DNA transcribed from that gene, or the transcription of that gene in a cell, which results in a decrease in the expression level of the gene product (e.g., the protein encoded by that gene).
[0193] The terms "reduce", "decrease", and "lower" are used interchangeably herein and mean a statistically significant decrease (e.g., below the normal value by two standard deviations (2SD)). In some embodiments, "reduce", "decrease", or "lower" means a decrease of at least about 5% compared to a reference level, such as a decrease of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a reference level. In some embodiments, "reduce", "decrease", or "lower" is any decrease between 10% and 100% compared to a reference level. In some embodiments, "reduce", "decrease", or "lower" means a decrease of at least about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold compared to a reference level. In some embodiments, the reduced or decreased expression results in the target gene or target polynucleotide sequence in a cell or cell population being at an undetectable level, as determined by methods used by those of skill in the art or methods disclosed in the present disclosure (e.g., FACS). In some embodiments, the reduced RFX expression is reduced relative to a reference. In some embodiments, the reference is an iPSC or a population of iPSCs that are genetically modified to not have the gene (e.g., the RFX gene). In some embodiments, the reference is an immunogenic human cell or a population of immunogenic human cells that are genetically modified to not have the gene.
[0194] In some embodiments, the terms "increase", "enhance", and "elevate" are used interchangeably herein and mean an increase of at least about 5% compared to a reference level, such as an increase of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a reference level. In some embodiments, "increase", "enhance", or "elevate" is any increase between 10% and 100% compared to a reference level. In some embodiments, "increase", "enhance", or "elevate" means an increase of at least about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold compared to a reference level.
[0195] As used herein, the term "polynucleotide", which may be used interchangeably with the term "nucleic acid", generally refers to a biomolecule comprising two or more nucleotides. Typically, the polynucleotides of the present disclosure are composed of nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) that are naturally present in DNA or RNA and joined by phosphodiester bonds. In some embodiments, the polynucleotide is a hybrid DNA / RNA molecule. In some embodiments, the term encompasses molecules containing nucleosides or nucleoside analogs that contain chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. When the present application refers to polynucleotides, it should be understood that both DNA and RNA are provided and in each case single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, a "polynucleotide sequence" may refer to the polynucleotide material itself and / or the sequence information that biochemically characterizes a particular nucleic acid (i.e., the sequence of letters used as base abbreviations). Unless otherwise indicated, the polynucleotide sequences provided herein are provided in the 5' to 3' direction. In some embodiments, the polynucleotide contains at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides. In some embodiments, the polynucleotide is a locus or region of genomic DNA. In some embodiments, the polynucleotide is an endogenous gene contained within the cell genome. In some embodiments, the polynucleotide is an exogenous polynucleotide that does not integrate into genomic DNA. In some embodiments, the polynucleotide is an exogenous polynucleotide that integrates into genomic DNA. In some embodiments, the polynucleotide is a plasmid or an adeno-associated virus vector. In some embodiments, the polynucleotide is a circular or linear molecule.
[0196] As used herein, "cell culture medium" (also referred to herein as "culture medium" or "culture") is a medium for culturing cells that contains nutrients that maintain cell viability and support proliferation. Cell culture medium can contain any suitable combination of any of the following substances: salts, buffers, amino acids, glucose or other sugars, antibiotics, serum or serum replacements, and other components such as peptide growth factors, etc. Cell culture media commonly used for specific cell types are known to those of skill in the art. Some non-limiting examples are provided herein.
[0197] As used herein, "cell line" refers to a population of cells that are generally or substantially identical, usually derived from a single progenitor cell or from a defined and / or substantially identical population of progenitor cells. A cell line may have been or may be capable of being maintained in culture for an extended period (e.g., months, years, an indefinite period of time). It may have undergone a spontaneous or induced transformation process that confers upon the cells an unlimited culture lifespan. Cell lines include all cell lines recognized in the art. It should be understood that cells acquire mutations and possible epigenetic changes over time such that at least some properties of the individual cells of a cell line may differ from one another.
[0198] As used herein, the terms "differentiate", "differentiation", etc. refer to the process by which unspecialized (or undetermined) or less specialized cells acquire the characteristics of specialized cells such as blood cells or muscle cells. Differentiated or differentiation-induced cells are cells that occupy a more specialized (or determined) position in the cell lineage. When a cell proceeds to a certain point in the differentiation pathway, it is determined: under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types and, under normal circumstances, cannot differentiate into a different cell type or revert to a less differentiated cell type.
[0199] As used herein, the term "encode" refers to the inherent property of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template in biological processes for the synthesis of other polymers and macromolecules that have a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties. Thus, if transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, the gene encodes that protein. Both the coding strand, which has the same nucleotide sequence as the mRNA and is usually provided in the sequence listing, and the non-coding strand, which serves as the template for transcription of the gene or cDNA, can be said to encode the protein, or other product of the gene or cDNA.
[0200] As used herein, the term "exogenous" is intended to indicate the introduction of the molecule or activity mentioned into a host cell. For example, a molecule can be introduced by introducing a coding nucleic acid into the host genetic material, such as by integration into the host chromosome or as non-chromosomal genetic material such as a plasmid. Thus, when used in reference to the expression of a coding nucleic acid, the term refers to the introduction of the coding nucleic acid into a cell in an expressible form. The term "endogenous" refers to the molecule or activity mentioned that is present in the host cell. Similarly, when used in reference to the expression of a coding nucleic acid, the term refers to the expression of a coding nucleic acid that is contained within the cell and is not exogenous.
[0201] As used herein, the term "induced pluripotent stem cell" or "iPSC" refers to a stem cell generated from a differentiated somatic cell that has been induced or altered (i.e., reprogrammed) to a cell capable of differentiating into tissues having all three germ layers or dermal layers: mesoderm, endoderm, and ectoderm.
[0202] As used herein, the term "isolated", when used in reference to a cell, is intended to mean a cell that is substantially free of at least one component when the cell is found in nature. The term includes a cell that has been removed from some or all of the components in which it is found in its natural environment. The term also includes a cell that has been removed from at least one, some, or all of the components when the cell is found in a non-naturally occurring environment. Thus, an isolated cell is at least partially or completely separated from other substances found in nature or growing, stored, or present in a non-naturally occurring environment. Specific examples of isolated cells include partially pure cells, substantially pure cells, and cells cultured in a non-naturally occurring medium.
[0203] As used herein, the term "purified", etc. refers to an increase in purity. For example, the purity can be increased to at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% (e.g., as compared to a reference).
[0204] As used herein, the term "pluripotency" refers to the ability of a cell to form all lineages of the body or soma (i.e., the embryo itself). For example, embryonic stem cells are a type of pluripotent stem cell that are capable of forming cells from each of the three germ layers, namely, the ectoderm, mesoderm, and endoderm. Pluripotency is a continuum of developmental potential, ranging from less complete or partially pluripotent cells (e.g., epiblast stem cells or EpiSCs) that are unable to give rise to a complete organism to more primitive, pluripotent cells (e.g., embryonic stem cells) that are capable of giving rise to a complete organism.
[0205] As used herein, the term "population," when used in reference to T lymphocytes, refers to a group of cells that includes two or more T lymphocytes. An isolated population of T lymphocytes can have only one type of T lymphocyte, or two or more types of T lymphocytes. An isolated population of T lymphocytes can be a homogeneous population of one type of T lymphocyte or a heterogeneous population of two or more types of T lymphocytes. An isolated population of T lymphocytes can also be a heterogeneous population that has T lymphocytes and at least one cell other than T lymphocytes (e.g., B cells, macrophages, neutrophils, red blood cells, hepatocytes, endothelial cells, epithelial cells, muscle cells, brain cells, etc.). The heterogeneous population can have from 0.01% to about 100% T lymphocytes. Thus, an isolated population of T lymphocytes can have at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% T lymphocytes. An isolated population of T lymphocytes can include only one type of T lymphocyte, or a mixture of more than one type of T lymphocyte. An isolated population of T lymphocytes can include one or more or all of the different types of T lymphocytes, including but not limited to those disclosed herein. An isolated population of T lymphocytes can include all known types of T lymphocytes. In an isolated population of T lymphocytes that includes more than one type of T lymphocyte, the proportion of each type of T lymphocyte can range from 0.01% to 99.99%. The isolated population can also be a clonal population of T lymphocytes, wherein all of the T lymphocytes in the population are clones of a single T lymphocyte.
[0206] A "recombinant" polynucleotide is a polynucleotide that is not in its native state, e.g., the polynucleotide contains a nucleotide sequence not found in nature, or the polynucleotide is in a context other than that in which it is naturally found, e.g., separated from nucleotide sequences with which it is normally adjacent in nature or adjacent (or ligated) to nucleotide sequences with which it is not normally adjacent. For example, the sequence in question can be cloned into a vector or recombined with one or more additional nucleic acids.
[0207] As used herein, "reprogramming" refers to the process of altering or reversing the differentiated state of a somatic cell. Prior to reprogramming, the cell can be partially differentiated or terminally differentiated. Reprogramming includes the complete reversal of the differentiated state of a somatic cell (e.g., a T cell) to a pluripotent state. Reprogramming also includes the partial reversal of the differentiated state of a somatic cell to a state that makes the cell more amenable to complete reprogramming to a pluripotent state upon the performance of additional manipulations such as those described herein. Such exposure can cause the cell to express specific genes, the expression of which aids in reprogramming. In some embodiments of the present disclosure, reprogramming of a somatic cell results in the somatic cell being in a pluripotent and ES-like state. The resulting cells are referred to herein as reprogrammed pluripotent somatic cells or induced pluripotent stem cells (iPSCs). In some embodiments, reprogramming also includes the partial reversal of the differentiated state of a somatic cell to a multipotent state.
[0208] Reprogramming is different from simply maintaining the existing undifferentiated state of cells that are already pluripotent or maintaining the existing partially differentiated state of cells that are already multipotent (such as hematopoietic stem cells). Reprogramming is also different from promoting the self-renewal or proliferation of cells that are already pluripotent or multipotent. In some embodiments, the methods described herein facilitate the establishment of a pluripotent state by reprogramming. In some embodiments, the methods described herein can be implemented on fully differentiated cells and / or specific types of cells (e.g., γδ T cells), rather than on cells that are already multipotent or pluripotent.
[0209] As used herein, a "reprogramming factor" refers to, for example, a gene, RNA, or protein that promotes or facilitates cell reprogramming in vitro. Examples of reprogramming factors for reprogramming somatic cells to pluripotency of interest in vitro are Oct3 / 4, Klf4, c-Myc, Nanog, Sox2, and Lin28, and any gene / protein that can substitute for one or more of these reprogramming factors in, for example, methods of reprogramming somatic cells in vitro.
[0210] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to the major type of white blood cell that completes thymic maturation and has multiple roles in the immune system, including the identification of specific foreign antigens in vivo and the activation and inactivation of other immune cells. T lymphocytes can be any T lymphocyte, such as cultured T lymphocytes, e.g., primary T lymphocytes, or T lymphocytes from a cultured T cell line, e.g., Jurkat, SupT1, etc., or T lymphocytes obtained from a mammal. T lymphocytes can be CD3 + cells. T lymphocytes can be any type of T lymphocyte and can be at any developmental stage, including but not limited to CD4 + / CD8 + double-positive T cells, CD4 + helper T cells (e.g., Th1 and Th2 cells), CD8 + T cells (e.g., cytotoxic T cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδ T cells (γδ T cells), etc. T lymphocytes can be T regulatory cells, which include nTreg (natural Treg), iTreg (induced Treg), CD8 + Treg, Tr1 regulatory cells, and Th3 cells. Other types of helper T cells include cells such as Th3 (Treg), Th17, Th9, or T follicular helper (Tfh) cells. Other types of memory T cells include cells such as central memory T cells (TCM cells), effector memory T cells (T EM cells and T EMRA cells). T lymphocytes can also refer to genetically engineered T lymphocytes, such as T lymphocytes modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T lymphocytes can also differentiate from stem cells, permanent hematopoietic endothelium, CD34 + cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic multipotent progenitor cells or T cell progenitor cells.
[0211] As used herein, the term "γδ T cell" refers to a T cell that has a T cell receptor on its surface that comprises a γ chain and a δ chain.
[0212] As used herein, the term "selectable marker" refers to a gene, RNA or protein that, when expressed, confers a selectable phenotype on a cell, such as resistance to a cytotoxic agent or a cell growth inhibitor (e.g., antibiotic resistance), prototrophy, or the expression of a specific protein that can be used as a basis for distinguishing cells that express the protein from cells that do not. Proteins whose expression can be readily detected, such as fluorescent or luminescent proteins or enzymes that act on a substrate to produce a colored, fluorescent or luminescent substance ("detectable markers"), constitute a subset of selectable markers. The presence of a selectable marker linked to the native expression control elements of a gene that is selectively or specifically expressed in pluripotent cells makes it possible to identify and select somatic cells that have been reprogrammed to a pluripotent state. A variety of selectable marker genes can be used, such as the neomycin resistance gene (neo), the puromycin resistance gene (puro), the guanine phosphoribosyltransferase (gpt), the dihydrofolate reductase (DHFR), the adenosine deaminase (ada), the puromycin-N-acetyltransferase (PAC), the hygromycin resistance gene (hyg), the multidrug resistance gene (mdr), the thymidine kinase (TK), the hypoxanthine-guanine phosphoribosyltransferase (HPRT), and the hisD gene. Detectable markers include green fluorescent protein (GFP), Sapphire, yellow, red, orange and cyan fluorescent proteins and variants of any of these. Luminescent proteins such as luciferase (e.g., firefly or Renilla luciferase) are also useful. As will be apparent to those skilled in the art, as used herein, the term "selectable marker" can refer to a gene or the expression product of that gene, such as the encoded protein.
[0213] In some embodiments, a selectable marker confers a proliferation and / or survival advantage on cells expressing it relative to cells that do not express it or express it at a significantly lower level. Such proliferation and / or survival advantages typically occur when cells are maintained under certain conditions, i.e., "selective conditions". To ensure effective selection, a cell population can be maintained under conditions and for a sufficient period of time such that cells that do not express the marker do not proliferate and / or do not survive and are eliminated from the cell population, or their numbers are reduced to only a very small fraction of the cell population. A method of selecting cells expressing a marker by maintaining a cell population under selective conditions to substantially or completely eliminate cells that do not express a marker conferring a proliferation and / or survival advantage is referred to herein as "positive selection", and the marker is referred to as "usable for positive selection". Negative selection and markers for negative selection are also of interest in certain methods described herein. Expression of these markers confers a proliferation and / or survival defect on cells expressing the marker relative to cells that do not express the marker or express it at a significantly lower level (or, considered another way, cells that do not express the marker have a proliferation and / or survival advantage relative to cells expressing the marker). Thus, when maintained under selective conditions for a sufficient time, cells expressing the marker can be substantially or completely eliminated from the cell population.
[0214] As used herein, "feeder cells" or "feeder layer" is a term describing the co-culture of one type of cell with a second type of cell to provide an environment in which the second type of cell can grow, expand, or differentiate, because the feeder cells provide stimuli, growth factors, and nutrients for supporting the second cell type. The feeder cells are optionally from a different species than the cells they support. For example, certain types of human cells, including stem cells, can be supported by primary cultures of mouse embryonic fibroblasts or immortalized mouse embryonic fibroblasts. In another example, peripheral blood-derived cells or transformed leukemia cells support the expansion and maturation of natural killer cells. When co-cultured with other cells, the feeder cells can typically be inactivated by irradiation or treatment with a mitotic inhibitor such as mitomycin to prevent them from growing beyond the cells they support. Feeder cells can include endothelial cells, stromal cells (e.g., epithelial cells or fibroblasts), and leukemia cells. Without limiting the foregoing, one particular type of feeder cell can be a human feeder layer, such as human skin fibroblasts. Another type of feeder cell can be mouse embryonic fibroblasts (MEF). Generally, various feeder cells can be used in part to maintain pluripotency, direct differentiation into a certain lineage, enhance proliferative capacity, and promote maturation into specialized cell types, such as effector cells.
[0215] As used herein, a "feeder-free" (FF) environment refers to an environment such as a culture condition, cell culture, or culture medium that is substantially free of feeder or stromal cells and / or not pre-conditioned by culturing feeder cells. A "pre-conditioned" culture medium refers to a culture medium harvested after culturing feeder cells in the culture medium for a period of time (such as at least one day). The pre-conditioned culture medium contains many mediator substances, including growth factors and cytokines secreted by the feeder cells cultured in the culture medium. In some embodiments, the feeder-free environment is free of both feeder and stromal cells and is also not pre-conditioned by culturing feeder cells.
[0216] The term "pluripotency-related gene" refers to a gene whose expression occurs in pluripotent stem cells under normal conditions (e.g., in the absence of genetic engineering or other manipulations designed to alter gene expression) and is typically limited to pluripotent stem cells and is essential for its functional identity. It should be understood that the polypeptide encoded by a gene related to pluripotent function may be present as a maternal factor in the oocyte. The gene may be expressed by at least some cells of the embryo, e.g., during at least a part of the entire pre-implantation period and / or in the germ cell precursors of the adult.
[0217] The term "pluripotency factor" is used to refer to the expression product of a pluripotency-related gene, e.g., a polypeptide encoded by the gene. In some embodiments, the pluripotency factor is a factor that is generally not substantially expressed in the somatic cell types that make up the body of an adult animal (except for germ cells or their precursors). For example, the pluripotency factor may be a factor whose average level in ES cells is at least 50-fold or 100-fold higher than its average level in those terminally differentiated cell types present in an adult mammalian body. In some embodiments, the pluripotency factor is a factor necessary to maintain the viability or pluripotent state of ES cells in vivo and / or ES cells derived using conventional methods. Thus, if the gene encoding the factor is knocked out or inhibited (i.e., its expression is eliminated or significantly reduced), the ES cells will not form, will die, or in some embodiments will not differentiate. In some embodiments, inhibiting the expression of a gene whose function is related to pluripotency in ES cells (resulting in, for example, a reduction of at least 50%, 60%, 70%, 80%, 90%, 95% or more in the average steady-state level of the RNA transcript and / or protein encoded by the gene) produces living cells that are no longer pluripotent. In some embodiments, the gene is characterized by a decrease in its expression in ES cells when the cells differentiate into terminally differentiated cells (resulting in, for example, a reduction of at least 50%, 60%, 70%, 80%, 90%, 95% or more in the average steady-state level of the RNA transcript and / or protein encoded by the gene).
[0218] As used herein, "pluripotency-inducing gene" refers to a gene whose expression contributes to reprogramming somatic cells into a pluripotent state. A "pluripotency-inducing factor" refers to the expression product of a pluripotency-inducing gene. A pluripotency-inducing factor may or may not be a pluripotency factor. The expression of an exogenously introduced pluripotency-inducing factor can be transient, i.e., it may be required during at least part of the reprogramming to induce pluripotency and / or establish a stable pluripotent state, but is not required thereafter to maintain pluripotency. For example, the factor can induce the expression of endogenous genes whose functions are related to pluripotency. These genes can then maintain the reprogrammed cells in a pluripotent state.
[0219] "Polypeptide" refers to a polymer of amino acids. The terms "protein" and "polypeptide" are used interchangeably herein. A peptide is a relatively short polypeptide, typically having a length between about 2 and 60 amino acids. Polypeptides used herein generally contain the most common amino acids found in proteins, such as 20 L-amino acids. However, other amino acids and / or amino acid analogs known in the art can be used. One or more amino acids in a polypeptide can be modified, e.g., by addition of chemical entities such as carbohydrate groups, phosphate groups, fatty acid groups, linkers for conjugation, functionalization, etc. A polypeptide having a non-polypeptide moiety covalently or non-covalently bound thereto is still considered a "polypeptide". Exemplary modifications include glycosylation and palmitoylation. Polypeptides can be purified from natural sources, produced using recombinant DNA techniques, or synthesized by chemical methods such as conventional solid-phase peptide synthesis. As used herein, the term "polypeptide sequence" or "amino acid sequence" can refer to the polypeptide material itself and / or the sequence information that biochemically characterizes the polypeptide (i.e., the sequence of letters or three-letter codes used as abbreviations for amino acids). Unless otherwise specified, polypeptide sequences provided herein are given in the N-terminal to C-terminal direction.
[0220] 7.5 Genetic Modification
[0221] A list of abbreviations used in this disclosure is provided in Table 1 below.
[0222] 7.5.1 Modifying Genomic DNA Sequences
[0223]
[0224]
[0225] 7.5.1 RNAi Technology and Transcriptional Repression
[0226] Cells for use in the methods of this disclosure can be from all cells and tissues, particularly mammalian cells and tissues. Suitable cells can be of human, ape, monkey, pig, or rodent origin, and can be primary cells or cultured cells. In some embodiments, the cells modified using the methods of this disclosure are human cells.
[0227] It should be noted that all cell types are considered in this article, and preferred cell types include immune cells, such as T cells, natural killer (NK) cells, and B cells, as well as induced pluripotent stem cells (iPSCs). Other suitable cells include bone marrow stem cells and adult progenitor stem cells. In some embodiments, the cells modified using the methods of the present disclosure are T cells. In some embodiments, the cells modified using the methods of the present disclosure are NK cells. In some embodiments, the cells modified using the methods of the present disclosure are iPSCs. In some embodiments, the cells modified using the methods of the present disclosure are hematopoietic stem cells (HSCs).
[0228] In some embodiments, the cells modified using the methods of the present disclosure are α-β T cells. In some embodiments, the T cells modified using the low immunogenicity engineering methods of the present disclosure are γ-δ T cells. In some embodiments, the T cells include CD8 + T cells and / or CD4 + T cells.
[0229] 7.6 Cell Populations
[0230] In some embodiments, the cells used in the methods of the present disclosure are derived from a donor. The cells can be allogeneic or non-autologous ("non-self") relative to the recipient to whom the cells are administered. In some embodiments, the cells are obtained from a mammalian subject. In other embodiments, the cells are obtained from a primate subject. In some embodiments, the cells are obtained from a human subject.
[0231] In some embodiments, the cells used in the methods of the present disclosure are lymphocytes (e.g., T cells, NK cells). Lymphocytes can be obtained from sources such as, but not limited to, peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infected site, ascites, pleural effusion, spleen tissue, and tumors. Lymphocytes can also be generated by the differentiation of stem cells. In some embodiments, lymphocytes can be obtained from the blood collected from a subject using techniques commonly known to those of ordinary skill in the art (such as sedimentation, e.g., FICOLL TM separation).
[0232] Cells from the circulating blood of a subject can be obtained by apheresis. Apheresis devices typically contain lymphocytes (including T cells), monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis can be washed to remove the plasma portion and placed in an appropriate buffer or medium for subsequent processing. The cells can be washed with PBS or with another suitable solution lacking calcium, magnesium, and most, if not all, divalent cations. The washing step can be accomplished by methods known to those skilled in the art, such as, but not limited to, using a semi-automated flow centrifuge (e.g., the Cobe 2991 cell processor or the Baxter CytoMate). After washing, the cells can be resuspended in a variety of biocompatible buffers, cell culture media, or other buffered or unbuffered saline solutions.
[0233] T cells can be isolated from PBMCs by lysing red blood cells and removing monocytes. As an example, T cells can be sorted by centrifugation through a PERCOLL TM gradient. In some embodiments, after isolation of PBMCs, both cytotoxic T lymphocytes and helper T lymphocytes can be sorted into naive T cell subsets, memory T cell subsets, and effector T cell subsets, either before or after activation, expansion, and / or genetic modification.
[0234] In some embodiments, T lymphocytes can be enriched. For example, positive or negative selection techniques can be used to enrich specific subsets of T lymphocytes that express one or more markers, such as, but not limited to, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD27, CD28, CD34, CD36, CD45RA, CD45RO, CD56, CD62, CD62L, CD122, CD123, CD127, CD235a, CCR7, HLA-DR, or combinations thereof.
[0235] In some embodiments, immune cells (e.g., T cells, NK cells) can also be differentiated from stem cells, such as umbilical cord blood stem cells, progenitor cells, bone marrow stem cells, hematopoietic stem cells (HSCs), and induced pluripotent stem cells (iPSCs).
[0236] 7.7 Compositions
[0237] The present inventors particularly provide in this article hypoimmunogenic methods, such as bioengineering methodologies and materials, including hypoimmunogenic (such as engineered hypoimmunogenic) methodologies and materials that can be used to, for example, genetically modify and / or otherwise alter at least one target gene or gene product, methods for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), the manufacture of hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell systems (such as engineered hypoimmunogenic cell systems), and their uses. In one aspect, hypoimmunogenic (such as engineered hypoimmunogenic) methods are provided herein.
[0238] In some embodiments, the immunogenic cells are rodent, porcine, simian, primate, ape, or human immunogenic cells. In some embodiments, the immunogenic cells are immunogenic human cells.
[0239] In some embodiments, the method includes genetically modifying (e.g., as disclosed in Section 7.5) at least one human cell or at least one target gene of the cell (e.g., regulatory factor X (RFX) gene, B2M gene, CD58 gene, CIITA gene, TNFRSF14 gene, TNFRSF1A gene, TNFRSF1B gene, ICAM1 gene). In some embodiments, genetically modifying the at least one target gene reduces the expression of the protein encoded by the at least one target gene in the human cell or the cell. In some embodiments, genetically modifying the at least one target gene produces cells or human cells with hypoimmunogenicity.
[0240] In some embodiments, the method further includes placing the genetically modified human cell or the genetically modified cell in the immune system and determining the immunogenicity of the genetically modified human cell or the genetically modified cell, wherein the immunogenicity is altered compared to the human cell or the cell in which the at least one gene is not genetically modified.
[0241] In some embodiments, the method further includes placing the genetically modified cell or the genetically modified human cell in the immune system and determining the immunogenicity of the genetically modified cell or the genetically modified human cell, wherein the immunogenicity is altered compared to the unmodified cell or the unmodified human cell, and the only difference between the genetically modified cell or such genetically modified human cell and the unmodified cell or the unmodified human cell is that the at least one gene is not genetically modified in the cell or the human cell.
[0242] In some embodiments, the method further includes administering hypoimmunogenic cells, such as engineered hypoimmunogenic cells, to a subject.
[0243] In some embodiments, the method further comprises forming at least one embryoid body or multicellular body from genetically modified human cells or genetically modified cells to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), subjecting the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) to the immune system, and determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered as compared to an unmodified human cell or unmodified cell in which the at least one target gene is not genetically modified.
[0244] In some embodiments, the method further comprises forming at least one embryoid body or multicellular body from genetically modified cells or genetically modified human cells to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), subjecting the genetically modified cell or the genetically modified human cell to the immune system, and determining the immunogenicity of the genetically modified cell or the genetically modified human cell, wherein the immunogenicity is altered as compared to an unmodified cell or unmodified human cell, wherein the only difference between the genetically modified cell (such as a genetically modified human cell) and the unmodified cell or the unmodified human cell is that the at least one gene is not genetically modified in the unmodified cell or the unmodified human cell.
[0245] In some embodiments, prior to exposure to the immune system for immunogenicity testing, the embryoid bodies are made into a single cell suspension. Embryoid bodies can be prepared by any method known to those of ordinary skill in the art, such as the methods disclosed in Pettinato et al., “Engineering Strategies for the Formation of Embryoid Bodies from Human Pluripotent Stem Cells”, Stem Cells and Development, Vol. 24, No. 14, 2015. Non-limiting exemplary methods include suspension culture (e.g., bacteriological dish culture or methylcellulose culture), hanging drop culture, conical tube culture, round bottom 96-well plate culture (including low-adhesion multi-well plates), rotating bioreactor culture, slow rotating lateral vessel, and microscale gel culture.
[0246] In some embodiments, the method further comprises introducing a chimeric antigen receptor (CAR) into the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or iPS human cell, optionally into endogenous target genes such as RFX, CD58, CIITA, and / or B2M.
[0247] In some embodiments, the method further comprises introducing the CAR into a hypoimmunogenic cell as described herein (such as an engineered hypoimmunogenic cell) or an iPS human cell such that the CAR is expressed on the surface of the cell (such as an engineered hypoimmunogenic cell) or iPS human cell and is detectable by flow cytometry. In some embodiments, the method further comprises using a gRNA to knock a transgene containing a promoter and the CAR into a target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene), resulting in the expression of the CAR on the surface of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or iPS human cell that is detectable by flow cytometry.
[0248] In some embodiments, the method further comprises knocking out one or more target genes in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or an iPS human cell or iPS cell, for example via a gRNA, optionally while knocking a transgene containing a promoter and the CAR into the target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene). In some embodiments, the method further comprises introducing a CAR and target gene miR-shRNA dual expression system as described herein, which enables the expression of the CAR and the knockdown of an endogenous target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) from a single vector such that the CAR is detectable by flow cytometry on the surface of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or iPS human cell or iPS cell. In some embodiments, the gRNA targets RFX5 and is used to knock in a miR-adapted shRNA targeting CD58. In some embodiments, the miRNA comprises a sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0249] In some embodiments, the method further comprises knocking out one or more target genes in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via shRNA. In some embodiments, the shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66 or 67. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 63 or 64.
[0250] In some embodiments, the human cell is an immunogenic human cell. In some embodiments, the human cell is an induced pluripotent stem (iPS) human cell reprogrammed from an immunogenic human cell.
[0251] In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is a T cell. In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is a T effector cell. In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is not a T regulatory cell. In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) does not have C45RA + CD27 - CD28 - CCR7 - CD62L - phenotype. In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is not a natural killer cell. In some embodiments, the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is a hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell).
[0252] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell does not contain a genetically modified, such as disrupted or knocked out: a) CISH (cytokine-inducible SH2-containing protein) gene; b) adenosine A2A (ADORA2A) gene; c) TGFβ receptor gene; d) HLA class I gene, e.g., HLA A, B, C, E, F, G; e) HLA class II gene; f) NLRC5 (NOD-like receptor family CARD domain-containing 5) gene; g) CD38 gene; h) thioredoxin-interacting protein (TXNIP) gene; i) ITGB3 (integrin subunit beta 3) gene; j) IL17A gene; k) DGKA (diacylglycerol kinase alpha) gene; l) DGKZ (diacylglycerol kinase zeta) gene; m) PD1 gene; n) TRGC1 (T cell receptor gamma constant region 1) gene; o) TRGC1 (T cell receptor gamma constant region 2) gene; and / or p) TRDC (T cell receptor delta constant region) gene.
[0253] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell is not TCR-deficient, e.g., not TCRα, β, γ, and / or δ-deficient. For example, in certain embodiments, the TCR locus (e.g., the TCRα, β, γ, or δ locus) is not disrupted or knocked out, e.g., does not contain an insertion (e.g., a CAR insertion).
[0254] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell does not contain: a) an exogenous NICD (Notch intracellular domain) coding sequence, such as a NICD1 coding sequence; c) an exogenous CD47 coding sequence or increased CD47 expression relative to wild-type (non-engineered) iPS human cells; d) an exogenous sequence encoding a cell surface protein that binds to the surface of phagocytic or lytic immune cells, wherein said binding causes activation of a low immunogenicity cell (such as an engineered low immunogenicity cell) such as a T cell; e) an exogenous CR1 coding sequence; f) an exogenous CD24 coding sequence; g) an exogenous DUX4 (double homeobox 4) coding sequence; h) an exogenous nucleotide sequence operably linked to a promoter derived from the human FOXP3 gene; i) an exogenous CD3 complex cell surface coding sequence or increased CD3 complex cell surface gene expression relative to wild-type (non-engineered) iPS human cells; j) an exogenous NKG2C (natural killer group 2, member C) coding sequence or increased NKG2C expression relative to wild-type (non-engineered) iPS human cells; k) an exogenous NKG2D (natural killer group 2, member D) coding sequence or increased NKG2D expression relative to wild-type (non-engineered) iPS human cells; l) an exogenous PD-L1 coding sequence or increased PD-L1 expression relative to wild-type (non-engineered) iPS human cells; m) an exogenous CTLA-4 coding sequence or increased CTLA-4 expression relative to wild-type (non-engineered) iPS human cells; n) an exogenous CD16 coding sequence or increased CD16 expression relative to wild-type (non-engineered) iPS human cells; o) an exogenous HLA-A coding sequence; p) an exogenous HLA-B coding sequence; q) an exogenous HLA-C coding sequence; r) an exogenous HLA-D coding sequence; s) an exogenous HLA-E coding sequence; t) an exogenous HLA-F coding sequence; u) an exogenous HLA-G coding sequence; v) an exogenous C1-inhibitor coding sequence; x) an exogenous IL35 coding sequence; and / or y) an IL15 / IL15 receptor α (IL15Ra) fusion protein, such as an IL15 / IL15Ra fusion protein, wherein the IL15Ra portion lacks an intracellular domain.
[0255] In some embodiments, low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells contain a CAR knocked into an endogenous target gene, such as one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene. In some embodiments, low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells contain a transgene comprising a promoter and a CAR that has been knocked into one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, resulting in the expression of the CAR on the cell surface such that the CAR can be detected by flow cytometry. In some embodiments, the transgene can be knocked in using a gRNA as described herein.
[0256] In some embodiments, low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells or iPS cells contain a knockout of an endogenous target gene, i.e., a knockout of one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, and a knock-in of a CAR. In some embodiments, the CAR knock-in and target gene knockout are accomplished by introducing a CAR and target gene miR-shRNA dual expression system as described herein, which enables the expression of the CAR and the knockdown of the endogenous target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) from a single vector. In some embodiments, the gRNA targets RFX5 and is used to knock in a miR-adapted shRNA targeting CD58. In some embodiments, the miRNA comprises a sequence shown in SEQ ID NO:74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0257] In some embodiments, the method further comprises knocking out one or more target genes in low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells or iPS cells, for example via shRNA. In some embodiments, the shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO:60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO:60, 63, or 64.
[0258] Remington
[0259] In some embodiments, the target gene is the regulatory factor X (RFX) gene. In some embodiments, genetically modifying the RFX gene abolishes or reduces RFX protein expression.
[0260] Regulatory factor X (also known as RFX) refers to a member of the regulatory factor X (RFX) family of transcription factors. Human RFX proteins are encoded by the RFX gene. Members of the RFX gene family include, but are not limited to, RFX5, RFXANK, and RFXAP. Human regulatory factor X5 or RFX5 is encoded by the RFX5 gene (e.g., NCBI Entrez gene: 5993). The protein containing human regulatory factor X-associated ankyrin or RFXANK is encoded by the RFXANK gene (e.g., NCBI Entrez gene: 8625). Human regulatory factor X-associated protein or RFXAP is encoded by the RFXAP gene (e.g., NCBI Entrez gene: 5994). In some embodiments, the methods disclosed herein include genetically modifying an RFX selected from the group consisting of RFX5, RFXANK, and RFXAP.
[0261] In some embodiments, the present disclosure provides methods comprising genetically modifying the regulatory factor X (RFX) gene of at least one human cell or at least one cell. In some embodiments, genetically modifying the RFX gene reduces the expression of RFX protein in the human cell or cell. In some embodiments, genetically modifying the RFX gene produces cells with low immunogenicity. In some embodiments, the method further comprises placing the genetically modified human cell or the genetically modified cell in an immune system and determining the immunogenicity of the genetically modified human cell or the genetically modified cell, wherein the immunogenicity is altered compared to the human cell or cell in which the at least one gene is unmodified. In some embodiments, the only difference between the genetically modified human cell or the genetically modified cell and the human cell or cell in which the at least one gene is unmodified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are unmodified in the unmodified human cell or unmodified cell.
[0262] In some embodiments, the method further comprises forming at least one embryoid body or multicellular body from genetically modified human cells or genetically modified cells to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), placing the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) in the immune system, and determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to human cells or cells in which the RFX gene is not genetically modified. In some embodiments, the only difference between the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) and the human cells or cells in which at least one of the genes is not genetically modified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are not genetically modified in the unmodified human cells or unmodified cells.
[0263] In some embodiments, the method further comprises genetically modifying at least one of the B2M gene, the CD58 gene, the CIITA gene (e.g., genetically modifying the RFX gene and the B2M gene, genetically modifying the RFX gene and the CD58 gene, genetically modifying the RFX gene and the CIITA gene). In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.
[0264] In some embodiments, the target gene is the B2M gene. In some embodiments, genetically modifying the B2M gene eliminates or reduces B2M protein expression.
[0265] The terms "beta-2 microglobulin", "B2M", or "β2m" refer to the beta chain component of the MHC class I molecule. Human beta-2 microglobulin is encoded by the B2M gene (e.g., NCBI Gene ID 567). Expression of beta-2 microglobulin is required for the assembly and function of MHC class I molecules on the cell surface.
[0266] In some embodiments, the present disclosure provides methods of genetically modifying the B2M gene in at least one human cell or at least one cell. In some embodiments, genetically modifying the B2M gene reduces the expression of B2M protein in the human cell or cell. In some embodiments, genetically modifying the B2M gene produces cells with low immunogenicity. In some embodiments, the method further comprises placing the genetically modified human cell or genetically modified cell in an immune system and determining the immunogenicity of the genetically modified human cell or genetically modified cell, wherein the immunogenicity is altered as compared to a human cell or cell in which the at least one gene is unmodified. In some embodiments, the only difference between the genetically modified human cell or genetically modified cell and the human cell or cell in which the at least one gene is unmodified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are unmodified in the unmodified human cell or unmodified cell.
[0267] In some embodiments, the method further comprises forming at least one embryoid body or multicellular body from the genetically modified human cell or genetically modified cell to produce at least one low immunogenic cell (such as an engineered low immunogenic cell), placing the low immunogenic cell (such as an engineered low immunogenic cell) in an immune system, and determining the immunogenicity of the low immunogenic cell, wherein the immunogenicity is altered as compared to a human cell or cell in which the B2M gene is unmodified. In some embodiments, the only difference between the low immunogenic cell (such as an engineered low immunogenic cell) and the human cell or cell in which the at least one gene is unmodified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are unmodified in the unmodified human cell or unmodified cell.
[0268] In some embodiments, the method further comprises genetically modifying at least one of the RFX gene, CD58 gene, and CIITA gene (e.g., genetically modifying the RFX gene and B2M gene, genetically modifying the B2M gene and CD58 gene, genetically modifying the B2M gene and CIITA gene). In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, TNFRSF1A (also known as TNFR1) gene, TNFRSF1B (also known as TNFR2) gene, and ICAM1 gene.
[0269] In some embodiments, the target gene is the CD58 gene. In some embodiments, genetically modifying the CD58 gene eliminates or reduces CD58 protein expression.
[0270] As used herein, the term "CD58" or "LFA-3" refers to the ligand of the T lymphocyte CD2 protein and plays a role in the adhesion and activation of T lymphocytes. Human CD58 is encoded by the CD58 gene (e.g., NCBI Entrez Gene: 965). Cd2 (the CD58 receptor) is known to be important for monocyte and dendritic cell function (see, e.g., Crawford et al., J Immunol, 1999 Dec 1; 163(11):5920-8. and Crawford et al., Blood. 2003 Sep 1; 102(5):1745-52.).
[0271] In some embodiments, the present disclosure provides methods of genetically modifying the CD58 gene of at least one human cell or at least one cell. In some embodiments, genetically modifying the CD58 gene reduces the expression of the CD58 protein in the human cell or cell. In some embodiments, genetically modifying the CD58 gene produces cells with low immunogenicity. In some embodiments, the method further comprises placing the genetically modified human cell or genetically modified cell in an immune system and determining the immunogenicity of the genetically modified human cell or cell, wherein the immunogenicity is altered compared to a human cell or cell in which the at least one gene is unmodified. In some embodiments, the only difference between the genetically modified human cell or genetically modified cell and the human cell or cell in which the at least one gene is unmodified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are unmodified in the unmodified human cell or unmodified cell.
[0272] In some embodiments, the method further comprises forming at least one embryoid body or multicellular body from the genetically modified human cell or genetically modified cell to produce at least one low immunogenicity cell (such as an engineered low immunogenicity cell), placing the low immunogenicity cell (such as an engineered low immunogenicity cell) in an immune system, and determining the immunogenicity of the low immunogenicity cell (such as an engineered low immunogenicity cell), wherein the immunogenicity is altered compared to a human cell in which the CD58 gene is unmodified. In some embodiments, the only difference between the low immunogenicity cell (such as an engineered low immunogenicity cell) and the human cell or cell in which the at least one gene is unmodified is that one or more of the RFX gene and / or B2M gene and / or CD58 gene and / or CIITA gene are unmodified in the unmodified human cell or unmodified cell.
[0273] In some embodiments, the method further comprises genetically modifying at least one gene of the RFX gene, the B2M gene, and the CIITA gene (e.g., genetically modifying the CD58 gene and the B2M gene, genetically modifying the CD58 gene and the RFX gene, genetically modifying the CD58 gene and the CIITA gene). In some embodiments, the method further comprises genetically modifying at least one gene of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.
[0274] In some embodiments, in addition to at least one gene of these target genes (e.g., the RFX gene, the B2M gene, and / or the CD58 gene), the methods disclosed herein further comprise genetically modifying the CIITA gene. In some embodiments, genetically modifying the CIITA gene eliminates or reduces CIITA protein expression. In some embodiments, the method further comprises genetically modifying at least one gene of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.
[0275] As used herein, the term "class II major histocompatibility complex transactivator" or "CIITA" refers to the CIITA protein that is essential for the transcriptional activity of the HLA class II promoter. Human CIITA is encoded by the CIITA gene (e.g., NCBI Entrez Gene: 4261). Mutations in the CIITA gene are associated with bare lymphocyte syndrome type II (also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency).
[0276] Pharmaceutical Sciences
[0277] In some embodiments, the immunogenic cell is a rodent, porcine, primate, monkey, ape, or human immunogenic cell. In some embodiments, the immunogenic cell is an immunogenic human cell.
[0278] In some embodiments, the immunogenic cell is an allogeneic or non-MHC that matches the cells, receptors, or polypeptides of the immune system to which the engineered hypoimmunogenic cell is administered or placed.
[0279] In some embodiments, the immunogenic human cell is an allogeneic or non-HLA that matches the cells, receptors, or polypeptides of the immune system to which the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is administered or placed.
[0280] In some embodiments, the immunogenic cell triggers and / or provides an immune response. In one aspect, the immunogenic cell provides an innate immune response, a specific or adaptive immune response, or a combination thereof. In another aspect of the invention, the immunogenic cell is an allogeneic or non-HLA that is matched to the cell, receptor, or polypeptide of the immune system that it triggers or provides to. In some embodiments, the immune system is an in vitro immune system. In some embodiments, the immune system is an in vivo immune system. In some embodiments, the immune system is the in vivo immune system of a human subject.
[0281] In some embodiments, the immunogenic cell or the immunogenic human cell is a non-immune effector cell. In some embodiments, the immunogenic cell or the immunogenic human cell is an immune effector cell.
[0282] An "immune effector cell" is an immune cell that can perform immune effector functions. In some embodiments, the immune effector cell expresses at least FcγRIII and performs ADCC effector functions. Examples of immune effector cells that mediate ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, cytotoxic T cells, neutrophils, and eosinophils.
[0283] In some embodiments, the immune effector cell is a T cell. In some embodiments, the T cell is CD4 + / CD8 - 、CD4 - / CD8 + 、CD4 + / CD8 + 、CD4 - / CD8 - or a combination thereof. In some embodiments, the T cell produces IL-2, TFN, and / or TNF upon binding to a target cell. In some embodiments, the CD8 + T cell lyses antigen-specific target cells upon binding to the target cell.
[0284] In some embodiments, the immune effector cell is an NK cell. In other embodiments, the immune effector cell can be an established cell line, such as the NK-92 cell.
[0285] In some embodiments, the immune effector cell is differentiated from stem cells (such as hematopoietic stem cells, pluripotent stem cells, iPS, or embryonic stem cells).
[0286] The Merck Index
[0287] In some embodiments, the cell is an induced pluripotent stem (iPS) cell. In some embodiments, the iPS cell is reprogrammed from an immunogenic cell (e.g., an immunogenic cell disclosed herein).
[0288] In some embodiments, the human cell is an induced pluripotent stem (iPS) human cell. In some embodiments, the iPS human cell is reprogrammed from an immunogenic human cell (e.g., an immunogenic human cell disclosed herein).
[0289] Any suitable method known in the art can be used to reprogram an immunogenic cell into an iPS cell or an immunogenic human cell into an iPS cell. In some embodiments, the iPS cell or iPS human cell is generated by the methods disclosed in WO2021 / 257679 (PCT / US2021 / 037594) or US2021 / 0395697, each of these patents is incorporated herein by reference in its entirety.
[0290] In some embodiments, the iPS cell or iPS human cell is reprogrammed from an immunogenic human cell comprising a heterodimeric T cell receptor containing a gamma chain and a delta chain. In some embodiments, the iPS cell or iPS human cell is reprogrammed from a gamma-delta T cell. In some embodiments, the iPS cell or iPS human cell has rearranged genes at the TRG and TRD loci. In some embodiments, the iPS cell or iPS human cell does not produce PCR products from the TCRG and TCRD loci.
[0291] In some embodiments, the iPS cell or iPS human cell does not originate from an alpha-beta T cell. In some embodiments, the iPS cell or iPS human cell does not have rearranged genes at the TRA and TRB loci. In some embodiments, the iPS cell or iPS human cell does not produce PCR products from the TCRA and TCRB loci.
[0292] In some embodiments, the iPS cell or iPS human cell is negative for Sendai virus (SeV) vector.
[0293] In some embodiments, the iPS cell or iPS human cell is genomically stable without chromosomal loss. In some embodiments, the genomic stability of the iPS cell or iPS human cell is determined by chromosomal karyotyping.
[0294] In some embodiments, the iPS cell or iPS human cell is capable of growing and maintaining in feeder-free medium after adoptive transfer.
[0295] In some embodiments, the iPS cells or iPS human cells express one or more reprogramming factors and comprise a nucleotide sequence encoding a rearrangement of the TRG and TRD genes. In some embodiments, these reprogramming factors are selected from the group consisting of Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28. In some embodiments, these reprogramming factors comprise Oct3 / 4, Sox2, Klf4, and c-Myc. In some embodiments, these reprogramming factors are Oct3 / 4, Sox2, KLF4, c-Myc, and Lin28. In some embodiments, these reprogramming factors are Oct3 / 4, Sox2, Klf4, and c-Myc.
[0296] In some embodiments, the iPS cells or iPS human cells are pluripotent cells that express one or more reprogramming factors, wherein (i) the pluripotent cells comprise a nucleotide sequence encoding a rearrangement of the TRG and TRD genes or have rearranged genes at the TRG and TRD loci, (ii) these reprogramming factors are selected from the group consisting of Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28, (iii) the iPS cells or iPS human cells are negative for Sendai virus (SeV) vectors; (iv) the iPS cells or iPS human cells are reprogrammed from γδ T cells but not from αβ T cells; (v) the iPS cells or iPS human cells do not produce PCR products from the TCRA and TCRB loci; (vi) the iPS cells or iPS human cells are genomically stable and do not have chromosomal losses, e.g., as determined by chromosomal karyotyping; and / or (vii) the iPS cells or iPS human cells are capable of growing and maintaining in feeder-free medium after adoptive transfer.
[0297] Methods for identifying reprogrammed mammalian somatic cells having a low differentiation state or pluripotent state are known in the art. For example, in some embodiments, reprogrammed somatic cells are identified by selecting cells that express an appropriate selectable marker. In some embodiments, the pluripotency characteristics of the reprogrammed somatic cells are further evaluated. The presence of pluripotency characteristics indicates that the somatic cells have been reprogrammed to a pluripotent state.
[0298] The differentiation state of a cell is a continuous spectrum, with terminal differentiation at one end and dedifferentiation (pluripotent state) at the other end. As used herein, reprogramming refers to the process of altering or reversing the differentiation state of a somatic cell, which can be partially differentiated or terminally differentiated. Reprogramming includes both complete and partial reversal of the somatic cell differentiation state. In other words, as used herein, the term "reprogramming" includes any movement of a cell's differentiation state along the spectrum towards a less differentiated state. For example, reprogramming includes reversing a pluripotent cell back to a pluripotent cell, reversing a terminally differentiated cell back to a pluripotent or pluripotent cell. In some embodiments, reprogramming of a somatic cell results in the somatic cell being converted all the way back to a pluripotent state. In some embodiments, reprogramming of a somatic cell results in the somatic cell being converted back to a pluripotent state. Thus, as used herein, the term "less differentiated state" is a relative term and includes both fully dedifferentiated and partially differentiated states.
[0299] The term "pluripotency characteristics" refers to a number of characteristics associated with pluripotency, including, for example, the ability to differentiate into all cell types and the unique expression pattern of pluripotent cells, including the expression of pluripotency genes, the expression of other ES cell markers, and the unique expression profile referred to as the "stem cell molecular signature" or "stemness" at the global level.
[0300] Thus, to assess the pluripotency characteristics of reprogrammed somatic cells, various growth characteristics and ES cell-like morphology of these cells can be analyzed. In some embodiments, the cells can be injected subcutaneously into immunodeficient SCID mice to induce teratomas (a standard assay for ES cells). ES-like cells can differentiate into embryoid bodies (another ES-specific characteristic). In addition, ES-like cells can be differentiated in vitro by adding certain growth factors known to drive differentiation into specific cell types. The ability to self-renew, as marked by induction of telomerase activity, is another pluripotency characteristic that can be monitored.
[0301] In some embodiments, a functional assay of reprogrammed somatic cells can be performed by introducing them into blastocysts to determine whether the cells are capable of generating all cell types. If the reprogrammed cells are able to form several cell types of the body, they are pluripotent; if the reprogrammed cells are able to form all cell types of the body, including germ cells, they are pluripotent.
[0302] In other embodiments, the expression of individual pluripotency genes in reprogrammed somatic cells can be examined to assess their pluripotency characteristics.
[0303] In addition, the expression of other ES cell markers can be evaluated. Stage-specific embryonic antigen-1, -3, and -4 (SSEA-1, SSEA-3, SSEA-4) are glycoproteins that are specifically expressed during early embryonic development and are markers of ES cells (Solter and Knowles, 1978, Proc. Natl. Acad. Sci. USA 75:5565-5569; Kannagi et al., 1983, EMBO J 2:2355-2361).
[0304] Elevated alkaline phosphatase (AP) expression is another marker associated with undifferentiated embryonic stem cells (Wobus et al., 1984, Exp. Cell 152:212-219; Pease et al., 1990, Dev. Biol. 141:322-352). Other stem cell / progenitor cell markers include intermediate neurofilament nestin (Lendahl et al., 1990, Cell 60:585-595; Dah-Istrand et al., 1992, J. Cell Sci. 103:589-597), the membrane glycoprotein prominin / AC133 (Weigmann et al., 1997, Proc. Natl. Acad. USA 94:12425-12430; Corbeil et al., 1998, Blood 91:2625-22626), the transcription factor Tcf-4 (Korinek et al., 1998, Nat. Genet. 19:379-383; Lee et al., 1999, J. Biol. Chem. 274.1566-1572), and the transcription factor Cdx1 (Duprey et al., 1988, Genes Dev. 2:1647-1654; Subramania'n et al., 1998, Differentiation 64:11-18).
[0305] In some embodiments, the expression profile of reprogrammed somatic cells can be used to evaluate their pluripotency characteristics. Pluripotent cells (such as embryonic stem cells) and multipotent cells (such as adult stem cells) are known to have unique global gene expression profile patterns. This unique pattern is referred to as the "stem cell molecular signature" or "stemness." See, for example, Ramalho-Santos et al., Science 298:597-600 (2002); Ivanova et al., Science 298:601-604.
[0306] Somatic cells can be reprogrammed to acquire a full set of pluripotency characteristics and are thus pluripotent. Alternatively, somatic cells can be reprogrammed to acquire only a subset of pluripotency characteristics. In another alternative, somatic cells can be reprogrammed to be multipotent.
[0307] 8. Embodiments
[0308] In some embodiments, the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is determined by exposing the cell to the immune system. In some embodiments, the immunogenicity is altered as compared to a human cell (e.g., an immunogenic cell or an iPS human cell) or a cell in which at least one target gene is not genetically modified. In some embodiments, the only difference between the genetically modified human cell or the genetically modified cell and the unmodified human cell or the unmodified cell is that the at least one target gene is not genetically modified in the unmodified human cell or the unmodified cell.
[0309] In some embodiments, a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is administered to an allogeneic or non-MHC-matched subject. In some embodiments, a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is administered to an allogeneic or non-HLA-matched subject.
[0310] In some embodiments, altering the immunogenicity comprises balancing, reducing, or neutralizing the immunogenicity (such as reducing or neutralizing the immunogenicity) or the immune response as compared to an unmodified cell or population of unmodified cells (e.g., as compared to an immunogenic human cell or an iPS human cell in which the at least one target gene is not genetically modified). In some embodiments, the only difference between the genetically modified cell or population of genetically modified cells and the unmodified cell or population of unmodified cells is that the at least one target gene is not genetically modified in the unmodified cell or population of unmodified cells (e.g., as compared to an immunogenic cell or an iPS cell in which the at least one target gene is not genetically modified).
[0311] In some embodiments, the reduced immunogenicity of a low-immunogenicity cell (such as an engineered low-immunogenicity cell) includes one or more of the following: i) a reduced or ablated myeloid cell response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; ii) a reduced or ablated T cell response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; iii) a reduced or ablated natural killer (NK) cell response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; iv) a reduced or ablated neutralizing antibody response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; v) a reduced or ablated MHC class II-mediated response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; vi) a reduced or ablated neutralizing MHC class I-mediated response when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic or non-MHC-matched subject, as compared to a cell corresponding to a modified but non-genetically modified cell; and vii) a reduced or ablated allogeneic host rejection of the graft when the low-immunogenicity cell (such as an engineered low-immunogenicity cell) is present in an allogeneic subject, as compared to a cell corresponding to a modified but non-genetically modified cell.
[0312] In some embodiments, a population of low-immunogenicity cells (such as engineered low-immunogenicity cells) of the present disclosure has a reduced immunogenicity or immune response of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower), as compared to an unmodified cell population (e.g., as compared to a cell in which the at least one target gene is not genetically modified). In some embodiments, the only difference between the population of low-immunogenicity cells (such as engineered low-immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population (e.g., as compared to a cell in which the at least one target gene is not genetically modified).
[0313] In some embodiments, altering immunogenicity includes reducing or neutralizing myeloid cell responses for hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells having at least one genetically modified target gene). In some embodiments, compared to an unmodified cell population (e.g., compared to cells in which the at least one target gene is not genetically modified), a population of hypoimmunogenic cells of the present disclosure (such as engineered hypoimmunogenic cells) (e.g., cells having at least one genetically modified target gene) has a myeloid cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and an unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population (e.g., cells in which the at least one target gene is not genetically modified).
[0314] In some embodiments, altering immunogenicity includes reducing or neutralizing T cell responses for hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells having at least one genetically modified target gene). In some embodiments, compared to an unmodified cell population (e.g., cells in which the at least one target gene is not genetically modified), a population of hypoimmunogenic cells of the present disclosure (such as engineered hypoimmunogenic cells) (e.g., cells having at least one genetically modified target gene) has a T cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and an unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population (e.g., cells in which the at least one target gene is not genetically modified).
[0315] In some embodiments, altering immunogenicity includes reducing or neutralizing natural killer cell responses against hypoimmunogenic cells, such as engineered hypoimmunogenic cells (e.g., cells having at least one genetically modified target gene). In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of the hypoimmunogenic cells of the present disclosure, such as engineered hypoimmunogenic cells (e.g., cells having at least one genetically modified target gene), has a reduced natural killer cell response of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower). In some embodiments, the only difference between the population of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, and the population of unmodified cells is that the at least one target gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0316] In some embodiments, altering immunogenicity includes reducing or neutralizing antibody responses against hypoimmunogenic cells, such as engineered hypoimmunogenic cells (e.g., cells having at least one genetically modified target gene). In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of the hypoimmunogenic cells of the present disclosure, such as engineered hypoimmunogenic cells (e.g., cells having at least one genetically modified target gene), has a reduced antibody response of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower). In some embodiments, the only difference between the population of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, and the population of unmodified cells is that the at least one target gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0317] In some embodiments, altering immunogenicity includes reducing or neutralizing the allogeneic host rejection of the graft. In some embodiments, compared to an unmodified cell population (e.g., compared to a cell in which the at least one target gene is not genetically modified), a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced allogeneic host rejection of the graft by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population (e.g., a cell in which the at least one target gene is not genetically modified).
[0318] In some embodiments, the method includes genetically modifying the RFX gene. In some embodiments, altering immunogenicity includes reducing or ablating MHC class II-mediated responses for low immunogenicity cells (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene). In some embodiments, compared to an unmodified cell population (e.g., compared to a cell in which the at least one target gene is not genetically modified), a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene) has a reduced MHC class II-mediated response by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the RFX gene is not genetically modified in the unmodified cell population (e.g., a cell in which the at least one target gene is not genetically modified).
[0319] In some embodiments, altering immunogenicity includes reducing or neutralizing MHC class I-mediated responses for hypoimmunogenic cells, such as engineered hypoimmunogenic cells (e.g., cells having a genetically modified RFX gene). In some embodiments, a population of hypoimmunogenic cells of the present disclosure, such as engineered hypoimmunogenic cells, has a reduced MHC class I-mediated response of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower), compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between the population of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, and the population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0320] In some embodiments, the expression of HLA class II molecules (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR) is reduced (e.g., partially or completely) or ablated in the hypoimmunogenic cells of the present disclosure, such as engineered hypoimmunogenic cells (e.g., cells having a genetically modified RFX gene). In some embodiments, HLA class II molecule expression is not detected in the population of genetically modified cells of the present disclosure (e.g., not detected by conventional methods such as FACS). In some embodiments, the expression of HLA class II molecules in the population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower), compared to the expression of HLA class II molecules in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between the population of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, and the population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0321] In some embodiments, the expression of HLA-A, HLA-B, and / or HLA-C is reduced (e.g., partially) in the low immunogenic cells (such as engineered low immunogenic cells) disclosed in the present invention (e.g., cells having a genetically modified RFX gene). In some embodiments, the expression of HLA-A in a population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower) compared to the expression of HLA-A in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between a population of low immunogenic cells (such as engineered low immunogenic cells) and a population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the expression of HLA-B in a population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower) compared to the expression of HLA-B in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between a population of low immunogenic cells (such as engineered low immunogenic cells) and a population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the expression of HLA-C in a population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower) compared to the expression of HLA-C in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between a population of low immunogenic cells (such as engineered low immunogenic cells) and a population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0322] In some embodiments, the expression of HLA-E is reduced (e.g., partially) in the low immunogenic cells (such as engineered low immunogenic cells) (e.g., cells having a genetically modified RFX gene) disclosed in the present invention. In some embodiments, the expression of HLA-E can still be detected (e.g., by FACS). In some embodiments, compared with the expression of HLA-E in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), the expression of HLA-E in a population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower). In some embodiments, the only difference between a population of low immunogenic cells (such as engineered low immunogenic cells) and a population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0323] In some embodiments, the method includes genetically modifying the B2M gene. In some embodiments, altering immunogenicity includes reducing or ablating MHC class I-mediated responses for low immunogenic cells (such as engineered low immunogenic cells) (e.g., cells having a genetically modified B2M gene). In some embodiments, compared with a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of the low immunogenic cells (such as engineered low immunogenic cells) (e.g., cells having a genetically modified B2M gene) disclosed in the present invention has a reduced MHC class I-mediated response by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between a population of low immunogenic cells (such as engineered low immunogenic cells) and a population of unmodified cells is that the B2M gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0324] In some embodiments, the expression of HLA class I molecules (e.g., HLA-A, HLA-B, HLA-C, or HLA-E) is reduced (e.g., partially or completely), ablated, or undetectable (e.g., by FACS) in the genetically modified hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified B2M gene) disclosed in the present invention. In some embodiments, the expression of HLA-A in a population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA-A in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the B2M gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the expression of HLA-B in a population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA-B in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the B2M gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, the expression of HLA-C in a population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA-C in a population of unmodified cells. In some embodiments, the expression of HLA-E in a population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA-E in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).In some embodiments, the only difference between a population of low immunogenicity cells, such as engineered low immunogenicity cells, and a population of unmodified cells is that the B2M gene is unmodified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0325] In some embodiments, the method includes genetically modifying the CD58 gene. In some embodiments, genetically modifying the CD58 gene alters immunogenicity in the cells. In some embodiments, genetically modifying the CD58 gene reduces or ablates co-stimulatory immune cell responses. In some embodiments, genetically modifying the CD58 gene impairs the formation of immunological synapses. In some embodiments, genetically modifying the CD58 gene results in impaired recognition by patient (host) T cells, NK cells, and myeloid cells. In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified CD58 gene) has a co-stimulatory immune cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between a population of low immunogenicity cells, such as engineered low immunogenicity cells, and a population of unmodified cells is that the CD58 gene is unmodified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified). In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified CD58 gene) has an immunological synapse formation that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between a population of low immunogenicity cells, such as engineered low immunogenicity cells, and a population of unmodified cells is that the CD58 gene is unmodified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0326] In some embodiments, the method includes further genetically modifying the CIITA gene in combination with genetically modifying at least one of the RFX gene, the B2M gene, and the CD58 gene. In some embodiments, genetically modifying the CIITA gene further alters the immunogenicity in the cell. In some embodiments, altering the immunogenicity includes reducing or ablating MHC class II-mediated responses for hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells having a genetically modified CIITA gene). In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure has a reduced MHC class II-mediated response of about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and the population of unmodified cells is that the CIITA gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0327] In some embodiments, the expression of HLA class II molecules (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR) is further reduced (e.g., partially, completely) or ablated in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells having a genetically modified CIITA gene) disclosed in the present invention. In some embodiments, HLA class II molecule expression is not detected in the population of genetically modified cells of the present disclosure (e.g., not detected by conventional methods such as FACS). In some embodiments, compared to the expression of HLA class II molecules in a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), the expression of HLA class II molecules in a population of genetically modified cells (e.g., cells having a genetically modified CIITA gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the genetically modified cells and the population of unmodified cells is that the CIITA gene is not genetically modified in the population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified).
[0328] In some embodiments, the reduced immunogenicity of a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) includes one or more of the following: i) a reduced or ablated myeloid cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; ii) a reduced or ablated T cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; iii) a reduced or ablated natural killer (NK) cell response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; iv) a reduced or ablated neutralizing antibody response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; v) a reduced or ablated MHC class II-mediated response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; vi) a reduced or ablated neutralizing MHC class I-mediated response compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic or non-MHC-matched subject; and vii) a reduced or ablated allogeneic host rejection of the graft compared to a cell corresponding to a modified but ungenetically modified cell when the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) is present in an allogeneic subject.
[0329] In some embodiments, in a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell): i) the expression of HLA class II molecules is reduced or ablated; ii) the expression of HLA-A, HLA-B, and / or HLA-C is reduced; and iii) the expression of HLA-E is reduced but still detectable.
[0330] In some embodiments, the expression of HLA class I and class II molecules is detected by FACS.
[0331] In some embodiments, the immunogenicity of the cells is evaluated using any suitable method known to those skilled in the art. In some embodiments, the cells are analyzed to detect the presence of antibodies on the cell surface, for example, by staining with anti-IgM antibodies. In some embodiments, the immunogenicity is evaluated by a PBMC cell lysis assay. In some embodiments, a cell population is incubated with peripheral blood mononuclear cells (PBMCs), and then the lysis of the cells by the PBMCs is evaluated. In some embodiments, the immunogenicity is evaluated by a natural killer (NK) cell lysis assay. In some embodiments, a cell population is incubated with NK cells, and then the lysis of the cells by the NK cells is evaluated. In some embodiments, the immunogenicity is evaluated by a CD8 + T cell lysis assay. In some embodiments, a cell population is incubated with CD8 + T cells, and then the lysis of the cells by the CD8 + T cells is evaluated. In some embodiments, compared to an unmodified cell or cell population (e.g., compared to an immunogenic human cell or immunogenic cell or iPS human cell or iPS cell in which the RFX gene is not genetically modified), the genetically modified cells or their population of the present disclosure have increased viability or increased survival rate. In some embodiments, the only difference between the genetically modified cells and the unmodified cell or cell population is that the RFX gene (and optionally the B2M gene and / or CIITA gene and / or CD58 gene) is not genetically modified in the unmodified cell or cell population. In some embodiments, compared to a population of unmodified cells (e.g., cells in which the at least one target gene is not genetically modified), the population of genetically modified cells of the present disclosure has an increased viability or survival rate of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (higher). In some embodiments, the only difference between the genetically modified cells and the unmodified cell or cell population is that one or more of the RFX gene and / or B2M gene and / or CIITA gene and / or CD58 gene are not genetically modified in the unmodified cell population. In some embodiments, any suitable method known to those skilled in the art is used to evaluate the increased viability or increased survival rate of the cells. In some embodiments, flow cytometry, high-content imaging, tetrazolium reduction (MTT) assay, resazurin reduction assay, protease activity labeling assay, and / or ATP detection assay are used to determine cell viability or survival rate.
[0332] 9. Examples
[0333] In some embodiments, a chimeric antigen receptor (CAR) can be introduced into hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells, optionally into endogenous target genes such as RFX, CD58, CIITA, and / or B2M.
[0334] In some embodiments, the method further comprises introducing a CAR into the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) described herein such that the CAR is expressed on the surface of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and can be detected by flow cytometry. In some embodiments, the method further comprises using a gRNA to knock in a transgene containing a promoter, a CAR, and / or miR-adapted shRNA into an endogenous target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene), resulting in the expression of the CAR on the surface of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that can be detected by flow cytometry.
[0335] In some embodiments, the method further comprises knocking out one or more target genes, e.g., by gRNA, miRNA, shRNA, miR-adapted shRNA, or other RNA interference (RNAi)-based methods, in combination with the knock-in of the CAR. In some embodiments, the knockout comprises the formation of indels that result in non-functional expression of the gene.
[0336] In some embodiments, the method further comprises introducing a CAR and target gene miR-shRNA dual expression system as described herein, which enables the expression of the CAR and the knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) from a single vector, such that the CAR can be detected by flow cytometry on the surface of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells. In some embodiments, the gRNA is used to knock in a miR-adapted shRNA targeting CD58. In some embodiments, the gRNA targets RFX5. In some embodiments, the miRNA comprises the sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0337] In some embodiments, the method further comprises knocking out one or more target genes in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via shRNA. In some embodiments, the shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 63, or 64.
[0338] In some embodiments, hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a CAR knocked into an endogenous target gene, for example, one or more genes among the RFX gene, CD58 gene, CIITA gene, and / or B2M gene. In some embodiments, hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a transgene containing a promoter and a CAR, which has been knocked into one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, resulting in the expression of the CAR on the cell surface such that the CAR can be detected by flow cytometry. In some embodiments, the transgene can be knocked in by using the gRNA as described herein.
[0339] In some embodiments, hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells comprise a knockout of an endogenous target gene, i.e., a knockout of one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, and a knock-in of a CAR. In some embodiments, the CAR knock-in and target gene knockout are accomplished by introducing a CAR and target gene miR-shRNA dual-expression system as described herein, which enables the expression of the CAR and the knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) from a single vector. In some embodiments, the gRNA is used to knock in an miRNA targeting CD58. In some embodiments, the miRNA comprises the sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0340] In some embodiments, the low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells or iPS cells comprise knockout of one or more target genes in the low immunogenic cells (such as engineered low immunogenic cells) or iPS human cells or iPS cells, for example via shRNA. In some embodiments, shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66 or 67. In some embodiments, the shRNA comprises the sequence shown in SEQ ID NO: 60, 63 or 64.
[0341] Challenges in chimeric antigen receptor engineering and some potential options for addressing such challenges are known to those of ordinary skill in the art, and the engineering methods herein include advances in cell engineering, including chimeric antigen receptor cell methods. See, for example, Sotilo E. et al., Cancer Discov. 2015 5(12):1282-1295; Gardner R. et al., Blood 2016 127(20):2406-2410; and Majzner RG et al., Cancer Discov. 2020 May 10(5):702-723
[0342] 9.1 Example 1: RFX, B2M, and CIITA Genes for Evading Allogeneic Host Immune Responses Against Grafts
[0343] In some embodiments, genetic modification of a target gene (e.g., RFX gene, B2M gene, CIITA gene, CD58 gene) eliminates or reduces the expression of the protein encoded by the gene.
[0344] In some embodiments, genetic modification of the target gene eliminates the expression of the protein encoded by the gene. In some embodiments, genetic modification of the target gene reduces (e.g., partially or completely) the expression of the protein encoded by the gene. In some embodiments, expression of the protein encoded by the gene is not detected in the genetically modified cell population of the present disclosure. In some embodiments, compared to the expression of the protein encoded by the gene in an unmodified cell population, the expression of the protein encoded by the gene in the genetically modified cell population is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower).
[0345] Any suitable method known in the art can be used to genetically modify the genes in the cells disclosed herein (e.g., the cells disclosed in Section 7.3 or 7.4), the human cells disclosed herein (e.g., the immunogenic human cells or iPS human cells disclosed in Section 7.4).
[0346] In some embodiments, genetically modifying a target gene includes modifying the genomic DNA sequence of the gene; inhibiting transcription or translation of the gene's mRNA via an RNA interference (RNAi) system; or reducing or ablating transcription of the gene by recruiting or directing a transcriptional repressor to the gene.
[0347] Editing
[0348] In some embodiments, genetically modifying a target gene includes modifying the genomic DNA sequence of the target gene. In some embodiments, modifying the genomic DNA sequence of the gene includes using a site-specific nuclease to cleave deoxyribonucleic acid (DNA) at a precise target location in the genome, thereby creating a single-stranded or double-stranded DNA break at a specific location within the genome. Such breaks can and regularly are repaired by natural, endogenous cellular processes, such as homologous directed repair (HDR) and non-homologous end joining (NHEJ). NHEJ directly joins the DNA ends generated by the double-stranded break, sometimes with loss or addition of nucleotide sequences, which may disrupt gene expression. HDR utilizes a homologous sequence or donor sequence as a template for inserting a defined DNA sequence at the break point. The homologous sequence can be within the endogenous genome, such as a sister chromatid. Alternatively, the donor sequence can be an exogenous polynucleotide, such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, duplex oligonucleotide, or virus, that has regions highly homologous to the locus cleaved by the nuclease (e.g., a left homologous arm and a right homologous arm), but which may also contain additional sequences or sequence alterations, including deletions that can be incorporated into the cleaved target locus. A third repair mechanism can be microhomology-mediated end joining (MMEJ), also known as "alternative NHEJ", where the genetic outcome is similar to NHEJ because small deletions and insertions can occur at the cleavage site. MMEJ can utilize homologous sequences of several base pairs flanking the DNA break site to drive a more favorable DNA end joining repair outcome (Cho and Greenberg, Nature, 2015, 518, 174-76; Kent et al., Nature Structural and Molecular Biology, 2015, 22(3):230-7; Mateos-Gomez et al., Nature, 2015, 518, 254-57; Ceccaldi et al., Nature, 2015, 528, 258-62).
[0349] Each of these genome editing mechanisms can be used to generate a desired genetic modification. A step in the genome editing process can be to create one or two DNA breaks in a target locus near the site of the intended mutation or alteration, the latter being a double-strand break or two single-strand breaks. This can be achieved by using an endonuclease as described herein.
[0350] In some embodiments, a target gene of the present disclosure (e.g., RFX gene, B2M gene, CIITA gene, CD58 gene) is disrupted or at least partially deleted via a CRISPR-Cas system. In some embodiments, the CRISPR / Cas system for altering a target polynucleotide sequence in a cell comprises an RNA-binding protein, an endonuclease or exonuclease, a helicase, and / or a polymerase. In some embodiments, the CRISPR-endonuclease system comprises an endonuclease and at least one guide nucleic acid that guides the DNA cleavage of the endonuclease by hybridizing with a recognition site (or target motif of the target polynucleotide) in genomic DNA. In some embodiments, the CRISPR-endonuclease system comprises an endonuclease and at least one ribonucleic acid (e.g., guide RNA (gRNA)) that guides the DNA cleavage of the endonuclease by hybridizing with a recognition site (or target motif of the target polynucleotide) in genomic DNA. In some embodiments, the CRISPR system is a type I, type II, type III, type IV, type V, and / or type VI system. In some embodiments, the CRISPR system is a type II CRISPR / Cas9 system. In some embodiments, the CRISPR system is a type V CRISPR / Cpf1 (or Cas12a) system. In some embodiments, the CRISPR system is a CRISPR-MAD7 system. In some embodiments, the CRISPR system includes an endonuclease (e.g., Cas9, Cpf1, or MAD7), and one or two non-coding RNAs - crisprRNA (crRNA) and trans-activating RNA (tracrRNA) to target the cleavage of DNA.
[0351] CRISPR systems (including various guide designs, such as those described in the following publications) are known to those of ordinary skill in the art. Exemplary CRISPR systems are described in WO 2017 / 106569; WO 2015 / 139139; Zetsche B et al., “Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR system.” Cell. 2015 Oct 22;163(3):759-71; Jedrzejczyk DJ et al., “CRISPR-Cas12a nucleases function with structurally engineered crRNAs: Synthetic trAcrRNA.” Sci Rep. 2022 Jul 16;12(1):12193; EP3642334A1; U.S. Patent No. 9,790,490; U.S. Patent No. 11,180,751; US20210348156; EP3502253; EP3283625; US10337028; WO 2019 / 046540; and WO 2017 / 127807.
[0352] In some embodiments, the genome editing methods of the present disclosure use at least one and / or any ribonucleic acid (e.g., guide RNA or gRNA) that is capable of guiding an endonuclease (Cas protein) to and hybridizing with a target motif of a target polynucleotide sequence. In some embodiments, the at least one ribonucleic acid includes a tracrRNA. In some embodiments, the at least one ribonucleic acid includes a CRISPR RNA (crRNA). In some embodiments, the CRISPR RNA (crRNA) is or comprises a sequence of about 17 to 20 nucleotides complementary to the target DNA (the target motif of the target polynucleotide). In some embodiments, the tracrRNA serves as a binding scaffold for an endonuclease (e.g., Cas9, Cpf1, MAD7, or any other endonuclease of the present disclosure). In some embodiments, a single ribonucleic acid includes a guide RNA (gRNA) that guides an endonuclease or Cas protein to and hybridizes with a target motif of a target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids includes a guide RNA that guides an endonuclease or Cas protein to and hybridizes with a target motif of a target polynucleotide sequence in a cell. In some embodiments, the one or two ribonucleic acids both include a guide RNA that guides an endonuclease or Cas protein to and hybridizes with a target motif of a target polynucleotide sequence in a cell. In some embodiments, at least one ribonucleic acid of the present disclosure can be selected to hybridize with a plurality of different target motifs (e.g., different target motifs within a target polynucleotide). In some embodiments, at least one ribonucleic acid of the present disclosure can be selected to hybridize with a plurality of different target motifs (depending on the particular CRISPR / Cas system employed) and the sequence of the target polynucleotide, as understood by those skilled in the art. In some embodiments, at least one ribonucleic acid (e.g., one to two ribonucleic acids) can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, when compared to all other genomic nucleotide sequences in a cell, the at least one ribonucleic acid (e.g., one to two ribonucleic acids) hybridizes with a target motif containing at least two mismatches. In some embodiments, when compared to all other genomic nucleotide sequences in a cell, the at least one ribonucleic acid (e.g., one to two ribonucleic acids) hybridizes with a target motif containing at least one mismatch. In some embodiments, the at least one ribonucleic acid (e.g., one to two ribonucleic acids) is designed to hybridize with a target motif adjacent to a deoxyribonucleic acid motif recognized by an endonuclease or Cas protein. In some embodiments, the at least one ribonucleic acid (e.g., one to two ribonucleic acids) is designed to hybridize with a target motif adjacent to a deoxyribonucleic acid motif recognized by an endonuclease or Cas protein flanked by mutant alleles located between the target motifs.
[0353] In some embodiments, the genome editing methods of the present disclosure can be used with tracrRNA. In some embodiments, the genome editing methods of the present disclosure may not be used with tracrRNA. In some embodiments, the genome editing methods of the present disclosure can be used with discontinuous or split RNAs (such as, but not limited to, discontinuous or split gRNAs).
[0354] In some embodiments, the at least one ribonucleic acid (such as a guide RNA) is complementary to and / or hybridizes with a sequence on the same strand of the target polynucleotide sequence (such as the RFX gene, B2M gene, CIITA gene, CD58 gene). In some embodiments, the at least one ribonucleic acid (such as a guide RNA) is complementary to and / or hybridizes with a sequence on the opposite strand of the target polynucleotide sequence. In some embodiments, the at least one ribonucleic acid (such as a guide RNA) is not complementary to and / or does not hybridize with a sequence on the opposite strand of the target polynucleotide sequence. In some embodiments, the at least one ribonucleic acid (such as a guide RNA) is complementary to and / or hybridizes with an overlapping target motif of the target polynucleotide sequence. In some embodiments, the at least one ribonucleic acid (such as a guide RNA) is complementary to and / or hybridizes with an offset target motif of the target polynucleotide sequence.
[0355] In some embodiments, the at least one ribonucleic acid is complementary to and / or hybridizes with a sequence on the same strand of the target polynucleotide sequence, wherein the target polynucleotide sequence comprises the B2M gene. In some embodiments, the at least one ribonucleic acid is a gRNA. In some embodiments, the target polynucleotide sequence comprises the sequence shown in SEQ ID NO:253. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO:129 (UAAUUUCUACUCUUGUAGAU), optionally in combination with the spacer sequence shown in SEQ ID NO:251 (AGUGGGGGUGAAUUCAGUGUA). In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO:252.
[0356] In some embodiments, the at least one ribonucleic acid is complementary to and / or hybridizes with a sequence on the same strand of the target polynucleotide sequence, wherein the target polynucleotide sequence comprises an RFX gene. In some embodiments, the at least one ribonucleic acid is a gRNA. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 184 (RFX5_Exon9_gRNA 2; AGGAUCCGCUCUGCCCAGUCA), SEQ ID NO: 193 (RFX5_Exon10_gRNA 1; GAUGACCGUUCCCGAGGUGCA), SEQ ID NO: 202 (RFX5_Exon10_gRNA 4; GAGAACCCAGAGGGUGGAGCC), SEQ ID NO: 205 (RFX5_Exon10_gRNA 5; GUACCUCUGCAGAAGAGGACG), SEQ ID NO: 223 (RFX5_Exon11_gRNA 8; AGGGCACCUGAAGAAAGCCUG), SEQ ID NO: 239 (RFX5_Exon9_gRNA 2; AGGAUCCGCUCUGCCCAGUC) or SEQ ID NO: 246 (RFX5_Exon10_gRNA 1; GAUGACCGUUCCCGAGGUGC). In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 239 or 246. In some embodiments, the gRNA targets a genomic region comprising SEQ ID NO: 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 241, 241 or 248. In some embodiments, the gRNA comprises a repeat sequence shown in SEQ ID NO: 129, 235 or 237. In some embodiments, the gRNA further comprises a spacer sequence shown in SEQ ID NO: 130, 133, 136, 139, 142, 145, 148, 151, 154, 157, 160, 163, 166, 169, 172, 175, 178, 181, 184, 187, 190, 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 239 or 246.In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 131, 134, 137, 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 238, 240, 242, 243, 244, 245, 247, 249 or 250. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 141, 186, 195, 204, 207, 225, 241 or 248. In some embodiments, the gRNA comprises the repeat sequence shown in SEQ ID NO: 129, 235 or 237. In some embodiments, the gRNA further comprises the spacer sequence shown in SEQ ID NO: 139, 184, 193, 202, 205, 223, 239 or 246. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 140, 185, 194, 203, 206, 224, 236, 238, 240, 242, 243, 244, 245, 247, 249 or 250.
[0357] In some embodiments, the gRNA targeting RFX5 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence shown in SEQ ID NO: 377, 378, 379, 380, 381, 382, 383, 384 or 385.
[0358] In some embodiments, the at least one ribonucleic acid is complementary to and / or hybridizes with a sequence on the same strand of the target polynucleotide sequence, wherein the target polynucleotide sequence comprises the CD58 gene. In some embodiments, the at least one ribonucleic acid is a gRNA. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 259, 262, 265, 268, 271, 274, 277, 280, 283, 286, 289, 292, 295, 298, 301, 304, 307, 310, 313, 316, 319, 322, 325, 328, 331, 334, 337, 340, 343, 346, 349, 352, 355, 358, 361, 364, 367, 370, 373 or 376. In some embodiments, the gRNA comprises the sequence shown in SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence, which comprises the sequence of SEQ ID NO: 254, 257, 260, 263, 266, 269, 272, 275, 278, 281, 284, 287, 290, 293, 296, 299, 302, 305, 308, 311, 314, 317, 320, 323, 326, 329, 332, 335, 338, 341, 344, 347, 350, 353, 356, 359, 362, 365, 368, 371 or 374. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, 309, 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372 or 375. In some embodiments, the target polynucleotide sequence comprises SEQ IDNO: 256, 271, 274, 280, 304 or 328. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence, which comprises the sequence of SEQ ID NO: 254, 269, 272, 278, 302 or 326. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 270, 273, 279 or 327.
[0359] In some embodiments, the gRNA targeting CD58 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequences set forth in SEQ ID NO: 377, 378, 379, 386, 387, or 388.
[0360] In some embodiments, the CRISPR endonuclease is Cas9 and / or Cpf1, e.g., L. bacterium ND2006 Cpf1 and / or Acidaminococcus sp. BV3L6 Cpf1 and / or MAD7, and CRISPR / MAD7 is used in various embodiments. In some embodiments, since MAD7 is a Cas12a-like endonuclease, the target motif and / or guide nucleic acid (e.g., gRNA) used or recognized by Cpf1 or Cas-12a is the same as the target motif and / or guide nucleic acid (e.g., gRNA) used by MAD7. In some embodiments, the target motif recognized or used by the CRISPR-Cpf1 system is the same as the target motif used by the CRISPR-MAD7 system. In some embodiments, the guide nucleic acid (e.g., gRNA) recognized or used by the CRISPR-Cpf1 system is the same as the guide nucleic acid (e.g., gRNA) used by the CRISPR-MAD7 system. In some embodiments, the target motif and guide nucleic acid (e.g., gRNA) recognized or used by the CRISPR-Cpf1 system are the same as the target motif and guide nucleic acid (e.g., gRNA) used by the CRISPR-MAD7 system. In some embodiments, the CRISPR endonuclease is MAD7. In some embodiments, the nuclease used in the methods of the present disclosure is MAD7 of Inscripta TM Nuclease. In some embodiments, the nuclease used in the methods of the present disclosure is a nuclease of Inscripta. In some embodiments, Inscripta MAD7 is incorporated TM The method of nuclease is to use MAD7 TMMethods, such as those disclosed in WO2021 / 1186269, WO2021 / 119563, WO2022 / 146497 and WO2022 / 150269, the entire contents of which are incorporated herein by reference. In some embodiments, the CRISPR endonuclease is Cas9 (CRISPR-associated protein 9). In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes. In some embodiments, other Cas9 homologs are used, such as Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, Streptococcus thermophilus CRISPR 1 Cas9, Streptococcus thermophilus CRISPR 3 Cas9, or Treponema denticola Cas9. In some embodiments, the endonuclease is a Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and / or Cpf1 endonuclease. In some embodiments, wild-type variants can be used. In some embodiments, modified versions of the endonuclease can be used (e.g., homologs thereof, recombinants of its naturally occurring molecules, its codon-optimized versions, or its modified versions). In some embodiments, the endonuclease is any one or more of the endonucleases of the present disclosure. In some embodiments, the endonuclease is any one or more of the endonucleases known to those skilled in the art. In some embodiments, the exogenous Cas protein can be introduced into the cell in polypeptide form. In some embodiments, the Cas protein can be conjugated or fused with a cell-penetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide that promotes the uptake of a molecule into a cell, respectively. In some embodiments, the cell-penetrating polypeptide can contain a detectable label.
[0361] In some embodiments, the endonuclease or Cas protein can be conjugated or fused to a charged protein (e.g., a protein carrying a positive, negative, or overall neutral charge). Such linkage can be covalent. In some embodiments, the endonuclease or Cas protein can be fused to a super positively charged GFP to significantly enhance the ability of the Cas protein to penetrate cells (Cronican et al., ACS Chem Biol. 2010;5(8):747-52). In some embodiments, the endonuclease or Cas protein can be fused to a protein transduction domain (PTD) to facilitate its entry into cells. Exemplary PTDs include Tat, oligomeric arginine, and penetratin. In some embodiments, the endonuclease or Cas protein comprises a Cas polypeptide fused to a cell-penetrating peptide.
[0362] In some embodiments, the endonuclease is linked to at least one nuclear localization signal (NLS). The at least one NLS can be located at or within 50 amino acids of the amino terminus of the endonuclease, and / or the at least one NLS can be located at or within 50 amino acids of the carboxyl terminus of the endonuclease.
[0363] In some embodiments, the CRISPR-endonuclease system comprises an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease comprises an amino acid sequence having at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% amino acid sequence identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure). In some embodiments, the endonuclease has about or at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 consecutive amino acids. In some embodiments, the endonuclease has at most about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 consecutive amino acids. In some embodiments, the endonuclease has at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. In some embodiments, the endonuclease has at most about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 consecutive amino acids in the HNH nuclease domain of the endonuclease. In some embodiments, the endonuclease has at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 consecutive amino acids in the RuvC nuclease domain of the endonuclease.In some embodiments, the endonuclease has at most about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of the present disclosure) over about or at least about 10 contiguous amino acids in the RuvC nuclease domain of the endonuclease. The present disclosure provides guide RNAs (gRNAs) that can direct the activity of a related endonuclease to a specific target site within a polynucleotide. In some embodiments, the guide RNA comprises a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In some embodiments, for example in a CRISPR type II system, the gRNA further comprises a second RNA called a tracrRNA sequence. In some embodiments, in a CRISPR type II guide RNA (gRNA), the CRISPR repeat sequence and the tracrRNA sequence hybridize to each other to form a duplex. In some embodiments, in a CRISPR type V system, the gRNA comprises a crRNA that forms a duplex. In some embodiments, the gRNA can bind to the endonuclease such that the gRNA and the endonuclease form a complex. The gRNA can provide target specificity to the complex through its association with the endonuclease.
[0364] In some embodiments, the tracrRNA sequence comprises nucleotides that hybridize to a CRISPR repeat sequence in a cell. The tracrRNA sequence and the CRISPR repeat sequence can form a duplex, i.e., a base-paired double-stranded structure. At the same time, the tracrRNA sequence and the CRISPR repeat sequence can bind to an RNA-guided endonuclease. In some embodiments, at least a portion of the tracrRNA sequence can hybridize to the CRISPR repeat sequence. In some embodiments, the tracrRNA sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or 100% complementary to the CRISPR repeat sequence. In some embodiments, the tracrRNA sequence can have a length of from about 7 nucleotides to about 100 nucleotides. For example, the tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt in length. In some embodiments, the tracrRNA sequence can be about 9 nucleotides in length. In some embodiments, the tracrRNA sequence can be about 12 nucleotides in length.
[0365] In some embodiments, the tracrRNA sequence can be at least about 60% identical to a reference tracrRNA (e.g., wild-type, tracrRNA from Streptococcus pyogenes) sequence over a region of at least 6, 7, or 8 contiguous nucleotides. For example, the tracrRNA sequence can be at least about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99% or 100% identical to the reference tracrRNA sequence over a region of at least 6, 7, or 8 contiguous nucleotides.
[0366] In some embodiments, a Cas protein or an endonuclease can be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein or endonuclease (e.g., Cas9, Cpf1, MAD7, or any endonuclease or Cas protein of the present disclosure). In some embodiments, the method includes techniques for introducing the nucleic acid into γδ iPSC cells. The process of introducing the nucleic acid into the cell can be achieved by any suitable technique. Suitable techniques include, but are not limited to, transfection (e.g., Neon transfection, calcium phosphate, or lipid-mediated transfection), electroporation, and transduction or infection using viral vectors. In some embodiments, a non-viral system (e.g., Neon transfection) is used to introduce the nucleic acid into the cell. In some embodiments, a viral system (e.g., adeno-associated virus) is used to introduce the nucleic acid into the cell. In some embodiments, the method includes electroporating a cell (e.g., as disclosed in Section 7.3 or 7.4) or a human cell (e.g., an immunogenic human cell, an iPS human cell as disclosed in Section 7.4) to introduce genetic material, including, for example, DNA, RNA, and / or mRNA. In some embodiments, the techniques for introducing a protein or nucleic acid can include introducing the protein or nucleic acid by: electroporation; microinjection; viral delivery; exosomes; liposomes; gene gun; jet injection; hydrodynamic injection; ultrasound; magnetic field-mediated gene transfer; electric pulse-mediated gene transfer; using nanoparticles, including, for example, lipid-based nanoparticles; incubation with an endosome-lysing agent; using a cell-penetrating peptide; or any other suitable technique. In some embodiments, the method includes electroporating a human cell, including, for example, using a Neon transfection system (Thermo Fisher Scientific Inc.).
[0367] In some embodiments, the nucleic acid includes DNA. In some embodiments, the nucleic acid includes modified DNA. In some embodiments, the nucleic acid includes mRNA. In some embodiments, the nucleic acid includes modified mRNA.
[0368] In some embodiments, the Cas protein or endonuclease is complexed with at least one ribonucleic acid (e.g., one to two ribonucleic acids). In some embodiments, the Cas protein or endonuclease is complexed with two ribonucleic acids. In some embodiments, the Cas protein or endonuclease is complexed with one ribonucleic acid. In some embodiments, the Cas protein or endonuclease is encoded by a modified nucleic acid.
[0369] In some embodiments, the endonuclease and the gRNA can be each administered to the cell separately. In some embodiments, the endonuclease can be pre-complexed with one or more guide RNAs or one or more crRNAs and tracrRNA. The pre-complexed material can then be administered to the cell. Such pre-complexed material is referred to as a ribonucleoprotein particle (RNP). The endonuclease in the RNP can be, for example, a Cpf1 endonuclease, a MAD7 endonuclease, a Cas9 endonuclease, or any endonuclease of the present disclosure. In some embodiments, the endonuclease can be flanked at the N-terminus, C-terminus, or both the N-terminus and C-terminus with one or more nuclear localization signals (NLS). In some embodiments, the weight ratio of the genomic targeting nucleic acid to the endonuclease in the RNP can be 1:1, 2:1, 1:2, or any suitable ratio.
[0370] In some embodiments, the gRNA can be a bimolecular guide RNA. In some embodiments, the gRNA can be a single-molecule guide RNA (sgRNA). In some embodiments, the gRNA can be constructed as a single RNA oligonucleotide that is a combination of a repeat sequence followed by a spacer sequence, wherein specificity for a genomic target location is conferred by complementary binding of the spacer to genomic DNA. A split gRNA can be constructed as two RNA oligonucleotides consisting of a tracrRNA and a crRNA, wherein the tracrRNA contains a portion of the repeat sequence and the crRNA contains a portion of the repeat sequence followed by a spacer sequence.
[0371] In some embodiments, the gRNA comprises a sequence that hybridizes to a sequence in the target polynucleotide. In some embodiments, the nucleotide sequence of the gRNA can vary according to the sequence of the target nucleic acid of interest. In some embodiments, the gRNA comprises a sequence of variable length having 17 to 30 nucleotides, wherein at least a portion of the sequence hybridizes to a sequence in the target polynucleotide. In some embodiments, the gRNA sequence can be designed to hybridize to a target polynucleotide located 5' of the PAM of the endonuclease used in the system.
[0372] In some embodiments, the gRNA comprises another moiety (e.g., a stability control sequence, an endonuclease binding sequence, or a ribozyme). This moiety can decrease or increase the stability of the nucleic acid of the target nucleic acid. In some embodiments, this moiety can be a transcription terminator fragment (i.e., a transcription termination sequence). In some embodiments, this moiety can function in eukaryotic cells. This moiety can function in prokaryotic cells. In some embodiments, this moiety can function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m7G)), a riboswitch sequence (e.g., allowing regulation of stability and / or regulation of accessibility of proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.), a modification or sequence that provides for tracking (e.g., directly conjugated to a fluorescent molecule, conjugated to a moiety that facilitates fluorescence detection, a sequence that allows for fluorescence detection, etc.) and / or a modification or sequence that provides a protein binding site (e.g., proteins that act on DNA, including transcription activators, transcription repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).
[0373] In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide is referred to as the spacer. In some embodiments, the portion of the gRNA (spacer) that hybridizes to a sequence or target motif in the target polynucleotide comprises about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than about 25 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide comprises less than about 25 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, comprises more than about 20 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, comprises about or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, comprises at most about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides. In some embodiments, the sequence or target motif in the target polynucleotide sequence comprises about, at least about, or at most about 20 bases 5' of the first nucleotide adjacent to the PAM.
[0374] In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide has a length of at least about 6 nucleotides (NTs). In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, is about or at least about 6 NTs, about or at least about 10 NTs, about or at least about 15 NTs, about or at least about 18 NTs, about or at least about 19 NTs, about or at least about 20 NTs, about or at least about 21 NTs, about or at least about 22 NTs, about or at least about 23 NTs, about or at least about 24 NTs, about or at least about 25 NTs, about or at least about 30 NTs, about or at least about 35 NTs, about or at least about 40 NTs, about or at least about 45 NTs, about or at least about 50 NTs, or more than about 50 NTs. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, is from about 6 NTs to about 40 NTs, from about 6 NTs to about 35 NTs, from about 6 NTs to about 30 NTs, from about 6 NTs to about 29 NTs, from about 6 NTs to about 28 NTs, from about 6 NTs to about 27 NTs, from about 6 NTs to about 26 NTs, from about 6 NTs to about 25 NTs, from about 6 NTs to about 24 NTs, from about 6 NTs to about 23 NTs, from about 6 NTs to about 22 NTs, from about 6 NTs to about 21 NTs, from about 6 NTs to about 20 NTs, from about 10 NTs to about 50 NTs, from about 10 NTs to about 40 NTs, from about 10 NTs to about 35 NTs, from about 10 NTs to about 30 NTs, from about 10 NTs to about 30 NTs, from about 10 NTs to about 29 NTs, from about 10 NTs to about 28 NTs, from about 10 NTs to about 27 NTs, from about 10 NTs to about 26 NTs, from about 10 NTs to about 25 NTs, from about 10 NTs to about 24 NTs, from about 10 NTs to about 23 NTs, from about 10 NTs to about 22 NTs, from about 10 NTs to about 21 NTs, from about 10 NTs to about 20 NTs, from about 19 NTs to about 23 NTs, from about 19 NTs to about 24 NTs, from about 19 NTs to about 25 NTs, from about 19 NTs to about 30 NTs, from about 19 NTs to about 35 NTs, from about 19 NTs to about 40 NTs, from about 19 NTs to about 45 NTs, from about 19 NTs to about 50 NTs, from about 19 NTs to about 60 NTs, from about 20 NTs to about 25 NTs, from about 20 NTs to about 30 NTs, from about 20 NTs to about 35 NTs, from about 20 NTs to about 40 NTs, from about 20 NTs to about 45 NTs, from about 20 NTs to about 50 NTs, or from about 20 NTs to about 60 NTs.
[0375] In some embodiments, the percentage of complementarity between the gRNA or a portion of the gRNA (e.g., the spacer or crRNA) and the target polynucleotide is about or at least about 30%, about or at least about 40%, about or at least about 50%, about or at least about 60%, about or at least about 65%, about or at least about 70%, about or at least about 75%, about or at least about 80%, about or at least about 85%, about or at least about 90%, about or at least about 95%, about or at least about 97%, about or at least about 98%, about or at least about 99%, or 100%. In some embodiments, the percentage of complementarity between the gRNA or a portion of the gRNA and the target polynucleotide is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some embodiments, the lengths of this portion of the gRNA and the target nucleic acid can differ by 1 to 6 nucleotides, which can be considered one or more bulges.
[0376] In some embodiments, the gRNA is modified or chemically modified. In some embodiments, the chemically modified gRNA is a gRNA comprising at least one nucleotide having a chemical modification (e.g., 2'-O-methyl sugar modification). In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises 2'-O-methyl-thiophosphate residues. In some embodiments, the chemical modification enhances stability, reduces the likelihood or extent of an innate immune response, and / or enhances other properties, as described in the art.
[0377] In some embodiments, the modified gRNA comprises a modified backbone, such as a thiophosphate, phosphotriester, morpholino, methylphosphonate, short chain alkyl or cycloalkyl sugar internucleotide linkage, or short chain heteroatom or heterocyclic sugar internucleotide linkage.
[0378] In some embodiments, the modified gRNA comprises one or more substituted sugar moieties, such as one of the following groups at the 2'-position: OH, SH, SCH3, F, OCN, OCH3, OCH3O(CH2)nCH3, O(CH2)nNH2 or O(CH2)nCH3, where n is from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S- or N-alkyl; O-, S- or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleavage group; reporter group; intercalator; 2'-O-(2-methoxyethyl); 2'-methoxy (2'-O-CH3); 2'-propoxy (2'-OCH2CH2CH3); and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the gRNA, such as the 3'-position of the sugar on the 3'-terminal nucleotide, and / or the 5'-position of the 5'-terminal nucleotide. In some examples, both the sugar and the internucleoside bond (i.e., the backbone) of the nucleotide unit can be replaced by different groups.
[0379] In some embodiments, the gRNA includes additional or alternative nucleobase (or "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases that are only occasionally or transiently found in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidine, 5-methylcytosine (also known as 5-methyl-2'-deoxycytosine or 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentiobiosyl HMC, as well as synthetic nucleobases, such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine or other hetero-substituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine and 2,6-diaminopurine.
[0380] In some embodiments, the modified nucleobases can include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azauracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (specifically 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine.
[0381] In some embodiments, zinc finger nucleases (ZFNs) can be used to genetically modify the genomic DNA sequence of a target gene. A zinc finger nuclease (ZFN) is a modular protein consisting of an engineered zinc finger DNA-binding domain linked to the catalytic domain of the type II endonuclease FokI. Because FokI functions as a dimer, a pair of ZFNs is engineered to bind to homologous target "half-site" sequences on opposite DNA strands with a precise spacing between them to enable the formation of a catalytically active FokI dimer. After dimerization of the FokI domains, a DNA double-strand break is generated between the ZFN half-sites, which serves as the initial step in genome editing.
[0382] In some embodiments, the DNA-binding domain of each ZFN consists of 3 to 6 zinc fingers with an abundant Cys2-His2 architecture, where each finger primarily recognizes a nucleotide triplet on one strand of the target DNA sequence, although cross-strand interactions with a fourth nucleotide can also occur. Altering the amino acids of the finger at positions critical for DNA contact changes the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12-bp target sequence, which is a composition of the triplet preferences contributed by each finger, although the triplet preferences may be influenced to varying degrees by adjacent fingers. By simply modifying a single finger, a ZFN can easily be re-targeted to almost any genomic address. In some embodiments, 4- to 6-finger proteins are used, recognizing 12 to 18 bp, respectively. Thus, a pair of ZFNs will typically recognize a combined target sequence of 24 to 36 bp, excluding the typical 5- to 7-bp spacer between the half-sites. These binding sites can be further separated with larger spacers (containing 15 to 17 bp).
[0383] A variety of ZFN-based systems have been described in the art, and their modifications have been frequently reported, and many references describe the rules and parameters for guiding ZFN design; see, for example, Segal et al., Proc Natl Acad Sci, 1999 96(6):2758-63; Dreier B et al., J Mol Biol., 2000, 303(4):489-502; Liu Q et al., J Biol Chem., 2002, 277(6):3850-6; Dreier et al., J Biol Chem., 2005, 280(42):35588-97; and Dreier et al., J Biol Chem. 2001, 276(31):29466-78.
[0384] In some embodiments, transcription activator-like effector nucleases (TALENs) can be used to genetically modify the genomic DNA sequence of a target gene. TALENs represent another form of modular nuclease, where, like ZFNs, an engineered DNA-binding domain is linked to a FokI nuclease domain, and a pair of TALENs operate in tandem to effect targeted DNA cleavage. The main difference from ZFNs lies in the nature of the DNA-binding domain and the associated target DNA sequence recognition characteristics. The TALEN DNA-binding domain is derived from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs consist of a tandem array of 33 to 35 amino acid repeats, where each repeat recognizes a single base pair in the target DNA sequence, which typically has a length of up to 20 bp, resulting in a total target sequence of up to 40 bp in length. The nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which consists of only two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine, and thymine are mainly recognized by four RVDs: Asn-Asn, Asn-Ile, His-Asp, and Asn-Gly. A variety of TALEN-based systems have been described in the art, and modifications thereof are frequently reported; see, for example, Boch, Science, 2009 326(5959):1509-12; Mak et al., Science, 2012, 335(6069):716-9; and Moscou et al., Science, 2009, 326(5959):1501. The use of TALENs based on the "Golden Gate" platform or cloning scheme has been described by multiple teams; see, for example, Cermak et al., Nucleic Acids Res., 2011, 39(12):e82; Li et al., Nucleic Acids Res., 2011, 39(14):6315-25; Weber et al., PLoS One., 2011, 6(2):e16765; Wang et al., J Genet Genomics, 2014, 41(6):339-47; and Cermak T et al., Methods Mol Biol., 2015 1239:133-59.
[0385] In some embodiments, homing endonucleases (HEs) can be used to genetically modify the genomic DNA sequence of a target gene. Homing endonucleases (HEs) are sequence-specific endonucleases that have a long recognition sequence (14 to 44 base pairs) and typically cleave DNA at unique sites in the genome with high specificity. Based on the structural classification of the HE families, there are at least six known HE families, including GIY-YIG, His-Cis box, H-N-H, PD-(D / E)xK, and Vsr-like, which are derived from a wide range of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and bacteriophages. Like ZFNs and TALENs, HEs can be used to generate DSBs at the target locus, which serves as the starting step for genome editing. In addition, some natural and engineered HEs cleave only one strand of DNA and thus function as site-specific nickases. A variety of HE-based systems have been described in the art, and their modifications are often reported; see, for example, the following reviews: Steentoft et al., Glycobiology, 2014, 24(8):663-80; Belfort and Bonocora, Methods MolBiol., 2014, 1123:1-26; and Hafez and Hausner, Genome, 2012, 55(8):553-69.
[0386] In some embodiments, the MegaTAL or Tev-mTALEN platform can be used to genetically modify the genomic DNA sequence of a target gene. The MegaTAL platform and the Tev-mTALEN platform use a fusion of a TALE DNA-binding domain with a catalytically active HE, taking advantage of both the tunable DNA binding and specificity of the TALE and the cleavage sequence specificity of the HE; see, for example, Boissel et al., Nucleic Acids Res., 2014, 42:2591-2601; Kleinstiver et al., G3, 2014, 4:1155-65; and Boissel and Scharenberg, Methods Mol.Biol., 2015, 1239:171-96.
[0387] In some embodiments, the MegaTev architecture is a fusion of a meganuclease (Mega) and a nuclease domain derived from the GIY-YIG homing endonuclease I-Teel (Tev). The two active sites are separated by approximately 30 bp on the DNA substrate and generate two DSBs with incompatible sticky ends; see, e.g., Wolfs et al., Nucleic Acids Res., 2014, 42, 8816-29. It is expected that other combinations of existing nuclease-based methods will continue to evolve and be useful for achieving the targeted genomic modifications described herein.
[0388] Table 1. List of CRISPR / Cas9 crRNAs
[0389] In some embodiments, genetically modifying a target gene includes reducing the mRNA of the target gene via an RNA interference (RNAi) system. RNA interference (RNAi) is a biological process of mRNA degradation and target gene expression inhibition induced by double-stranded (ds) small interfering RNA (siRNA) with complementary sequences. Any suitable RNAi system known in the art can be used to reduce the mRNA of the target gene. For a review of RNAi technology, see, e.g., Xu et al., Comprehensive Biotechnology. 2019:560–575.
[0390] In some embodiments, the RNAi system comprises synthetic siRNA, short hairpin RNA (shRNA), dicer-generated siRNA, endoribonuclease-prepared short interfering RNA (esiRNA), microRNA and mimics, pro-siRNA, miR-adapted shRNA, or combinations thereof.
[0391] In some embodiments, genetically modifying a target gene includes reducing or ablating the transcription of the target gene (e.g., transcriptional repression). In some embodiments, genetically modifying a target gene includes recruiting or directing a transcriptional repressor to the target gene. A transcriptional repressor is a chromatin-modifying protein capable of inhibiting gene transcription. The repressor protein acts by binding to the promoter region of the gene, which prevents the production of mRNA.
[0392] Any suitable transcriptional repressor known in the art can be used for the subject matter disclosed herein. Non-limiting examples of transcriptional repressors include the Kruppel-associated box (KRAB) repressor domain and methyl-CpG-binding protein 2 (MeCP2). Transcriptional repression can also occur through steric hindrance at the initiation or elongation stage of the RNA polymerase complex.
[0393] In some embodiments, the gRNA is used to knock in an miR-adapted shRNA targeting CD58. In some embodiments, the miRNA comprises a sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.
[0394] In some embodiments, the method includes knocking out one or more target genes in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via an shRNA. In some embodiments, the shRNA is used to disrupt the CD58 gene. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises a sequence shown in SEQ ID NO: 60, 63, or 64.
[0395] Table 2. List of CRISPR / Cas12a crRNAs.
[0396] The present disclosure also provides non-naturally occurring hypoimmunogenic cells (such as engineered hypoimmunogenic cells) produced by the methods disclosed herein (e.g., the methods of engineering hypoimmunogenicity disclosed in Sections 7.4 and 7.5).
[0397] The present disclosure also provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods disclosed herein (e.g., the methods of engineering hypoimmunogenicity disclosed in Sections 7.4 and 7.5).
[0398] The present disclosure also provides non-naturally occurring hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that comprise at least one target gene that has been genetically modified (e.g., an RFX gene, a B2M gene, a CD58 gene, a CIITA gene), wherein the genetically modified target gene reduces the expression of the protein encoded by the at least one target gene. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are generated from embryoid bodies. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise at least two, at least three, at least four genetically modified target genes (e.g., a genetically modified RFX gene and a B2M gene, a genetically modified RFX gene and a CD58 gene, a genetically modified B2M gene and a CIITA gene, a genetically modified B2M gene and a CD58 gene, a genetically modified CD58 gene and a CIITA gene, a genetically modified RFX gene, B2M gene and CD58 gene, a genetically modified CIITA gene, B2M gene and CD58 gene).
[0399] The present disclosure also provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) that comprise at least one target gene that has been genetically modified (e.g., an RFX gene, a B2M gene, a CD58 gene, a CIITA gene), wherein the genetically modified target gene reduces the expression of the protein encoded by the at least one target gene. In some embodiments, the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) are generated from embryoid bodies. In some embodiments, the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) comprise at least two, at least three, at least four genetically modified target genes (e.g., a genetically modified RFX gene and a B2M gene, a genetically modified RFX gene and a CD58 gene, a genetically modified B2M gene and a CIITA gene, a genetically modified B2M gene and a CD58 gene, a genetically modified CD58 gene and a CIITA gene, a genetically modified RFX gene, B2M gene and CD58 gene, a genetically modified CIITA gene, B2M gene and CD58 gene).
[0400] The present disclosure also provides γδT cell-derived induced pluripotent stem (iPS) human cells that comprise at least one target gene (e.g., RFX gene, B2M gene, CD58 gene, CIITA gene) that has been genetically modified, wherein the genetically modified target gene reduces the expression of the protein encoded by the at least one target gene. In some embodiments, the iPS human cells comprise at least two, at least three, at least four genetically modified target genes (e.g., genetically modified RFX gene and B2M gene, genetically modified RFX gene and CD58 gene, genetically modified B2M gene and CIITA gene, genetically modified B2M gene and CD58 gene, genetically modified CD58 gene and CIITA gene, genetically modified RFX gene, B2M gene and CD58 gene, genetically modified CIITA gene, B2M gene and CD58 gene).
[0401] In some embodiments, the present disclosure provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) derived from γδT cell-derived iPS human cells.
[0402] In some embodiments, the non-naturally occurring hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) or γδT cell-derived induced pluripotent stem (iPS) human cells disclosed herein also comprise at least one gene selected from the group consisting of a genetically modified TNFRSF14 (also known as HVEM) gene, a genetically modified TNFRSF1A (also known as TNFR1) gene, a genetically modified TNFRSF1B (also known as TNFR2) gene, and a genetically modified ICAM1 gene.
[0403] In some embodiments, compared to an unmodified cell population, a population of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has a reduced immunogenicity or immune response by, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower). In some embodiments, the only difference between the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0404] In some embodiments, compared to an unmodified cell population, a population of the low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced myeloid cell response of, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0405] In some embodiments, compared to an unmodified cell population, a population of the low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced T cell response of, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0406] In some embodiments, compared to an unmodified cell population, a population of the low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced natural killer cell response of, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0407] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced antibody response, for example, of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0408] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having at least one genetically modified target gene) has a reduced allogeneic host versus graft rejection, for example, of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more than 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the at least one target gene is not genetically modified in the unmodified cell population.
[0409] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene) has a reduced MHC class II-mediated response, for example, of about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the RFX gene is not genetically modified in the unmodified cell population.
[0410] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene) has a reduced MHC class I-mediated response of, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the RFX gene is not genetically modified in the unmodified cell population.
[0411] In some embodiments, compared to the expression of HLA class II molecules in an unmodified cell population, the expression of HLA class II molecules in a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene) is reduced by, for example, about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the RFX gene is not genetically modified in the unmodified cell population.
[0412] In some embodiments, compared to the expression of HLA class I molecules in an unmodified cell population, the expression of HLA class I molecules in a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the RFX gene is not genetically modified in the unmodified cell population.
[0413] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified B2M gene) has a reduced MHC class I-mediated response of about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the B2M gene is not genetically modified in the unmodified cell population.
[0414] In some embodiments, compared to the expression of HLA class I molecules in an unmodified cell population, the expression of HLA class I molecules in a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the B2M gene is not genetically modified in the unmodified cell population.
[0415] In some embodiments, compared to an unmodified cell population, a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified CIITA gene) has a reduced MHC class II-mediated response of about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the CIITA gene is not genetically modified in the unmodified cell population.
[0416] In some embodiments, compared to the expression of HLA class II molecules in an unmodified cell population, the expression of HLA class II molecules in a population of low immunogenicity cells of the present disclosure (such as engineered low immunogenicity cells) (e.g., cells having a genetically modified CIITA gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower). In some embodiments, the only difference between the population of low immunogenicity cells (such as engineered low immunogenicity cells) and the unmodified cell population is that the CIITA gene is not genetically modified in the unmodified cell population.
[0417] In some embodiments, a population of low immunogenic cells of the present disclosure, such as engineered low immunogenic cells (e.g., cells having a genetically modified CD58 gene), has a reduced or ablated co-stimulatory immune cell response. In some embodiments, a population of low immunogenic cells of the present disclosure, such as engineered low immunogenic cells (e.g., cells having a genetically modified CD58 gene), has a weakened immune synapse formation. In some embodiments, a population of low immunogenic cells of the present disclosure, such as engineered low immunogenic cells (e.g., cells having a genetically modified CD58 gene), has impaired recognition by patient (host) T cells, NK cells, and myeloid cells.
[0418] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is blood cells. In some embodiments, the blood cells are suitably peripheral blood mononuclear cells (PBMCs) and can include all types of blood cells present during the entire differentiation process from hematopoietic stem cells to final differentiation into peripheral blood. In some embodiments, the blood cells include, for example, hematopoietic stem cells, lymphoid stem cells, lymphoid dendritic cell progenitors, lymphoid dendritic cells, T lymphocyte progenitors, T cells, B lymphocyte progenitors, B cells, plasma cells, NK progenitors, NK cells, monocytes, and macrophages.
[0419] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) can be peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating lymphocytes (TILs), or a combination thereof. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is peripheral blood mononuclear (PBMC) cells.
[0420] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is T cells. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is optionally selected from the group consisting of + / CD8 + double positive T cells, cytotoxic T cells, Th3 (Treg) cells, Th9 cells, Thαβ helper cells, Tfh cells, stem cell memory TSCM cells, central memory TCM cells, effector memory TEM cells, effector memory TEMRA cells, γδ T cells, and any combination thereof.
[0421] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is derived from cell types that are easily accessible and require minimal invasion, such as fibroblasts, skin cells, umbilical cord blood cells, peripheral blood cells, and renal epithelial cells.
[0422] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is terminally differentiated cells. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is terminally differentiated T cells. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is terminally differentiated PBMC cells. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is terminally differentiated γδ T cells.
[0423] The population of low immunogenic cells (such as engineered low immunogenic cells) of the present disclosure can be derived from mammals, preferably humans, but including but not limited to non-human primates, murine (i.e., mice and rats), canines, felines, equines, bovines, ovines, porcines, caprines, etc.
[0424] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is mammalian cells.
[0425] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is human cells.
[0426] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) is human PBMC cells.
[0427] In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) does not contain BCMA-CAR. In some embodiments, the population of low immunogenic cells does not contain MHC class I chain-related (MIC)-CAR, such as MICA and / or MICB CAR. In some embodiments, the population of low immunogenic cells (such as engineered low immunogenic cells) does not contain a CAR that includes a signaling domain from a cytoplasmic domain of a signal transduction protein specific for T cell and / or NK cell activation or function.
[0428] In some embodiments, the low immunogenic cells (such as engineered low immunogenic cells) are T cells. In some embodiments, the low immunogenic cells (such as engineered low immunogenic cells) are T effector cells. In some embodiments, the low immunogenic cells (such as engineered low immunogenic cells) are not T regulatory cells. In some embodiments, the low immunogenic cells (such as engineered low immunogenic cells) do not have C45RA + CD27 - CD28 - CCR7 - CD62L -Phenotype. In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) is not a natural killer cell.
[0429] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell does not contain a genetically modified, such as disrupted or knocked out: a) CISH (cytokine-inducible SH2-containing protein) gene; b) adenosine A2A (ADORA2A) gene; c) TGFβ receptor gene; d) HLA class I gene, e.g., HLA A, B, C, E, F, G; e) HLA class II gene; f) NLRC5 (NOD-like receptor family CARD domain-containing 5) gene; g) CD38 gene; h) thioredoxin-interacting protein (TXNIP) gene; i) ITGB3 (integrin subunit beta 3) gene; j) IL17A gene; k) DGKA (diacylglycerol kinase alpha) gene; l) DGKZ (diacylglycerol kinase zeta) gene; m) PD1 gene; n) TRGC1 (T cell receptor gamma constant region 1) gene; o) TRGC1 (T cell receptor gamma constant region 2) gene; and / or p) TRDC (T cell receptor delta constant region) gene.
[0430] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell is not TCR-deficient, e.g., not TCRα, β, γ, and / or δ-deficient. For example, in certain embodiments, the TCR locus (e.g., the TCRα, β, γ, or δ locus) is not disrupted or knocked out, e.g., does not contain an insertion (e.g., a CAR insertion).
[0431] In some embodiments, the low immunogenicity cell (such as an engineered low immunogenicity cell) or the iPS human cell does not contain: a) an exogenous NICD (Notch intracellular domain) coding sequence, such as a NICD1 coding sequence; c) an exogenous CD47 coding sequence or increased CD47 expression relative...
Claims
1. A method for low immunogenicity, such as engineered low immunogenicity, comprising: a) Genetically modifying the regulatory factor X (RFX) gene of at least one immunogenic human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic human cell; b) Forming at least one embryoid body or multicellular body from the cells in a) to produce at least one low immunogenic cell, such as at least one engineered low immunogenic cell; c) Placing the low immunogenic cell, such as the engineered low immunogenic cell, into the immune system; And d) Determining the immunogenicity of the low immunogenic cell, such as the engineered low immunogenic cell, wherein the immunogenicity is altered compared to the immunogenic human cell in which the RFX gene is not genetically modified. Optionally, wherein step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene of the immunogenic human cell.
2. A method for low immunogenicity, such as engineered low immunogenicity, comprising: a) Reprogramming immunogenic human cells to produce induced pluripotent stem (iPS) human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor containing a γ chain and a δ chain; b) Genetically modifying the regulatory factor X (RFX) gene of the iPS human cells, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS human cells; c) Forming at least one embryoid body from the cells in step b) to produce at least one low immunogenic cell, such as at least one engineered low immunogenic cell; d) Placing the low immunogenic cell, such as the engineered low immunogenic cell, into the immune system; and e) Determining the immunogenicity of the low immunogenic cell, such as the engineered low immunogenic cell, wherein the immunogenicity is altered compared to the iPS human cells in which the RFX gene is not genetically modified. Optionally, wherein step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene of the iPS human cells.
3. A method for low immunogenicity, such as engineered low immunogenicity, comprising: a) Genetically modifying the regulatory factor X (RFX) gene of immunogenic human cells to produce low immunogenic cells, such as engineered low immunogenic cells, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic human cells; b) Placing the low immunogenic cell, such as the engineered low immunogenic cell, into the immune system; and c) Determining the immunogenicity of the low immunogenic cell, such as the engineered low immunogenic cell, wherein the immunogenicity is altered compared to the immunogenic human cells in which the RFX gene is not genetically modified. Optionally, step a) further includes genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene of the immunogenic human cells.
4. A method for generating hypoimmunogenic cells, such as engineered hypoimmunogenic cells, from immunogenic cells, comprising: (i) Genetically modifying the regulatory factor X (RFX) gene in the immunogenic cells, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the cells, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene in the immunogenic cells, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the immunogenic cells, wherein the method produces the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, which have one or more of the following characteristics: a) When the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject, they have reduced immunogenicity compared to the corresponding immunogenic cells not genetically modified by (i) and (ii). b) When the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject, they elicit a reduced immune response compared to the corresponding immunogenic cells not genetically modified by (i) and (ii). And c) When the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, are present in an allogeneic or non-MHC-matched subject, they elicit reduced cytotoxicity of alloreactive T cells compared to the corresponding immunogenic cells not genetically modified by (i) and (ii).
5. A method for producing hypoimmunogenic cells, such as engineered hypoimmunogenic cells, from immunogenic cells, comprising: a) Reprogramming the immunogenic cells to produce induced pluripotent stem (iPS) cells; b) (i) Genetically modifying the regulatory factor X (RFX) gene in the iPS cells of step (a), wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS cells, and (ii) optionally further genetically modifying one or more genes selected from the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and CD58 gene in the iPS cells, wherein genetically modifying the one or more genes reduces the expression of the corresponding one or more proteins in the iPS cells; and c) Optionally, differentiating the cells produced in step (b); wherein the method produces the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, which have one or more of the following characteristics: 1) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, they have reduced immunogenicity compared to the corresponding iPS cells that have not been genetically modified as described in step (b) or to the cells corresponding to the cells produced in step (c). 2) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, they elicit a reduced immune response compared to the corresponding iPS cells that have not been genetically modified as described in step (b) or to the cells corresponding to the cells produced in step (c). And 3) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, they elicit reduced cytotoxicity of alloreactive T cells compared to the corresponding iPS cells that have not been genetically modified as described in step (b) or to the cells corresponding to the cells produced in step (c).
6. The method according to any one of claims 1 to 5, wherein the low-immunogenic cells, such as the engineered low-immunogenic cells, comprise a T cell receptor (TCR) containing a γ chain and a δ chain.
7. The method according to any one of claims 1 to 6, wherein the immunogenic human cells or immunogenic cells are immune cells, optionally selected from T cells, natural killer (NK) cells, B cells, and hematopoietic stem cells (HSC).
8. The method according to any one of claims 1 to 7, wherein the reduced immunogenicity of the low-immunogenic cells, such as the engineered low-immunogenic cells, comprises one or more of the following: i) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, a reduced or ablated myeloid cell response compared to the cells corresponding to the cells that have been modified but not genetically modified. ii) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, a reduced or ablated T cell response compared to the cells corresponding to the cells that have been modified but not genetically modified. iii) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, a reduced or ablated natural killer (NK) cell response compared to the cells corresponding to the cells that have been modified but not genetically modified. iv) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, a reduced or ablated neutralizing antibody response compared to the cells corresponding to the cells that have been modified but not genetically modified. v) When the low-immunogenic cells, such as the engineered low-immunogenic cells, are present in an allogeneic or non-MHC-matched subject, a reduced or ablated MHC class II-mediated response compared to the cells corresponding to the cells that have been modified but not genetically modified. vi) a reduced or ablated MHC class I-mediated response when the low immunogenicity cells, such as the engineered low immunogenicity cells, are present in an allogeneic or non-MHC-matched subject, as compared to cells corresponding to the modified but non-genetically modified cells; and vii) a reduced or ablated allogeneic host rejection of the graft when the low immunogenicity cells, such as the engineered low immunogenicity cells, are present in an allogeneic subject, as compared to cells corresponding to the modified but non-genetically modified cells.
9. The method according to any one of claims 4 to 8, wherein the immunogenic cells are human cells.
10. The method according to claim 9, wherein in the low immunogenicity cells, such as the engineered low immunogenicity cells: i) the expression of HLA class II molecules is reduced or ablated; ii) the expression of HLA-A, HLA-B, and / or HLA-C is reduced; and iii) the expression of HLA-E is reduced but still detectable.
11. The method according to any one of claims 4 to 10, wherein the method comprises forming at least one embryoid body or multicellular body from the genetically modified cells to produce the low immunogenicity cells, such as the engineered low immunogenicity cells.
12. The method according to any one of claims 4 to 11, further comprising determining the immunogenicity of the low immunogenicity cells, such as the engineered low immunogenicity cells.
13. The method according to any one of claims 1 to 12, further comprising administering the low immunogenicity cells, such as the engineered low immunogenicity cells, to an allogeneic or non-MHC-matched subject.
14. The method according to any one of claims 1 to 13, wherein the immunogenicity of the low immunogenicity cells, such as the engineered low immunogenicity cells, is altered as compared to immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, wherein the only difference between the low immunogenicity cells, such as the engineered low immunogenicity cells, and the immunogenic cells or the immunogenic human cells or the iPS human cells or iPS cells is that one or more of the RFX gene and optionally the CIITA gene, the B2M gene, and the CD58 gene in the immunogenic cells or the immunogenic human cells or the iPS human cells or iPS cells are not genetically modified.
15. The method according to any one of claims 1 to 14, wherein the immunogenic human cells or immunogenic cells are allogeneic or non-HLA-matched or non-MHC-matched to the cells, receptors, or polypeptides of the immune system of the recipient subject.
16. The method according to any one of claims 1 to 3 and 6 to 15, wherein altering the immunogenicity comprises balancing, reducing, or neutralizing the immunogenicity.
17. The method according to any one of claims 1 to 3 and 6 to 16, wherein altering the immunogenicity comprises reducing or neutralizing the myeloid cell response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
18. The method according to any one of claims 1 to 3 and 6 to 17, wherein altering the immunogenicity comprises reducing or neutralizing the T cell response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
19. The method according to any one of claims 1 to 3 and 6 to 18, wherein altering the immunogenicity comprises reducing or neutralizing the natural killer cell response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
20. The method according to any one of claims 1 to 3 and 6 to 19, wherein altering the immunogenicity comprises reducing or neutralizing the antibody response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
21. The method according to any one of claims 1 to 3 and 6 to 20, wherein altering the immunogenicity comprises reducing or neutralizing the allogeneic host's rejection of the graft.
22. The method according to any one of claims 1 to 3 and 6 to 21, wherein altering the immunogenicity comprises reducing or ablating the MHC class II-mediated response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
23. The method according to any one of claims 1 to 3 and 6 to 22, wherein altering the immunogenicity comprises reducing or neutralizing the MHC class I-mediated response for the hypoimmunogenic cells such as the engineered hypoimmunogenic cells.
24. The method according to any one of claims 1 to 23, wherein the RFX gene is RFX5, RFXANK or RFXAP.
25. The method according to claim 24, wherein two or more of RFX5, RFXANK and RFXAP are genetically modified.
26. The method according to claim 24 or claim 25, wherein each of RFX5, RFXANK and RFXAP is genetically modified.
27. The method according to any one of claims 1 to 26, further comprising genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces the expression of the CD58 protein.
28. The method according to claim 27, wherein genetically modifying the CD58 gene reduces or ablates the co-stimulatory immune cell response and / or weakens the formation of the immunological synapse.
29. The method according to any one of claims 1 to 28, further comprising genetically modifying the B2M gene, wherein genetically modifying the B2M gene reduces or ablates the expression of HLA class I molecules on the hypoimmunogenic cells such as the engineered hypoimmunogenic cells, optionally the HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-E and combinations thereof.
30. The method according to any one of claims 1 to 29 further comprises genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene reduces or ablates the expression of HLA class II molecules on the hypoimmunogenic cells such as engineered hypoimmunogenic cells.
31. The method according to any one of claims 1 to 30, wherein genetically modifying the RFX gene comprises: (i) modifying the DNA sequence of the RFX gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of the RFX mRNA by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or a combination thereof; or (iii) reducing or ablating the transcription of the RFX gene, optionally by recruiting or directing a transcriptional repressor to the RFX gene.
32. The method according to any one of claims 1 to 31, wherein genetically modifying the CIITA gene and / or the B2M gene and / or the CD58 gene comprises: (i) modifying the DNA sequence of the CIITA gene and / or the B2M gene and / or the CD58 gene, optionally by a CRISPR-Cas system; (ii) inhibiting the transcription or translation of the CIITA gene and / or the B2M gene and / or the CD58 gene by an RNAi system, optionally wherein the RNAi system comprises shRNA, siRNA, miR-adapted shRNA, or a combination thereof; or (iii) reducing or ablating the transcription of the CIITA gene and / or the B2M gene and / or the CD58 gene, optionally by recruiting or directing a transcriptional repressor to the CIITA gene and / or the B2M gene and / or the CD58 gene.
33. The method according to any one of claims 1 to 32, wherein the method further comprises genetically modifying at least one gene selected from the group consisting of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.
34. A non-naturally occurring hypoimmunogenic human cell, such as an engineered hypoimmunogenic human cell, produced by the method according to any one of claims 1 to 33.
35. A non-naturally occurring hypoimmunogenic human cell, such as an engineered hypoimmunogenic human cell, the cell comprising a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces the expression of RFX protein; optionally the hypoimmunogenic human cell such as an engineered hypoimmunogenic human cell further comprises one or more genes selected from the group consisting of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified beta-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.
36. A composition comprising the low-immunogenic human cells as claimed in claim 34 or 35, such as the engineered low-immunogenic human cells.
37. A gamma-delta T cell-derived induced pluripotent stem (iPS) human cell comprising a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces the expression of RFX protein; optionally the iPS human cell further comprises one or more genes selected from the group consisting of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified beta-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.
38. A composition comprising the iPS human cells as claimed in claim 37.
39. A method for engineering low immunogenicity, comprising: a) performing the step of genetically modifying the function of the regulatory factor X (RFX) gene of at least one immunogenic human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the immunogenic human cell; b) performing the step of forming at least one embryoid body or multicellular body from the cells in a) to produce at least one engineered low-immunogenic cell; c) performing the step of placing the engineered low-immunogenic cell in the immune system; and d) performing the step of determining the immunogenicity of the engineered low-immunogenic cell, wherein the immunogenicity is altered as compared to the immunogenic human cell in which the RFX gene is not genetically modified, optionally wherein step a) further comprises performing the step of genetically modifying the function of the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and / or the CD58 gene of the immunogenic human cell.
40. A method for engineering low immunogenicity, comprising: a) performing the step of reprogramming an immunogenic human cell to produce an induced pluripotent stem (iPS) human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor containing a gamma chain and a delta chain; b) performing the step of genetically modifying the function of the regulatory factor X (RFX) gene of the iPS human cell, wherein genetically modifying the RFX gene reduces the expression of RFX protein in the iPS human cell; c) performing the step of forming at least one embryoid body from the cells in step b) to produce at least one engineered low-immunogenic cell; d) performing the step of placing the engineered low-immunogenic cell in the immune system; and e) performing the step of determining the immunogenicity of the engineered low-immunogenic cell, wherein the immunogenicity is altered as compared to the iPS human cell in which the RFX gene is not genetically modified, optionally wherein step b) further comprises performing the step of genetically modifying the function of the class II major histocompatibility complex transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and / or the CD58 gene of the iPS human cell.
41. A method for engineering low immunogenicity, comprising: a) Performing the step of expressing the regulatory factor X (RFX) gene in immunogenic human cells for genetic modification to produce the function of engineered hypoimmunogenic cells, wherein the genetic modification of the RFX gene reduces the expression of the RFX protein in the immunogenic human cells; b) Performing the step of placing the engineered hypoimmunogenic cells in the immune system; and c) Performing the step of determining the immunogenicity of the engineered hypoimmunogenic cells, wherein the immunogenicity is altered compared to the immunogenic human cells in which the RFX gene is not genetically modified. Optionally, wherein step a) further includes performing the function of genetically modifying the class II major histocompatibility complex transactivator (CIITA) gene, β-2-microglobulin (B2M) gene, and / or CD58 gene in the immunogenic human cells.
42. A non-naturally occurring engineered hypoimmunogenic human cell, comprising a component that reduces the expression of the RFX protein through a genetically modified RFX gene, and / or a component that alters the immunogenicity of the engineered hypoimmunogenic human cell by the immune system compared to the immunogenic human cell in which the RFX gene is not genetically modified; optionally, wherein the engineered hypoimmunogenic human cell further comprises a component that reduces the expression of the CIITA protein, B2M protein, and / or CD58 protein through a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified CD58 gene.
43. A γδT cell-derived induced pluripotent stem (iPS) human cell, comprising a component that reduces the expression of the RFX protein through a genetically modified RFX gene, and / or a component that alters the immunogenicity of the iPS human cell by the immune system compared to the iPS human cell in which the RFX gene is not genetically modified; optionally, wherein the iPS human cell further comprises a component that reduces the expression of the CIITA protein, B2M protein, and / or CD58 protein through a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified CD58 gene.
Citation Information
Patent Citations
Valve with rolling diaphragms
EP0012193A1
Nuclease-mediated genome editing
EP3283625A1
Novel crispr enzymes and systems
EP3502253A1
Nucleic acid-guided nucleases
EP3642334A1
Nucleic acid-guided nucleases
US10337028B2