PAD-T cell targeting acute myelogenous leukemia cell as well as preparation method and application of PAD-T cell

By using layer-layer coating technology of poly-L-lysine and sodium alginate and DNA aptamers on T cells, PAD-T cells targeting acute myeloid leukemia cells are formed, solving the problems of poor efficacy of CAR-T cells in the treatment of AML and the safety challenges of GVHD, and achieving efficient AML targeted killing and reducing GVHD risks.

CN120204423APending Publication Date: 2025-06-27ANHUI MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510188410.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Existing CAR-T cells are not effective in the treatment of acute myeloid leukemia (AML), and the safety challenges associated with donor lymphocyte infusion-related graft-versus-host disease (GVHD) affect the efficacy.

Method used

The nanofilm was coated with the outer layer of T cells through electrostatic adsorption principle to form PAD-T cells targeting acute myeloid leukemia cells.

Benefits of technology

It improves the targeted killing ability of PAD-T cells to AML cells, reduces the incidence of GVHD, ensures cell viability and coating rate, and has high clinical application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120204423A_ABST
    Figure CN120204423A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to a PAD-T cell targeting acute myelogenous leukemia cells and a preparation method and application of the PAD-T cell. The PAD-T cell comprises a T cell, a capsule shell coating the T cell, and a DNA aptamer connected with the capsule shell; wherein the capsule shell is formed by alternately overlapping a first polylysine layer, a first sodium alginate layer and a second polylysine layer, the DNA aptamer layer is an S30-T1 DNA aptamer, and the nucleotide sequence is as shown in SEQ ID NO. 1. According to the invention, the peripheral blood mononuclear cells of a healthy donor can be prepared on a large scale by utilizing a nano coating technology, and the recurrence after hematopoietic stem cell transplantation can be effectively relieved and the occurrence of GVHD can be reduced by combining an immune isolation concept and a biological material-nucleic acid material coated immune cell technology; the clinical application prospect is very high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technologies, and particularly relates to a PAD-T cell targeting acute myeloid leukemia cells, a preparation method thereof, and an application thereof. Background Art

[0002] Cell therapy is a new disease treatment technology that has emerged in recent years. It refers to using the characteristics of certain cells with specific functions, obtaining them by bioengineering methods and / or through in vitro amplification, special culture, etc., and then generating cells with powerful specific functions. After being transfused into the body, the purpose of treating diseases can be achieved.

[0003] At present, CAR-T cells have achieved good curative effects in the treatment of B-lymphocyte leukemia. However, due to the lack of specific targeting antigens, CAR-T treatment for acute myeloid leukemia (AML) has not achieved good curative effects.

[0004] Allogeneic hematopoietic stem cell transplantation (HSCT) is currently the main method for clinically curing hematological malignancies. It has a good therapeutic effect especially on refractory / relapsed AML with poor effects after chemotherapy or targeted drug use. And recurrence is one of the main reasons for the failure of HSCT in treating hematological malignancies. The prognosis of recurrence after transplantation is poor, but there is no effective treatment measure. Traditional treatment methods include discontinuing immunosuppressants, chemoradiotherapy, and secondary transplantation. The development of donor lymphocyte infusion (DLI) has brought hope for alleviating recurrence after transplantation. In recent years, although DLI treatment has greatly improved recurrence after transplantation, the safety such as infusion-related graft-versus-host disease (GVHD) still faces challenges and affects the curative effect of DLI.

[0005] Improving the killing ability of donor lymphocytes in DLI against AML cells and reducing the incidence of GVHD are the bottlenecks in the clinical DLI treatment of recurrence after transplantation.

[0006] A related patent (ZL 2021 1 1025332.1) has disclosed a GA-T cell, a preparation method thereof, and an application thereof in leukemia and anti-GVHD. The GA-T cell is obtained by coating donor lymphocytes through layer-by-layer self-assembly using a cationic material, amino-gelatin, and an anionic material, sodium alginate, and is used to prevent the occurrence of GVHD in allogeneic hematopoietic stem cell transplantation. However, developing a new technology that can both prevent GVHD and target and kill tumors is a bottleneck problem that needs to be broken through clinically. Summary of the Invention

[0007] To solve the above technical problems, one of the objectives of the present invention is to provide a PAD-T cell targeting acute myeloid leukemia cells.

[0008] The technical solution adopted by the present invention is as follows: A PAD-T cell targeting acute myeloid leukemia cells, comprising a T cell, a capsule shell coating the T cell, and a DNA aptamer connected to the capsule shell; the capsule shell is composed of an alternating stack of a first polylysine layer, a first sodium alginate layer, and a second polylysine layer, and the DNA aptamer layer is an S30-T1 DNA aptamer, and the sequence is as shown in SEQ ID NO.1.

[0009] The DNA aptamer is a long DNA chain containing n units of the S30-T1 DNA aptamer. Preferably, n is 1000 - 5000; more specifically, such as 2000 - 4000, 2500 - 3500.

[0010] Another objective of the present invention is to provide a preparation method of the PAD-T cell targeting acute myeloid leukemia cells as described above, comprising the following steps: S1. Processing the screened qualified T cells into a single-cell suspension; S2. Adding a polylysine solution to the cell suspension and incubating to adsorb polylysine on the surface of the T cells to form a first polylysine layer; S3. Adding a sodium alginate solution and incubating to wrap sodium alginate outside the first polylysine layer to form a first sodium alginate layer; S4. Repeating step S2 to form a second polylysine layer; S5. Adding a DNA rolling circle amplification system solution to the cell suspension in step S4 and incubating to obtain the required PAD-T cells; the DNA rolling circle amplification system solution includes a DNA aptamer primer strand, a DNA aptamer template strand, a ligase, a DNA polymerase, and deoxyribonucleoside triphosphate, the sequence of the DNA aptamer primer strand is as shown in SEQ ID NO.2, and the sequence of the DNA aptamer template strand is as shown in SEQ ID NO.3.

[0011] Preferably, the single dosage of the polylysine solution is 1 mL / 10 5-7 T cells, preferably 1 mL / 10 6 T cells, the single dosage of the sodium alginate solution is 1 mL / 10 5-7 T cells, preferably 1 mL / 10 6T cells, the volume ratio of the material solution to the T cell suspension is 0.5 - 1.5 - : 0.5 - 1.5, preferably 1:1, and the incubation time is 2 - 60 min.

[0012] Preferably, the specific steps of DNA rolling circle amplification are as follows: S51. Mix the DNA aptamer primer strand, DNA aptamer template strand and ligase buffer, and perform PCR annealing; S52. Add T4 ligase and incubate; S53. Add Φ29 DNA polymerase, deoxynucleoside triphosphate, bovine serum albumin, and Φ29 DNA polymerase reaction solution, mix with the cell suspension in step S4, and incubate to obtain the required PAD - T cells.

[0013] In the specific embodiment, the addition amount of the DNA aptamer template strand is 0.4 - 0.8 μM, such as 0.6 μM, the addition amount of the DNA aptamer primer strand is 1.0 - 1.4 μM, such as 1.2 μM, then add 10× ligase buffer, and make up the volume with deionized water; specifically, the final reaction system based on DNA rolling circle amplification is set to 100 μl.

[0014] Preferably, according to the following PCR program: anneal at 95°C for 2 min, 65°C for 30 min, 50°C for 30 min, 37°C for 30 min, 22°C for 30 min. After annealing is completed, add T4 ligase with an addition amount of 10 U / μL. After incubation for 3 h, the addition amount of Φ29 DNA polymerase is 2 U / μL, the addition amount of deoxynucleoside triphosphate is 2 mM / μL, and add deionized water to make up the volume to 100 μL.

[0015] The ratio of the total volume of the rolling circle amplification reaction system to the volume of the cell suspension is 1:5 - 15, preferably 1:9 - 11, specifically 1:10.

[0016] Preferably, the incubation time in step S52 is 3 h, and the incubation time in this step S53 is 1 - 2 h.

[0017] The third object of the present invention is to provide an application of the PAD - T cells targeting acute myeloid leukemia cells as described above in the preparation of a drug for relieving infusion - related graft - versus - host disease.

[0018] The fourth object of the present invention is to provide an application of the PAD - T cells targeting acute myeloid leukemia cells as described above in the preparation of a drug for treating recurrence after hematopoietic stem cell transplantation.

[0019] The beneficial effects of the present invention are as follows: By using the biopolymer materials poly-L-lysine and sodium alginate and the nucleic acid material DNA aptamer, a nano-film is assembled by layer-by-layer coating outside T cells through the principle of electrostatic adsorption. The biomaterial layer and the DNA aptamer layer respectively play the roles of immune isolation and targeting acute myeloid leukemia cells. This application can perform single-cell coating on T cells, thereby regulating proliferation, differentiation, and cell-cell interactions, etc.

[0020] More specifically, CD33 is a myeloid differentiation antigen that is highly expressed on AML blasts in most patients and may be expressed on leukemia stem cells in some patients. Therefore, it has been used as a therapeutic target in cell therapy for many years. As mentioned in a review published in "Blood", there are currently studies on CD33 CAR-T cells for killing AML cells, but there are safety problems of bone marrow toxicity. The present invention creatively incorporates a nucleic acid aptamer targeting CD33 on the coated T cells, and synthesizes an ultra-long nucleotide single strand containing the nucleic acid aptamer through rolling circle amplification technology. The nucleotide single strand is adsorbed on the T cell coating layer through electrostatic interaction to form a four-layer nano-film of biomaterial-nucleic acid material, improving safety. This application ensures the targeting of the DNA aptamer to CD33 highly expressed in AML. PAD-T cells can target and kill AML cells through the outermost DNA aptamer layer without affecting normal cells.

[0021] The method of the present invention ensures the optimal viability and coating rate of PAD-T cells. After four-layer coating (Poly-L-lysine (PLL)-Alginate-Poly-L-lysine-S30-T1 DNA aptamer), PAD-T cells form a relatively smooth capsule shell. The outermost DNA aptamer layer and poly-L-lysine of PAD-T cells gradually degrade within 96 h. And PAD-T has a potential and proliferation ability similar to immune cells. In addition, PAD-T has a stronger mechanical hardness than conventional T cells and can still maintain good cell viability under the action of repeated centrifugal forces of 3000-5000 rpm five times and in an environment with PH ≤ 6.5 or ≥ 8.

[0022] According to the present invention, the nano-coating technology can be used to prepare a large number of peripheral blood mononuclear cells from healthy donors for the treatment of post-transplant recurrence in allogeneic tumor patients. In the case of recurrence after hematopoietic stem cell transplantation, by combining the immune isolation concept in this application with the technology of coating immune cells with biomaterial-nucleic acid materials, and optimizing the means of timely inhibiting recurrence by donor lymphocyte infusion clinically, not only the effect of tumor killing in the case of recurrence is improved, but also the occurrence of GVHD is significantly alleviated, having extremely high clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the flow cytometry diagram of the coating efficiency of the DNA aptamer layer in this application.

[0024] Figure 2 This is the flow cytometry diagram of the DNA aptamer targeting AML cells in this application.

[0025] Figure 3 This is the confocal laser scanning microscopy diagram of the DNA aptamer targeting AML cells in this application.

[0026] Figure 4 This is the fluorescence observation diagram of the coating material layer of PAD-T in this application.

[0027] Figure 5 This is the cell potential detection diagram of PAD-T in this application.

[0028] Figure 6 This is the flow cytometry diagram for detecting the proliferation ability of PAD-T by CFSE method in this application.

[0029] Figure 7 This is the diagram for testing the resistance of PAD-T to physical stress and external environment in this application.

[0030] Figure 8 This is the diagram for detecting the cytokine release level of PAD-T cells by enzyme-linked immunosorbent assay (ELISA) in this application.

[0031] Figure 9 This is the flow cytometry diagram of PAD-T targeting and killing AML cells.

[0032] Figure 10 This is the flow cytometry detection of PAD-T killing AML cells by Annexin V - PI apoptosis kit.

[0033] Figure 11 This is the flow cytometry diagram of the activation markers of co-cultured PAD-T and mouse macrophages. Detailed implementation manners

[0034] For ease of understanding, the technical solutions of the present invention will be described in more detail below in conjunction with embodiments.

[0035] In this application, PAD-T cells: P is poly-L-lysine, A is alginate, and D is DNA aptamer.

[0036] Unless otherwise specified, various raw materials, reagents, instruments, and equipment used herein can be purchased through the market or prepared by existing methods.

[0037] Example 1. Preparation of PDA-T cells 1. Extraction and amplification of mouse T cells, including the following steps: S1. Preparation of spleen lymphocytes: Under sterile conditions, take the spleens of normal C57BL / 6 mice. Place 4 - 5 mL of lymphocyte separation medium in a 35 mm sterile culture dish. Place the mouse spleen in the sterile culture dish and gently grind and filter it through a 200 - mesh cell sieve using the syringe core of a 5 mL syringe. Immediately transfer the filtrate containing spleen cells to a 15 mL centrifuge tube, covering it with 200 - 500 μL of RPMI medium (to keep the liquid interface distinct). Centrifuge at 800 g for 30 min at room temperature. Aspirate the lymphocyte layer, then add 10 mL of RPMI medium and invert to wash. Centrifuge at 250 g for 10 min at room temperature to collect the cells. Resuspend the cells in serum - free RPMI for counting and adjust to the required number of cells for standby; stain with trypan blue and count the number of viable cells.

[0038] S2. Magnetic bead sorting: Resuspend the spleen lymphocytes prepared in S1 (add 100 μL of MACS buffer (magnetic beads for cell sorting) to every 10 7 cells), incubate with magnetic beads for negative sorting of CD3 T cells for 15 minutes. After washing (300 g / 10 min), resuspend with separation buffer. Add the labeled cell suspension to the sorting column, and then elute 3 times with buffer. The labeled cells are separated, and the unlabeled T cells are collected. Primary T cells are obtained.

[0039] S3. In vitro amplification culture of mouse T cells: Seed the primary T cells obtained in S2 at a density of 1×10 6 mL into 10 (V / V)% RPMI medium (2 mM L - glutamine, 10% fetal bovine serum, and 100 U / mL penicillin / streptomycin). Add the mouse T cell activator Con A (1 mg / mL). Add 30 U / mL of rIL - 2 and culture in a CO2 incubator at 37 °C. Observe the cell size and shape. When the cell density exceeds 2.5×10 6 cells / mL or the medium turns yellow, aliquot the culture medium into the medium containing 30 U / mL of rIL - 2, and adjust the density back to 0.5 - 1×10 6 cells / mL. An amplified culture of T cell suspension is obtained.

[0040] 2. Coating T cells with poly - L - lysine and sodium alginate in three layers Prepare poly - L - lysine solutions and 0.25 w / v% sodium alginate solution at room temperature, and adjust the pH to 7.3 - 7.5. Different concentrations of poly - L - lysine solutions are shown in Table 1 below. The physiological saline used for preparation is 0.9 wt% physiological saline.

[0041] Table 1 Table of poly - L - lysine solutions with different concentrations

[0042] The prepared amplified and cultured T cell suspension was washed with Dulbecco's phosphate buffered saline to remove residual proteins. Then, it was centrifugally washed with Dulbecco's phosphate buffered saline (1500 rpm, 5 min). After counting, it was resuspended into a single cell suspension of 1×10 6 cells / mL. 1 mL was taken and added into a 6-well plate, and then any one of the poly-L-lysine solutions with the concentrations in Table 1 was added. It was gently mixed, and blown gently several times to ensure uniform dispersion. Then, it was placed in a constant temperature shaking incubator and shaken and mixed (500 rpm) for incubation, and mixed once every 2 min, so that the positively charged poly-L-lysine in the poly-L-lysine solution was adsorbed on the negatively charged cell surface, completing the first layer coating of polylysine.

[0043] The cells were transferred into a 15 mL centrifuge tube, centrifuged at 1500 rpm for 5 min. After washing away the components of the excess poly-L-lysine solution, the supernatant was removed, and then 5 mL of Dulbecco's phosphate buffered saline was added for washing twice to remove the unadsorbed poly-L-lysine. Subsequently, 1 mL of 0.25 w / v% sodium alginate solution was added, gently mixed, and blown gently several times to ensure uniform dispersion. Then, it was placed in a constant temperature shaking incubator and shaken and mixed (500 rpm) for 15 min for incubation, and mixed once every 3 min, so that the negatively charged sodium alginate was adsorbed on the positively charged polylysine surface layer, obtaining the second sodium alginate coating layer.

[0044] After the cells were washed and centrifuged, the polylysine layer coating step was repeated to complete the third polylysine coating layer. Table 2 shows the coating efficiency of the poly-L-lysine layer at different concentrations and different incubation times.

[0045] Table 2 Coating effects at different incubation times and different concentrations (unit: %)

[0046]

[0047] Remarks: 1. The coating effect is based on the effective coating rate (%) of single cells; 2. "―" indicates obvious aggregation occurred and the effective coating rate could not be calculated.

[0048] Single cells coated with poly-L-lysine solutions at different concentrations (0.001%, 0.01%, 0.1%) for different incubation times (10 min, 20 min, 30 min, 40 min) were observed. From the perspective of the coating rate, the coating rate obtained with 0.01% poly-L-lysine solution incubated for 10 min was relatively high, and the coating efficiency was nearly 90%. Therefore, it is preferred to incubate with 0.01 g / 100 ml poly-L-lysine solution for 10 min to prepare the first polylysine layer and the third polylysine layer.

[0049] 3. S30-T1 DNA Aptamer-Coated T Cells Based on Rolling Circle Amplification 3.1 Preparation of S30-T1 DNA Aptamer Prepare the reaction system for S30-T1 DNA aptamer based on rolling circle amplification reaction: Among them, the S30-T1 DNA aptamer sequence is as follows: TTATAGGGGCTGGACAAAATTCTACCCAGCCTTTTCTGA (SEQ ID NO.1).

[0050] The DNA template strand and primer strand containing S30-T1 DNA aptamer are as follows: S30-T1 primer strand: ACAAAATTCTACCCAGCCTTGCTGCTGC (SEQ ID NO.2); S30-T1 circular DNA template strand: 5’-P: GAATTTTGTCCAGCCCCTATAATGCTGCTGCCACGTATCACCAGGCGCAGCAGCATCAGAAAAGGCTGGGTA-3’ (SEQ ID NO.3).

[0051] These two strands are used to prepare a hydrogel containing S30-T1 DNA aptamer by DNA rolling circle amplification reaction.

[0052] First, configure a 50 μL reaction system of T4 ligase buffer: add the above 0.6 μM phosphorylated S30-T1 circular DNA single-stranded template and 1.2 μM S30-T1 primer strand to the reaction system, then add 5 μl of 10× ligase buffer, and make up the volume to 50 μL with water. After mixing the above system, perform annealing treatment according to the conditions of 95℃ / 2min - 65℃ / 30min - 50℃ / 30min - 37℃ / 30min - 22℃ / 30min. After annealing, continue to add 0.5 μL of T4 ligase to the above system, mix well and let it stand at room temperature for 3 h to connect the 5’ end and 3’ end of the phosphorylated linear template. After adding T4 ligase, the molecular weight of the resulting product increases significantly, indicating that the 5’ end and 3’ end of the linear template are successfully connected.

[0053] Add 10 μL of phi 29 DNA polymerase, 2 μL of deoxynucleoside triphosphate, and 0.5 μL of bovine serum albumin solution to the DNA template and primer reaction system ligated with T4 ligase as described above. Then add 10 μL of 10×phi29 DNA polymerase reaction buffer, and then add it to a centrifuge tube containing 100 μL of the prepared T cells coated with three layers of biomaterials. Incubate the above reaction system at 37 °C for 30 min, 1 h, and 2 h respectively. After the reaction, add centrifugal washing to terminate the rolling circle amplification reaction, complete the coating, and obtain T cells coated with poly-L-lysine—sodium alginate—poly-L-lysine—S30-T1 DNA aptamer, namely PAD-T cells.

[0054] Example 2. Flow cytometry detection of the coating efficiency of the S30-T1 aptamer layer at different rolling circle amplification reaction times Before rolling circle amplification, add fluorescein isothiocyanate (FITC) to make the synthesized DNA aptamer carry an FITC fluorescent label, and prepare PAD-T cells referring to the steps of Example 1. Detect the fluorescently labeled DNA aptamer layer on PAD-T cells at a wavelength of 488 nm by flow cytometry, and analyze the coating efficiency of the DNA aptamer layer. The results are shown in Table 3 and Figure 1 as follows.

[0055] Table 3 and Figure 1 The results show that: at different rolling circle amplification reaction times (30 min, 1 h, 2 h), the results of the S30-T1 DNA aptamer layer coating show that a higher coating rate is obtained at 1 h of rolling circle amplification reaction, and the coating efficiency is over 80%. Figure 1 The flow cytometry peak diagram of also shows the above results.

[0056] Table 3 Coating effects at different rolling circle amplification reaction times (unit: %)

[0057] Example 3. Flow cytometry detection of the targeting of S30-T1 aptamer to AML cells Prepare the DNA aptamer according to the steps of Example 1, and add FITC before rolling circle amplification to make the synthesized DNA aptamer carry an FITC fluorescent label. Add the fluorescently labeled DNA aptamer to 1×10 6 AML cells or bone marrow cells and incubate at 37 °C for 24 h. Collect the AML cells or bone marrow cells, wash and centrifuge the cells with PBS and resuspend them, and then detect the fluorescently labeled DNA aptamer in the AML cells or bone marrow cells at a wavelength of 488 nm by flow cytometry, so as to analyze the targeting of the S30-T1 DNA aptamer to AML cells.

[0058] Figure 2The results showed that the flow cytometry peaks of the AML cell (Molm-13 and WEHI-3B) groups shifted to the right, indicating that the fluorescent S30-T1 DNA aptamer successfully targeted AML cells. However, the flow cytometry peaks of the bone marrow cell group did not shift significantly to the right, indicating that the S30-T1 DNA aptamer had specific targeting effects on AML cells.

[0059] Example 4. Detection of the targeting ability of S30-T1 aptamer to AML cells by laser confocal microscopy Collect the AML cells or bone marrow cells after co-incubation in Example 3, add 2.5% glutaraldehyde to fix for 10 minutes, then add DAPI (4',6-diamidino-2-phenylindole) to incubate for 15 minutes for cell staining. After washing, centrifuging, and resuspending with phosphate buffer, detect the fluorescence expression by laser confocal microscopy at wavelengths of 405 nm and 488 nm.

[0060] Figure 3 The results showed that the S30-T1 DNA aptamer had high targeting ability to AML cells and did not target normal bone marrow cells.

[0061] Example 5. Detection of poly-L-lysine and DNA aptamer-coated PAD-T cells by fluorescence microscopy Referring to Example 1, prepare PAD-T cells using poly-L-lysine labeled with CY5 and DNA aptamer labeled with FITC, centrifuge and separate them, wash with washing buffer (50 mL phosphate buffer + 50 μL Tween), and then count. Pipette about 1×10 6 PAD-T cells, centrifuge to discard the supernatant, add fixative to fix at room temperature for 15 min, centrifuge and wash to discard the supernatant, then add 100 µL of 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) staining solution, and incubate in the dark at room temperature for 30 min. Wash with washing buffer (500 μL / tube); after resuspending and centrifuging, discard the supernatant, leave 20 - 30 μl of supernatant in each tube, resuspend the cells evenly, drop them on a glass slide, smear evenly, and air dry naturally; then drop a small drop of anti-quenching mounting medium, carefully take out the cover glass, place the cells facing down, and gently tap on the mounting medium. Observe the surface fluorescence of the cells under a laser confocal microscope (excitation wavelengths 358 nm, 488 nm, 647 nm). The observation results under the laser confocal microscope are shown in Figure 5 .

[0062] Figure 4 The results in showed that the surface of the coated PAD-T cells carried the fluorescence of poly-L-lysine and DNA aptamer.

[0063] Example 6. Detection of the potential of PAD-T cells Prepare PAD-T cells with reference to Example 1. Take the cell samples before coating and the samples after each layer of coating: cells (Control), cells - poly-L-lysine (1 st PLL), cells - poly-L-lysine - sodium alginate (2 nd ALG), cells - poly-L-lysine - sodium alginate - poly-L-lysine (3 rd PLL), cells - poly-L-lysine - sodium alginate - poly-L-lysine - S30-T1 DNA aptamer (4 th S30-T1). Measure the surface potential change of PAD-T during the whole coating process with a Malvern nanoparticle size and zeta potential analyzer. The results are shown in Figure 4 .

[0064] It can be seen from Figure 5 that after four-layer coating, there is no significant change in the surface potential of PAD-T compared with that before coating (i.e., normal T cells).

[0065] Example 7. Detection of the proliferation ability of PAD-T by CFSE Prepare PAD-T cells with reference to Example 1. Resuspend PAD-T or conventional uncoated T cells with the staining working solution to a cell concentration of approximately 10 7 / mL. Incubate in a 37°C incubator for 20 minutes, centrifuge and remove the supernatant, wash the cells 1 - 2 times with PBS, add 10 (V / V)% RPMI medium, inoculate the cells in a 24-well plate (1×10 6 cells / well), add the mouse T cell activator ConA (1 mg / mL), add 30 U / mL rIL-2, and culture in a 37°C incubator for 48 h. Collect the cells, incubate with Anti-CD3-PE for 30 min to label T cells, centrifuge and wash, and detect the expression of CD3 and CFSE with a flow cytometer (collect the cells at 0 h before culture and label CD3 as a blank control). The results are shown in Figure 5 .

[0066] Figure 6 It shows that after stimulation with the stimulant, there is no significant difference in the proliferation ability of CD3+PAD-T detected by CFSE and conventional CD3+T cells.

[0067] Example 8. Test the physical stress and resistance to the external environment of PAD-T cells Prepare PAD-T cells with reference to Example 1. Collect the coated PAD-T or conventional uncoated T cells and add them to a 1.5 mL EP tube (about 1×10 6(samples) were treated with different physical stresses generated by different centrifugation speeds (1000 rpm, 1500 rpm, 2000 rpm, 3000 rpm, 4000 rpm, 5000 rpm) five times repeatedly. Then the cells were resuspended with 10 (V / V)% RPMI medium and inoculated into 96-well plates (10 μL / well), and cultured in an incubator at 37°C for 12 h. The cell viability of each group was detected by the CCK-8 method. The results are shown in Figure 6 Figure A in

[0068] Collect the coated PAD-T or conventional uncoated T cells and add them into 1.5 mL EP tubes (about 1×10 6 ), resuspend the cells with 10 (V / V)% RPMI medium, adjust the pH of the solution to 5.5, 6.5, 7.5, 8, 9 respectively to simulate different external environments, inoculate into 96-well plates (10 μL / well), and culture in an incubator at 37°C for 12 h. The cell viability of each group was detected by the CCK-8 method. The results are shown in Figure 6 Figure B in

[0069] Figure 7 The results showed that conventional T cells and PAD-T were treated with different physical stresses generated by different centrifugation speeds (1000 rpm, 1500 rpm, 2000 rpm, 3000 rpm, 4000 rpm, 5000 rpm), centrifuged for 5 min each time, and repeated 5 times. The cell viability was detected by the CCK-8 method. Compared with conventional T cells, PAD-T had a certain mechanical strength and could significantly reduce the physical destructive force generated by 2000 - 5000 rpm. *p<0.05, **p<0.01 (±s, n = 5). Different solution environments (pH = 5.5, 6.5, 7.5, 8, 9) were used to simulate different external environments. After culture, the cell viability was detected by the CCK-8 method. PAD-T had a certain effect on resisting the external environment and could significantly reduce the influence on cell viability caused by acidity (pH ≤ 6.5) and alkalinity (pH ≥ 8). *p<0.05, **p<0.01 (±s, n = 5).

[0070] Example 9: Enzyme-linked immunosorbent assay (ELISA) was used to test the cytokine secretion level of PAD-T cells Refer to Example 1 to prepare PAD-T cells. Collect single-cell coated PAD-T, add 10 (V / V)% RPMI medium and inoculate into 96-well plates (1×10 5The cells were cultured in a 5 (V / V) % CO2 incubator at 37°C. Cell supernatant samples were collected at 24 h and 72 h. The samples and standards (100 µL / well) were added into the antibody-coated ELISA sandwich wells. The biotinylated antibody working solution (50 µL / well) was added, and the mixture was thoroughly mixed using a micro shaker. The reaction wells were sealed with sealing tape and incubated at room temperature for 120 min. 350 µL of washing solution was added to each well, and the liquid was discarded by centrifugation after standing for 30 s. This washing step was repeated 4 times. The enzyme-conjugated working solution (100 µL / well) was added, and the plate was incubated at room temperature for 30 min. After washing the plate four times, 100 µL of chromogenic reagent was added to each well, and the plate was incubated at room temperature in the dark for 10 - 20 min. 100 µL of stop solution was added to each well, and the OD value at 450 nm was measured immediately after mixing. Conventional uncoated T cells were used as controls.

[0071] The results are shown in Figure 8 , and enzyme-linked immunosorbent assay (ELISA) detection showed that after stimulation with ConA, PAD-T coating did not affect the secretion levels of TNF-α (Figure A), IL-2 (Figure B), and IFN-γ (Figure C) within 72 h (±s, n = 5).

[0072] Example 10: Detection of PAD-T cell-targeted killing of AML cells by flow cytometry Refer to Example 1 to prepare PAD-T cells. AML cells (WEHI-3B) or bone marrow cells were resuspended to 1×10 6 cells / mL. CellTrace Far Red cell proliferation tracking reagent was added, and the cells were incubated at 37°C for 15 min to stain and label AML cells (WEHI-3B) or bone marrow cells. Then, the cells were resuspended with 100 µL of 10 (V / V) % RPMI medium. 1×10 6 PAD-T cells were added to the above cell suspension, and the mixture was incubated in a 24-well plate at 37°C for 12 h. The suspended cells in the wells were carefully extracted, incubated with Anti-CD3-PE for 30 min to label T cells, and after centrifugation and washing, the expression of CD3 and Far Red labels was detected by flow cytometry, with uncoated T cells used as controls.

[0073] Figure 9 The results showed that PAD-T cells had a significant targeted effect on AML cells (WEHI-3B) compared to uncoated T cells, but did not have a significant targeted effect on bone marrow cells.

[0074] Example 11: Detection of PAD-T killing of AML cells by flow cytometry using Annexin V - PI apoptosis kit Collect the AML cells (WEHI-3B) or bone marrow cells in the co-culture system of Example 9, centrifuge and wash them, resuspend the cells in 300 µL of staining buffer, add 5 - 10 µL of FITC-Annexin V reagent and stain for 10 minutes, then add 5 µL of PE-PI reagent and stain for 10 minutes, centrifuge and wash, and detect the apoptosis of AML cells (WEHI-3B) or bone marrow cells by flow cytometry.

[0075] Figure 10 The results showed that late apoptotic cells or dead cells would be shown in the upper right corner of the flow cytometry plot. The PAD-T cell group had a stronger killing effect on AML cells (WEHI-3B) compared to the uncoated T cell group, while there was no obvious killing effect on bone marrow cells.

[0076] Example 12: Detection of activation markers on the surface of PAD-T cells by flow cytometry After inducing RAW264.7 cells into mouse macrophages by adding 1 µg / mL LPS, add the PAD-T cells prepared according to Example 1 and co-culture them in a 24-well plate for 3 days or 6 days. Uncoated T cells were used as the control group, and the co-culture ratio was 1:10. Collect the T cells, add Anti-FITC-CD25 and incubate for 30 min, and detect the expression of CD25 in PAD-T cells by flow cytometry.

[0077] Figure 11 The results showed that after co-culturing for 3 days and 6 days, the expression of CD25 in the PAD-T cell group was significantly lower than that in the uncoated T cell group, indicating that the coating significantly delayed the activation of T cells by heterologous antigen presentation.

[0078] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the present invention; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be included within the protection scope of the present invention.

Claims

1. A PAD-T cell targeting acute myeloid leukemia cells, characterized in that: It comprises a T cell, a capsule encapsulating the T cell, and a DNA adaptor connected to the capsule; The capsule shell is composed of a first poly-lysine layer, a first sodium alginate layer, and a second poly-lysine layer alternately stacked, the capsule shell thickness is 400-800nm, and the PAD-T cell diameter is 7.4-8.5μm; The DNA aptamer layer is S30-T1 DNA aptamer.

2. The PAD-T cell targeting acute myeloid leukemia cells according to claim 1, characterized in that: The DNA aptamer is a base sequence synthesized by artificial screening and purified by PAGE, and the sequence is shown in SEQ ID NO.1; The DNA aptamer is a long DNA chain comprising n S30-T1 DNA aptamer units; preferably, n is 1000-5000; more specifically, 2000-4000, 2500-3500.

3. A method for preparing PAD-T cells targeting acute myeloid leukemia cells as claimed in claim 1, characterized in that: The following steps are involved: S1. Process the qualified T cells into single cell suspension; S2. adding a poly-lysine solution to the cell suspension and incubating the cell suspension to allow the poly-lysine to adsorb on the surface of the T cells to form a first poly-lysine layer; S3. Adding sodium alginate solution and incubating to wrap sodium alginate around the outside of the first poly-lysine layer to form a first sodium alginate layer; S4. Repeat step S2 to form a second poly-lysine layer; S5. Add the DNA rolling circle amplification system solution to the cell suspension in step S4, and incubate to obtain the desired PAD-T cells; The DNA rolling circle amplification system solution includes the DNA adaptor primer chain, the DNA adaptor template chain, a ligase, a DNA polymerase and deoxyribonucleoside triphosphates; specifically, the nucleotide sequence of the DNA adaptor primer chain is shown in SEQ ID NO.2, and the nucleotide sequence of the DNA adaptor template chain is shown in SEQ ID NO.

3.

4. The method for preparing PAD-T cells targeting acute myeloid leukemia cells according to claim 3, characterized in that: The single dosage of the poly-lysine solution is 1 mL / 10 5-7 T cells, preferably 1mL / 10 6 The single dose of sodium alginate solution for each T cell is 1mL / 10 5-7 T cells, preferably 1mL / 10 6 The volume ratio of the material solution to the T cell suspension is 0.5-1.5:0.5-1.5, preferably 1:1, and the incubation time is 2-60 min.

5. The method for preparing PAD-T cells targeting acute myeloid leukemia cells according to claim 3, characterized in that: The specific steps of DNA rolling circle amplification are: S51. Mixing DNA adapter primer strand, DNA adapter template strand and ligase buffer, PCR annealing; S52. Add T4 ligase and incubate; S53. Add Φ29 DNA polymerase, deoxyribonucleoside triphosphate, bovine serum albumin, and Φ29 DNA polymerase reaction solution, mix with the cell suspension in step S4, and incubate to obtain the desired PAD-T cells.

6. The method for preparing PAD-T cells targeting acute myeloid leukemia cells according to claim 5, characterized in that: The amount of the DNA aptamer template chain added is 0.4-0.8 μM, such as 0.6 μM, the amount of the DNA aptamer primer chain added is 1.0-1.4 μM, such as 1.2 μM, and then 10× ligase buffer is added, and the volume is supplemented with deionized water; specifically, the final reaction volume based on DNA rolling circle amplification is set to 100 μl.

7. The method for preparing PAD-T cells targeting acute myeloid leukemia cells according to claim 6, wherein the reaction of DNA rolling circle amplification is annealed according to the PCR program at 2 min-95°C, 30 min-65°C, 30 min-50°C, 30 min-37°C, and 30 min-22°C. After annealing, T4 ligase is added in an amount of 10U / μL. After 3h of incubation, Φ29 DNA polymerase is added in an amount of 2U / μL, deoxyribonucleoside triphosphate is added in an amount of 2mM / μL, and deionized water is added to make up the volume to 100μL. The ratio of the total volume of the rolling circle amplification reaction system to the volume of the cell suspension is 1:5-15, preferably 1:9-11.

8. The method for preparing PAD-T cells targeting acute myeloid leukemia cells according to claim 5, characterized in that: The incubation time in step S52 is 3 h, and the incubation time in step S53 is 1-2 h.

9. Use of the PAD-T cells targeting acute myeloid leukemia cells as claimed in claim 1 or 2 in the preparation of a drug for alleviating infusion-related graft-versus-host disease.

10. Use of the PAD-T cells targeting acute myeloid leukemia cells as claimed in claim 1 or 2 in the preparation of a drug for treating relapse after hematopoietic stem cell transplantation.

Citation Information

Patent Citations

  • Alginate-epsilon-polylysine microcapsules and preparation and application thereof

    CN102101036A

  • GA-T cell, preparation method thereof and application thereof in leukemia and GVHD resistance

    CN113584012A

  • Cascade targeting drug for resisting acute myelogenous leukemia and preparation method thereof

    CN117797267A