Multi-effect protein MEL3 and application thereof
By modifying the amino acid sequence of biodefensin, the pleiotropic protein MEL3 was developed, which solved the disadvantages of existing antibacterial and antiviral agents, achieved broad-spectrum antibacterial, anti-inflammatory and antiviral effects, and reduced the risk of drug resistance.
Patent Information
- Application Number
- CN202510269946.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2045-03-07
AI Technical Summary
The existing antibacterial and antiviral agents have many disadvantages, such as triggering adverse reactions, leading to enhanced bacterial resistance, poor antifungal and mold effects, and the biological defense protein has a narrow antibacterial activity against individual strains.
A pleiotropic protein MEL3 is provided, whose amino acid sequence has broad-spectrum antibacterial activity, anti-inflammatory and antiviral effects. By modifying the amino acid sequence of biodefensin, it reduces hydrophobicity, increases charging and improves stability.
MEL3 has broad-spectrum antibacterial activity, can effectively antifungal and mold, and has anti-inflammatory and antiviral effects, reducing adverse reactions to the body and reducing the possibility of drug resistance.
Smart Images

Figure CN120209088A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a multifunctional protein MEL3 and its applications. Background Art
[0002] In the traditional antibacterial field, common antibacterial components include antibiotics, inorganic salts, etc., such as penicillin, alcohol, iodophor, and silver ions. Among them, the antibacterial mechanism of antibiotics mainly uses biochemical means to interfere with one or more metabolic functions of bacteria, specifically manifested as inhibiting the synthesis of bacterial cell walls, enhancing the permeability of cell membranes, interfering with protein synthesis, and hindering nucleic acid replication and transcription. However, antibiotics have many drawbacks, such as causing adverse reactions, disrupting the normal flora balance of the body, and increasing bacterial drug resistance. The action mechanisms of silver ion-based antibacterial agents mainly include interfering with cell wall synthesis, damaging cell membranes, inhibiting protein synthesis, and interfering with nucleic acid synthesis. However, silver ion-based antibacterial agents also have defects. After being absorbed by the human body, they may accumulate in hepatocytes, thereby causing liver damage; silver-based antibacterial agents are prone to discoloration, the manufacturing process is difficult, and the use process in materials is relatively complex; their antifungal and anti-mold effects are not good, and they are prone to pigmentation on the skin surface. In comparison, bio-defense proteins are an ideal choice to replace antibiotics in the future. Bio-defense proteins are important components of the self-immunity of animals and plants, and have the effects of wide distribution, broad antibacterial spectrum, and immune enhancement. Their antibacterial mechanism is different from that of traditional antibiotics, and it is not easy to generate drug-resistant strains during use, so they are regarded as antibiotic substitutes with great potential and application prospects.
[0003] In the field of antiviral, bio-defense proteins show significant advantages in antiviral. Their action mechanisms are diverse. They can directly recognize and bind to viruses, prevent virus adsorption and invasion, interfere with virus replication, and regulate immune responses to enhance the body's antiviral immune response; they have broad-spectrum antiviral activity and can inhibit viruses of multiple virus families. And because they act on conserved virus structures or key antiviral pathways, they can still play a role even if the virus mutates; they have the characteristics of low toxicity and side effects, have little impact on host cells, can reduce interference with the normal physiological functions of the body, and have low immunogenicity, and are not easy to cause strong immune responses in the body, which is conducive to long-term action; at the same time, bio-defense proteins are not easy to develop drug resistance. Their multi-target action makes it difficult for viruses to escape through a few gene mutations, and the complex defense network formed by their synergistic action with other immune components also makes it difficult for viruses to break through, reducing the possibility of drug resistance.
[0004] Biodefense proteins are composed of more than twenty amino acids, with excellent physical and chemical properties, such as good water solubility, good stability, colorless, odorless, resistant to acids, bases and high temperatures, and have achieved results in both antibacterial and antiviral fields. Patent CN114262363B provides a kind of biodefensin KY23. According to the amino acid sequence of natural bioactive peptides, this patent modifies it to reduce its hydrophobicity, increase its chargeability, and improve its stability, so as to provide a kind of biodefensin with lower cytotoxicity and stronger bactericidal effect, and has good market prospects. Patent CN117024604B provides a recombinant protein, which has high antibacterial and antiviral activities and has good application prospects. However, the biodefense proteins of the above inventions only have antibacterial activities against individual strains, and the antibacterial spectrum is relatively narrow.
[0005] Therefore, it is the top priority of current research to provide a multi-functional protein MEL3 or its homologous protein that can have broad-spectrum antibacterial activity and can achieve anti-inflammatory and antiviral effects at the same time. Summary of the Invention
[0006] In view of the above deficiencies, the present invention provides a multi-functional protein MEL3 and its application. The amino acid sequence of the multi-functional protein MEL3 or its homologous protein provided by the present invention has the following general formula:
[0007] X1GAX2LX3VLX4GLX5ALISWIKRKRX6; wherein X1 is M or L; X2 is one of V, SI, AI; X3 is one of K, T, KI, KR; X4 is one of KK, TT, SS, VK; X5 is one of P, K, A, T; X6 is QQ or no amino acid. The multi-functional protein MEL3 provided by the present invention has broad-spectrum antibacterial activity and can achieve anti-inflammatory and antiviral effects at the same time, providing a new idea for the preparation of anti-pathogenic microorganisms or anti-inflammatory products.
[0008] The meanings of amino acid letters in the present invention are as follows:
[0009] A represents alanine; C represents cysteine; D represents aspartic acid; E represents glutamic acid; F represents phenylalanine; G represents glycine; H represents histidine; I represents isoleucine; K represents lysine; L represents leucine; M represents methionine; N represents asparagine; P represents proline; Q represents glutamine; R represents arginine; S represents serine; T represents threonine; V represents valine; W represents tryptophan; Y represents tyrosine.
[0010] In the present invention, the "codon degeneracy" refers to the phenomenon that the same amino acid has two or more codons. In particular, the degeneracy of cytosine and uracil or guanine and adenine at the third position of the codon is often equivalent.
[0011] In the present invention, an "expression vector" refers to a vector that can express a corresponding protein, which is constructed by inserting a nucleic acid molecule of the protein to be expressed into a vector backbone. Generally speaking, the vector backbone is a plasmid, or it can be other forms of vector backbones that can play the same role. The "expression vector" can be used to transfect cells and express proteins through the cells.
[0012] In the present invention, a "genetically engineered cell" refers to a cell that has been modified by genetic engineering means, and the genetic engineering means can be plasmid transformation or cell fusion, etc.
[0013] In the present invention, "Gram-negative bacteria" and "Gram-positive bacteria" refer to being stained with crystal violet solution plus iodine solution, then decolorized with alcohol, and then stained with dilute fuchsin solution. After such treatment, the bacteria stained purple are Gram-positive bacteria, and those stained red are Gram-negative bacteria.
[0014] The technical solution of the present invention includes:
[0015] In a first aspect, the present invention provides a pleiotropic protein MEL3 or its homologous protein, and the amino acid sequence of the pleiotropic protein MEL3 or its homologous protein has the following general formula:
[0016] X1GAX2LX3VLX4GLX5ALISWIKRKRX6;
[0017] X1 is M or L; X2 is one of V, SI, AI; X3 is one of K, T, KI, KR; X4 is one of KK, TT, SS, VK; X5 is one of P, K, A, T; X6 is QQ or no amino acid.
[0018] Specifically, the pleiotropic protein MEL3 or its homologous protein includes the amino acid sequence shown in any one of SEQ ID NO.1-20; or includes partial segments of any one or more of the amino acid sequences shown in SEQ ID NO.1-20; or a sequence having more than 30% homology with any one of the amino acid sequences of SEQ ID NO.1-20.
[0019] More specifically, the homologous proteins include pleiotropic protein MEL1, pleiotropic protein MEL2, pleiotropic protein MEL4, pleiotropic protein MEL5, pleiotropic protein MEL6, pleiotropic protein MEL7, pleiotropic protein MEL8, pleiotropic protein MEL9, pleiotropic protein MEL10, pleiotropic protein MEL11, pleiotropic protein MEL12, pleiotropic protein MEL13, pleiotropic protein MEL14, pleiotropic protein MEL15, pleiotropic protein MEL16, pleiotropic protein MEL17, pleiotropic protein MEL18, pleiotropic protein MEL19, pleiotropic protein MEL20.
[0020] Preferably, the pleiotropic protein MEL1 has the amino acid sequence shown in SED ID NO.1.
[0021] SEQ ID NO.1: MGAVLKVLKKGLPALISWIKRKR.
[0022] Preferably, the pleiotropic protein MEL2 has the amino acid sequence shown in SED ID NO.2.
[0023] SEQ ID NO.2: LGAVLKVLTTGLPALISKIKRKR.
[0024] Preferably, the pleiotropic protein MEL3 has the amino acid sequence shown in SED ID NO.3.
[0025] SEQ ID NO.3: MGAVLKVLTTGLPALISWIKRKR.
[0026] Preferably, the pleiotropic protein MEL4 has the amino acid sequence shown in SED ID NO.4.
[0027] SEQ ID NO.4: MGAVLKVLTTGLKALISWIKRKR.
[0028] Preferably, the pleiotropic protein MEL5 has the amino acid sequence shown in SED ID NO.5. SEQ IDNO.5: LGAVLTVLKKGLPALISWIKRKRQQ.
[0029] Preferably, the pleiotropic protein MEL6 has the amino acid sequence shown in SED ID NO.6. SEQ IDNO.6: MGAVLKVLSSGLAALISWIKRKR.
[0030] Preferably, the pleiotropic protein MEL7 has the amino acid sequence shown in SED ID NO.7. SEQ IDNO.7: LGAVLKVLKKGLPALISWIKRKR.
[0031] Preferably, the pleiotropic protein MEL8 has the amino acid sequence shown in SEQ ID NO.8. SEQ ID NO.8: LGAVLKVLTTGLAALISKIKRKRQQ.
[0032] Preferably, the pleiotropic protein MEL9 has the amino acid sequence shown in SEQ ID NO.9. SEQ ID NO.9: MGAVLTVLTTGLAALISWIKRKR.
[0033] Preferably, the pleiotropic protein MEL10 has the amino acid sequence shown in SEQ ID NO.10. SEQ ID NO.10: MGAVLTVLSSGLPALISWIKRKR.
[0034] Preferably, the pleiotropic protein MEL11 has the amino acid sequence shown in SEQ ID NO.11. SEQ ID NO.11: LGAVLTVLSSGLKALISWIKRKR.
[0035] Preferably, the pleiotropic protein MEL12 has the amino acid sequence shown in SEQ ID NO.12. SEQ ID NO.12: LGAVLTVLSSGLAALISWIKRKR.
[0036] Preferably, the pleiotropic protein MEL13 has the amino acid sequence shown in SEQ ID NO.13. SEQ ID NO.13: LGAVLKVLKKGLAALISWIKRKR.
[0037] Preferably, the pleiotropic protein MEL14 has the amino acid sequence shown in SEQ ID NO.14. SEQ ID NO.14: MGASILKIVLVKGLTALISWIKRKR.
[0038] Preferably, the pleiotropic protein MEL15 has the amino acid sequence shown in SEQ ID NO.15. SEQ ID NO.15: MGASILKRVLKKGLTALISWIKRKR.
[0039] Preferably, the pleiotropic protein MEL16 has the amino acid sequence shown in SEQ ID NO.16. SEQ ID NO.16: MGASILKVLKKGLPALISWIKRKR.
[0040] Preferably, the multi-effect protein MEL17 has the amino acid sequence shown in SED ID NO.17. SEQ ID NO.17: MGAAILTVLVKGLTALISWIKRKR.
[0041] Preferably, the multi-effect protein MEL18 has the amino acid sequence shown in SED ID NO.18. SEQ ID NO.18: LGASILKRVLSSGLAALISWIKRKR.
[0042] Preferably, the multi-effect protein MEL19 has the amino acid sequence shown in SED ID NO.19.
[0043] SEQ ID NO.19: LGAVLKRVLVKGLAALISWIKRKR.
[0044] Preferably, the multi-effect protein MEL20 has the amino acid sequence shown in SED ID NO.20.
[0045] SEQ ID NO.20: MGAAILTVLTTGLPALISWIKRKRQQ.
[0046] In a second aspect, the present invention provides a nucleic acid molecule encoding the above multi-effect protein MEL3 or its homologous protein.
[0047] Specifically, the nucleic acid molecule encodes the multi-effect protein MEL3.
[0048] Preferably, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO.21; or a partial segment of the nucleotide sequence shown in SEQ ID NO.21; or a nucleotide sequence obtained by base substitution of SEQ ID NO.21 according to codon degeneracy.
[0049] SEQ ID NO.21:
[0050] ATGGGAGCTGTATTAAAAGTTCTAACTACAGGTTTGCCGGCGCTGATCAGCTGGATTAAACGTAAGCGCTAA.
[0051] In a third aspect, the present invention provides an expression vector comprising the above nucleic acid molecule.
[0052] Specifically, the expression vector further includes a promoter for driving the expression of the nucleic acid molecule.
[0053] Preferably, the promoter is the T7 promoter.
[0054] Specifically, the backbone of the expression vector includes, but is not limited to: pET-28a vector, pRSFDuet-1 vector, pETDuet-1 vector, pACYCDuet-1 vector or pTrc99a vector.
[0055] Preferably, the backbone of the expression vector is pET-28a vector.
[0056] Preferably, the expression vector is located between the NcoI cleavage site and the XhoI cleavage site of the pET-28a vector.
[0057] In a fourth aspect, the present invention provides a genetically engineered cell that expresses the above-mentioned recombinant vector.
[0058] Specifically, the host cell of the genetically engineered cell includes Escherichia coli.
[0059] Preferably, the genetically engineered cell is BL21(DE3)Plys Escherichia coli.
[0060] In a fifth aspect, the present invention provides the use of the above-mentioned multifunctional protein MEL3 or its homologous protein, nucleic acid molecule, expression vector or genetically engineered cell in the preparation of anti-pathogenic microorganism products or anti-inflammatory products.
[0061] Specifically, the anti-pathogenic microorganism products include one or more of anti-bacterial products, anti-fungal products, anti-viral products, and anti-mycoplasma products.
[0062] Preferably, the anti-bacterial products are directed against one or more of Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Propionibacterium acnes, and Porphyromonas gingivalis.
[0063] Preferably, the anti-fungal products are directed against one or more of Candida albicans and Candida krusei.
[0064] Preferably, the anti-viral products are directed against one or more of HPV virus, coronavirus, and influenza A virus.
[0065] Preferably, the anti-mycoplasma products include anti-Mycoplasma pneumoniae products.
[0066] Specifically, the anti-inflammatory product inhibits the secretion of pro-inflammatory factors by blocking the binding of LPS and Toll-like receptors.
[0067] Preferably, the pro-inflammatory factors include one or more of TNF-α, IL-6, and NO.
[0068] In a sixth aspect, the present invention provides a product comprising the above-mentioned multifunctional protein MEL3 or its homologous protein, nucleic acid molecule, expression vector or genetically engineered cell, and the product includes one or more of drugs, medical devices, health products, cosmetics, preservatives, and disinfectants.
[0069] Specifically, the dosage form of the drug includes parenteral dosage forms or enteral dosage forms.
[0070] Preferably, the enteral dosage forms include, but are not limited to, tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.
[0071] Preferably, the parenteral dosage forms include, but are not limited to, injection dosage forms, respiratory dosage forms, skin dosage forms, mucosal dosage forms, and cavity dosage forms.
[0072] Preferably, the drug further includes one or more pharmaceutically acceptable excipients.
[0073] More preferably, the pharmaceutically acceptable excipients include, but are not limited to: solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, binders, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, mold release agents, coating agents, flavor correctors, or antioxidants.
[0074] Preferably, the medical device includes medical equipment and medical consumables.
[0075] Specifically, the health product further includes conventional health product excipients.
[0076] Preferably, the conventional health product excipients include, but are not limited to, fillers, flavor correctors, binders, disintegrants, lubricants, antacids, or nutritional fortifiers.
[0077] Specifically, the cosmetics include, but are not limited to, facial cleansers, toners, lotions, creams, serums, masks, foundations, concealers, sunscreens, sun protection sprays, shampoos, conditioners, body washes, foaming agents, patches, cosmetic powders, cotton pads, eye serums, eye masks, eyeshadows, eye gels, or eye creams.
[0078] Specifically, the cosmetics further include additives acceptable for cosmetics.
[0079] Preferably, the additives include, but are not limited to, one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, and buffers.
[0080] Specifically, the preservative includes food preservatives or cosmetic preservatives.
[0081] Preferably, the food preservative is used for human food or animal food.
[0082] Preferably, the food includes but is not limited to tablet candies, soy milk, yogurt, canned foods, biscuits, chocolates, pastries, cream, cheese, milk powder, ice cream, ice pops, jams, purees, candied fruits, preserved fruits, bread, egg rolls, protein drinks, solid drinks, lactic acid bacteria drinks, plant protein drinks, carbonated drinks, coffee, or puffed foods.
[0083] Preferably, the cosmetics include but are not limited to facial cleansers, toners, lotions, creams, serums, facial masks, foundations, concealers, sunscreen lotions, sunscreen sprays, shampoos, hair conditioners, body washes, foaming agents, patches, face powders, cotton pads, eye serums, eye masks, eyeshadows, eye gels, or eye creams.
[0084] The beneficial effects of the present invention are as follows:
[0085] The multi-functional protein MEL3 or its homologous protein provided by the present invention has broad-spectrum antibacterial activity and can simultaneously achieve anti-inflammatory and antiviral effects, providing new ideas for the preparation of anti-pathogenic microorganism or anti-inflammatory products. Description of the Drawings
[0086] Figure 1 is the median effective dose EC 50 Schematic diagram of sample loading.
[0087] Figure 2 is the median cytotoxic concentration CC 50 Schematic diagram of sample loading.
[0088] Figure 3 is the experimental result of the anti-HPV16 activity of the multi-functional protein MEL3.
[0089] Figure 4 is the experimental result of the anti-HPV18 activity of the multi-functional protein MEL3.
[0090] Figure 5 is the experimental result of the cytotoxicity of the multi-functional protein MEL3.
[0091] Figure 6 is the effect of the multi-functional protein MEL3 on the viability of THP-1 cells; unsti in the figure represents the untreated group.
[0092] Figure 7 is the effect of the multi-functional protein MEL3 on the production of nitric oxide in THP-1 cells; unsti in the figure represents the untreated group.
[0093] Figure 8 Effect of pleiotropic protein MEL3 on TNF-α secretion in THP-1 cells; in the figure, unsti represents the untreated group; ns represents no significant difference; **** represents P < 0.0001.
[0094] Figure 9 Effect of pleiotropic protein MEL3 on IL-6 secretion in THP-1 cells; in the figure, ns represents no significant difference; **** represents P < 0.0001.
[0095] Figure 10 Effect of pleiotropic protein MEL3 on the viability of DS-1 cells.
[0096] Figure 11 Inhibitory effect of pleiotropic protein MEL3 on the viability of DS-1 cells. Detailed implementation mode
[0097] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the following combines specific embodiments to further clarify the present invention. However, the following embodiments are only the preferred embodiments of the present invention, not all. Based on the embodiments in the implementation mode, other embodiments obtained by those skilled in the art without creative work all belong to the protection scope of the present invention. In the following embodiments, unless otherwise specified, the operation methods used are all conventional operation methods, the equipment used is all conventional equipment, and the equipment materials used in each embodiment are the same.
[0098] Example 1 Synthesis of pleiotropic protein
[0099] 1. Chemical synthesis method
[0100] Synthesize pleiotropic proteins MEL1-MEL20 with the amino acid sequences shown in SEQ ID NO.1-20 by chemical synthesis (synthesized by Shanghai Kopeptide, purity ≥ 95%), and the detailed information of the pleiotropic proteins is shown in Table 1.
[0101] Table 1
[0102]
[0103]
[0104] 2. Biosynthesis method
[0105] The nucleotide sequence of the nucleic acid molecule of the pleiotropic protein MEL3 is shown in SEQ ID NO.21. Using the total gene synthesis technology, a gene fragment was synthesized for expressing the nucleic acid molecule of the pleiotropic protein MEL3, and the synthesized gene fragment was obtained. The synthesized gene fragment was double-digested with NcoI enzyme and XhoI enzyme respectively and then ligated with the pET-28a vector. The synthesized gene fragment SEQ ID NO.13 was inserted between the NcoI restriction site and the XhoI restriction site of the pET-28a vector to obtain the vector pET-28a-MEL3.
[0106] The expression vector pET-28a-MEL3 was transformed into Escherichia coli BL21(DE3)Plys by heat shock method, and positive clones were screened. The obtained recombinant Escherichia coli was named BL21(DE3)Plys-MEL3.
[0107] The recombinant Escherichia coli BL21(DE3)Plys-MEL3 was taken. After seed expansion culture, it was inoculated into LB medium for fermentation culture. The culture solution was centrifuged to collect the precipitated bacteria, which were resuspended. The resuspended solution was ultrasonically disrupted, and the supernatant was collected and purified to obtain the pleiotropic protein MEL3.
[0108] The pleiotropic proteins MEL1, MEL2, MEL4 - MEL20DE can all be prepared by a biosynthetic method similar to that of this example.
[0109] Experimental Example 1 Antibacterial Performance Verification Test
[0110] 1. Test Strains
[0111] The strains used in this experiment are shown in Table 2:
[0112] Table 2
[0113]
[0114]
[0115] Note: In the table, "a" represents MHIIB; "b" represents MHIIB + 5% lysed horse blood; "c" represents Brucella agar added with 5 μg / ml hemin, 1 μg / ml Vitamin K1 and 5% lysed sheep blood; "d" represents RPMI 1640 + MOPs; "e" represents ATCC 2611 Medium.
[0116] 2. Main Reagents
[0117] The main reagents used in this experiment are shown in Table 3:
[0118] Table 3
[0119] Reagent Name Brand Catalog Number Lot Number Alamar blue Invitrogen DAL1100 2486611 Levofloxacin Abcam ab141245 APN12602-1-1 Vancomycin Abcam ab141224 APN12578-1-1 Meropenem TCI-M2279 M2279 YCY8L-ML Ciprofloxacin AnyChem E080630 GB260026 Amikacin Sigma A3650 BCBP7942V Azithromycin TCI A2076 3ABMK-AE Voriconazle Adamas 22105A P1196112 Itraconazole Adamas-beta 85974A P1034592 Rifampicin Sigma R3501 WXBD0542V Clarithromycin Abcam ab141202 APN12556-1-1
[0120] 3. Preparation of Test Samples and Positive Control Drugs
[0121] Preparation of stock solutions. On the day of the experiment, dissolve the test samples (multifunctional proteins MEL1 - MEL20 of the examples) and the positive control drugs into stock solutions, as detailed in Table 4.
[0122] Table 4
[0123]
[0124] 4. MIC Test
[0125] 4.1 MIC Test for Aerobic Bacteria: Inoculate the strains on the plate in advance and incubate overnight at 35°C in the incubator. On the day of the experiment, adjust the bacterial concentration to a turbidity of 0.2.
[0126] Dilute the bacterial suspension with the corresponding liquid medium (Table 2), and then transfer 50 μl to a 96 - well round - bottom plate containing 50 μl of the working solution to obtain the test plate, with a bacterial concentration of 5×10 5 CFU / mL. Place the obtained 96 - well round - bottom plate in the incubator at 35°C and incubate for 20 h.
[0127] 4.2 MIC Test for Anaerobic and Microaerophilic Bacteria
[0128] Dispense 30 μL of the prepared 100× test sample and positive control drug working solutions into a 6 - well plate, then add 3 mL of the prepared test agar medium, mix well and let it cool and solidify.
[0129] Anaerobic bacteria: Inoculate the required strains on the blood plate in advance and incubate in an anaerobic environment. On the day of the experiment, pick some colonies from the plate, adjust the turbidity to 0.2, and then inoculate 2 μl onto the drug - containing blood plate using a workstation, 10 5 / spot. After the inoculum is absorbed by the plate, invert the obtained blood plate and incubate at 35°C in an anaerobic environment for 2 days.
[0130] 4.3 MIC Test for Fungi
[0131] Fungi: Inoculate the strains on the plate in advance and incubate at 35°C in the incubator. For yeasts, on the day of the experiment, adjust the bacterial concentration to a turbidity of 0.2, dilute it with the corresponding liquid medium (Table 2), and the yeast concentration is 1 - 5×10 3 CFU / ml.
[0132] Transfer 100 μl to a 96 - well round - bottom plate containing 100 μl of the working solution to obtain the test plate. Place the obtained 96 - well round - bottom plate in the incubator at 35°C and incubate for 24 h.
[0133] 5. Experimental Results
[0134] The minimum inhibitory concentration (unit: μg / mL) of the multifunctional protein MEL1-MEL20 against the strains is shown in Tables 5 - 14 (NA in the table represents no inhibitory effect). The MICs of the positive control drugs against the quality control strains are all within the CLSI reference values. Therefore, the test data this time are reliable.
[0135] Table 5
[0136]
[0137]
[0138] Table 6
[0139]
[0140]
[0141] Table 7
[0142]
[0143]
[0144] Table 8
[0145]
[0146] Table 9
[0147]
[0148] Table 10
[0149]
[0150]
[0151] Table 11
[0152]
[0153]
[0154] Table 12
[0155]
[0156] Table 13
[0157]
[0158]
[0159] Table 14
[0160]
[0161]
[0162] The measurement results show that the pleiotropic proteins MEL1 - MEL20 have certain activities against all tested Gram - positive bacteria (G+) (MIC is 4 - 64 μg / ml). Among them, the inhibitory effects on Enterococcus faecium MEL3, MEL5, and MEL14 are the best, and the MICs for Enterococcus faecium ATCC 51559 and Enterococcus faecium ATCC 700221 can both reach 8 μg / ml. For Staphylococcus aureus and Staphylococcus haemolyticus, MEL3 shows the strongest antibacterial effect, with an MIC of 4 - 8 μg / ml, and the MICs of MEL3 for Staphylococcus aureus VRS5 and Staphylococcus haemolyticus CICC 23976 can reach 4 μg / ml. For Streptococcus pneumoniae, MEL3, MEL9, and MEL13 all show better antibacterial effects, with an MIC of 6 - 16 μg / ml. The MICs of MEL1 - MEL20 for Streptococcus mutans are less than or equal to 32 μg / ml.
[0163] For anaerobic bacteria, the pleiotropic proteins MEL1 - MEL20 all show certain antibacterial activities against Propionibacterium acnes ATCC 6919 (MIC is 16 - 64 μg / ml). Among them, MEL3, MEL11, MEL19, and MEL20 have better antibacterial effects on Propionibacterium acnes ATCC 6919 (MIC is 16 μg / ml).
[0164] For yeasts and Mycoplasma pneumoniae, the MICs of the pleiotropic proteins MEL1 - MEL20 for Candida albicans and Candida krusei are in the range of 16 - 128 μg / ml, showing good antibacterial ability.
[0165] It can be seen that for all tested strains, the pleiotropic proteins MEL1 - MEL20 have stronger antibacterial effects compared to the control antibiotics. Among them, MEL3 shows the strongest antibacterial activity against Gram - positive bacteria, anaerobic bacteria, yeasts, and Mycoplasma pneumoniae.
[0166] Experimental Example 2 Verification of Antiviral Performance
[0167] 1. Experimental Materials
[0168] The test sample in this experiment is the pleiotropic protein MEL3 of Example 1. The control compound (DAPT, also known as GSI - IX) is provided by WuXi AppTec.
[0169] HPV16 VLP and HPV18 VLP virus particles were provided by WuXi AppTec; 293FT
[0170] (ATCC-CRL-3216) cells were provided by WuXi AppTec; DMEM cell culture medium was provided by CORNING.
[0171] 2. Experimental procedures for screening anti-HPV16 and anti-HPV18 activities
[0172] On the first day, 293FT cells were seeded in 96-well plates at a density of 4×10 4 cells per well and cultured overnight in a 5% CO2, 37°C cell incubator.
[0173] On the second day, the virus, test samples, and control compounds were diluted separately using serum-free medium. 50 μL of the diluted MEL3 and 50 μL of 100 virus tissue culture infective dose 50 (TCID 50 ) HPV16 VLP or HPV18 were added to the cell wells respectively, and 50 μL of the control compound and 50 μL of 100 TCID 50 HPV16 VLP or HPV18 were added to the cell wells respectively. At the same time, cell controls (cells, without treatment with test samples, control compounds, and virus infection) and virus controls (cells infected with virus, without treatment with test samples and control compounds) were set up for the antiviral experiment (see details in Figure 1 ).
[0174] The highest detection point concentration of the test sample MEL3 was 100 μg / mL, and it was serially diluted to 8 concentration points (100 μg / mL, 40 μg / mL, 16 μg / mL, 8 μg / mL, 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL) for detection in duplicate wells; for the control compound: GSI-IX was serially diluted 5-fold to 8 concentration points for detection in duplicate wells, with the starting point final concentration of 10,000 nM. The cells added with virus, test samples, and control compounds were cultured in a 5% CO2, 37°C incubator for 3 days. The antiviral activity of the test sample was expressed as the inhibition rate (%) of the cytopathic effect caused by the virus at different concentrations.
[0175] 3. Experimental procedures for cytotoxicity assay
[0176] On the first day, 293FT cells were seeded in 96-well plates at a density of 4×10 4 cells per well and cultured overnight in a 5% CO2, 37°C cell incubator.
[0177] On the second day, the test samples and the control compound were diluted with serum-free medium. 50 μL of the diluted test samples and the control compound and 50 μL of the medium were added to the cell wells without virus infection (see Figure 2 ). At the same time, cell controls (cells, without treatment with test samples, control compounds and virus infection) and medium controls (without cells, without treatment with test samples, control compounds and virus infection) were set up for cytotoxicity experiments.
[0178] The highest detection point concentration of the test sample MEL3 was 100 μg / mL, and it was serially diluted to 8 concentration points (100 μg / mL, 40 μg / mL, 16 μg / mL, 8 μg / mL, 4 μg / mL, 2 μg / mL, 1 μg / mL, 0.5 μg / mL) for detection in duplicate; for the control compound: GSI-IX was serially diluted 5-fold to 8 concentration points for detection in duplicate, and the starting and final concentrations were 10,000 nM. The cells added with the test samples and the control compound were cultured in an incubator with 5% CO2 at 37 °C for 3 days. The cytotoxicity of the test samples was expressed as the inhibition rate (%) of 293FT cell activity at different concentrations of the samples.
[0179] 4. Experimental Results
[0180] The anti-HPV16 virus activity of the pleiotrophin MEL3 is shown in Table 15 and Figure 3 as shown, and the anti-HPV18 virus activity is shown in Table 16 and Figure 4 as shown. The results showed that the EC50 values of MEL3 against HPV16 and HPV18 were 1.22 μg / mL and 0.76 μg / mL respectively, indicating that MEL3 has potential antiviral ability. Table 17 and Figure 5 showed that MEL3 did not produce cytotoxicity at all tested concentrations, and CC 50 > 100 μg / mL.
[0181] Table 15
[0182]
[0183] Table 16
[0184]
[0185] Table 17
[0186]
[0187] In summary, MEL3 provided by the present invention showed strong antiviral activities against both HPV16 and HPV18, and its antiviral effect was superior to that of the control compound GSI-IX. At the same time, MEL had good safety and did not produce cytotoxicity at all tested concentrations.
[0188] Experimental Example 3 Verification of Anti-inflammatory Performance
[0189] 1. Research on the Anti-inflammatory Effect of Multifunctional Protein on THP-1
[0190] 1.1 Test Samples
[0191] The test sample in this experimental example is the multifunctional protein MEL3 of Example 1.
[0192] 1.2 Experimental Methods
[0193] (1) Preparation of Cell Culture Medium
[0194] The RPMI 1640 medium was purchased from Lonza, with the catalog number CC-3156.
[0195] Complete Medium (CM): RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin (100×).
[0196] (2) Preparation of Cell Stimulants
[0197] Phorbol 12-myristate 13-acetate (PMA) was purchased from Sigma, with the catalog number P1585; lipopolysaccharide (LPS) was purchased from Sigma, with the catalog number L3129. According to the method described in Table 18, the PMA stimulant was prepared; according to the method described in Table 19, the LPS stimulant was prepared.
[0198] Table 18
[0199]
[0200] Table 19
[0201]
[0202] (3) Preparation of Test Drugs
[0203] According to the method described in Table 20, the multifunctional protein MEL3 was prepared.
[0204] Table 20
[0205]
[0206] (4) Experimental Procedures
[0207] Day 1: Collect THP-1 cells, count them, and adjust the density of THP-1 cells to 3×10 6 cells / ml; add 1 ml of 3×10 6THP-1 cells at a density of 1×10⁶ cells / ml and 1 ml of 20 ng / ml (2×) PMA were placed in an incubator at 37 °C and incubated for 24 hours;
[0208] The next day: The THP-1 cells were collected, counted, and the cell density was adjusted to 0.5×10⁶ 6 cells / ml; 200 μL of THP-1 cells were added to a 96-well flat-bottom plate and incubated in an incubator at 37 °C overnight;
[0209] The third day: 100 μL of the cell supernatant was discarded, and 100 μL of 0.15 μg / mL (2×) LPS or LPS + the test drug (2×) was added, and incubated in an incubator at 37 °C for 24 hours;
[0210] The fourth day: 100 μL of the cell supernatant was collected for cytokine detection of TNF-α (Human TNFαFlex Set, purchased from BD, catalog number 558273), IL-6 (Human IL-6Flex Set, purchased from BD, catalog number 558276) and nitric oxide (NO detection kit, purchased from Beyotime, catalog number S0021S), and the cells were used to detect CTG (CTG detection kit, purchased from Promega, catalog number G7572).
[0211] 1.3 Experimental results
[0212] The effect of MEL3 on cell viability is shown as Figure 6 follows. Compared with the LPS-stimulated group, MEL3 significantly reduced the cell viability of HTP-1 at a concentration of 40 μg / mL and showed a dose-dependence.
[0213] The effect of MEL3 on nitric oxide production in THP-1 cells is shown as Figure 7 follows. Compared with the LPS-stimulated group, MEL3 reduced the content of NO in the supernatant of HTP-1 cells.
[0214] The effect of MEL3 on TNF-α secretion in cells is shown as Figure 8 follows. Compared with the LPS-stimulated group, MEL3 could reduce the secretion of TNF-α in THP-1 cells and showed a dose-dependence.
[0215] The effect of MEL3 on IL-6 secretion in cells is shown as Figure 9 follows. Compared with the LPS-stimulated group, LL-37 could reduce the secretion of IL-6 in HTP-1 cells, and MEL3 could reduce the secretion of IL-6 in HTP-1 cells at concentrations of 10 μg / mL and 40 μg / mL and showed a dose-dependence.
[0216] 2. The effect of pleiotrophin on the viability of DS-1 cells
[0217] 2.1 Test samples
[0218] The test sample in this experimental example was the multifunctional protein MEL3 of Example 1.
[0219] 2.2 Experimental methods
[0220] (1) Preparation of cytokines
[0221] Prepare cytokines according to the method described in Table 21. The recombinant human IL-6 protein in the table was provided by R&D, and the product number was 206-IL.
[0222] Table 21
[0223] Source Tube ID Source Tube Volume (μL) CM Volume (μL) Total Volume (μL) Target Concentration (1×) IL-6 100 μg / mL 2 198 200 1 μg / mL IL-6 1 μg / mL 150 29850 30000 5 ng / mL
[0224] (2) Preparation of drugs to be tested
[0225] Prepare the multifunctional protein MEL3 according to the method described in Table 22.
[0226] Table 22
[0227]
[0228]
[0229] (3) Experimental procedures
[0230] Collect DS-1 cells, count them, and adjust the density of DS-1 cells to 2.5×10 5 cells / ml; Add 100 μL of 2.5×10 5 cells / ml DS-1 and 100 μL of 5 ng / mL (1×) IL-6 or IL-6 + drug to be tested (2×) into a 96-well flat bottom plate, and incubate in a 37°C incubator for 72 hours; Discard 100 μL of the cell supernatant, and then add an equal volume of CTG detection reagent (CTG detection kit, purchased from Promega, product number G7572); Read the values with an enzyme-linked immunosorbent assay reader.
[0231] 2.3 Experimental results
[0232] The effect of MEL3 on the viability of DS-1 cells is as shown in Figure 10 and the inhibitory effect on the viability of DS-1 cells is as shown in Figure 11 . It can be seen from Figure 10 - Figure 11 that compared with the untreated group (IL-6 only, Medium), MEL3 can reduce the activity of DS-1 cells, and it has a concentration-dependent relationship, with an IC50 of 10.22 μg / mL.
[0233] Experimental Example 4 Anti-Mycoplasma pneumoniae activity
[0234] 1. Test materials
[0235] (1) Test substance: Multifunctional protein MEL3 of Example 1 at 10 μg / mL.
[0236] (2) Test bacteria: Mycoplasma pneumoniae (ATCC15531);
[0237] (3) Culture medium: Mycoplasma broth medium, calf serum;
[0238] (4) Neutralizer: D / E neutralizing broth;
[0239] (5) Interferent: 0.3% BSA
[0240] 2. Test methods
[0241] (1) Test basis: "Disinfection Technical Specification" (2002 version), 2.1.1.7, 2.1.1.9;
[0242] (2) Ambient temperature: 22.1 °C, relative humidity: 52% RH.
[0243] 3. Test steps
[0244] (1) Sensitivity check of the culture medium (color change unit test method)
[0245] Inoculate Mycoplasma pneumoniae into Mycoplasma broth medium (containing phenol red), incubate at 37 °C until the medium changes color. After blind passage for two generations, inoculate the culture into the test medium to make 10-fold serial dilutions until diluted to 10 -9 , and inoculate into arginine Mycoplasma broth medium. Inoculate 3 tubes for each dilution and incubate at 37 °C for 7 - 14 days. Observe the color change of the medium. The highest dilution at which more than 2 / 3 of the inoculated medium tubes change color is the sensitivity of the medium. The results are shown in Table 23.
[0246] Table 23
[0247]
[0248] (2) Mycoplasma killing test
[0249] Take the original Mycoplasma solution with a color-changed medium, let the test substance act for 30 min, measure the Mycoplasma content by the color change method, and observe the color change after incubation at 37 °C for 3 days. The test is repeated three times.
[0250] 1. (Test substance + Mycoplasma) + neutralizer (test group);
[0251] 2. Neutralizer + Mycoplasma, (observe whether Mycoplasma can grow normally) (control group);
[0252] 3. Diluent + Neutralizer + Culture Medium --- Cultivation (blank control group).
[0253] 3. Test Results
[0254] The mycoplasma concentration in the treated bacterial solution was calculated using the color change method. If the logarithm of the mycoplasma concentration after treatment decreased by more than 3, it indicated effective killing. The results are shown in Tables 24 - 25.
[0255] Table 24
[0256]
[0257] Table 25
[0258]
[0259] The results showed that under the test conditions of this experimental example, after 3 repeated tests, the killing rate of MEL3 against Mycoplasma pneumoniae after acting for 30 min was 99.99%.
[0260] Experimental Example 5 Anti - SARS - CoV - 2 Activity
[0261] 1. Test Materials
[0262] (1) Test substance: 10 μg / mL multifunctional protein MEL3 of Example 1.
[0263] (2) Test virus strain: Human coronavirus (HCoV - 229E);
[0264] (3) Cell line: Huh - 7 cells;
[0265] (4) Neutralizer: D / E neutralizing broth;
[0266] (5) Interferent: 0.3% BSA;
[0267] (6) Culture medium: Complete cell culture medium, cell maintenance medium, fetal bovine serum.
[0268] 2. Test Methods
[0269] (1) Test basis: Refer to "Disinfection Technical Specification" (2002 edition), 2.1.1.10.5, 2.1.1.10.7;
[0270] (2) Neutralizer identification test: Grouped according to 2.1.1.10.5, MEL3 was allowed to act with the neutralizer;
[0271] (3) Virus inactivation test: MEL3 was used as the test substance; the action time was 30 min, and the test was repeated 3 times;
[0272] (4) Ambient temperature: 21.8 °C, relative humidity: 52% RH.
[0273] 3. Test Procedures
[0274] Inoculate the HCoV-229E virus into Huh-7 cells, add an appropriate amount of culture medium, and culture in an incubator at 37°C and 5% CO₂. Observe daily. When 90% of the cells show cytopathic effects, freeze-thaw the cells three times repeatedly to break the host cells. After centrifugation at 6000 rpm for 15 min, remove the precipitate, and aspirate the virus suspension into a centrifuge tube. Using the quantitative suspension test method, determine the TCID₅₀ of the indicator virus in the sample before and after the action of the test substance by the cell infection method. Take the cytopathic effects after cell infection as the judgment index, with an action time of 30 min. Determine the infection titer of the virus in each group. Repeat the test three times, calculate the logarithm of the inactivation of the indicator virus by the test substance, and calculate the inactivation rate.
[0275] 4. Test Results
[0276] The results of the neutralizer identification test for human coronavirus (HCoV-229E) are shown in Table 26. The results of the inactivation test for human coronavirus (HCoV-229E) are shown in Table 27.
[0277] Table 26
[0278]
[0279]
[0280] After 3 repeated tests, the results of the neutralizer identification test showed that D / E neutralizing broth could effectively neutralize the residual effect of MEL3 on human coronavirus (HCoV-229E), and the neutralizer and its neutralization products had no obvious effect on the test virus and cell growth.
[0281] Table 27
[0282]
[0283] After 3 repeated tests, the results of the virus inactivation test showed that the average logarithm of inactivation of human coronavirus (HCoV-229E) after MEL3 acted for 30 min > 4.00, meeting the requirements of the "Disinfection Technical Specification" (2002 edition). The MEL3 sample had a significant inactivation effect on human coronavirus (HCoV-229E).
[0284] Experimental Example 6 Anti-Porphyromonas gingivalis Activity
[0285] 1. Test Samples
[0286] The test sample in this experimental example is the multifunctional protein MEL3 of Example 1, with a concentration of 10 μg / mL.
[0287] 2. Test Methods
[0288] Inspection basis and method: QB / T 2738-2023 "Evaluation Method for Antibacterial and Bacteriostatic Effects of Daily Chemical Products" 7.3 Inspection Method for Bacteriostatic Effects of Daily Chemical Products (Suspension Quantitative Method);
[0289] Evaluation basis: QB / T 2738-2023 "Evaluation Method for Antibacterial and Bacteriostatic Effects of Daily Chemical Products";
[0290] Test items: Bacteriostatic rate: Porphyromonas gingivalis GIM1.1464.
[0291] 3. Test results
[0292] The inhibitory effect of MEL3 on Porphyromonas gingivalis is shown in Table 28.
[0293] Table 28
[0294]
[0295]
[0296] Note:
[0297] QB / T 2738-2023 "Evaluation Method for Antibacterial and Bacteriostatic Effects of Daily Chemical Products" stipulates that: when the bacteriostatic rate ≥ 90%, the product has a strong bacteriostatic effect; when the bacteriostatic rate ≥ 50% and less than 90%, the product has a bacteriostatic effect. The above results show that MEL3 has a strong bacteriostatic effect on Porphyromonas gingivalis after acting for 30 min.
[0298] Experimental Example 7 Anti-influenza A virus activity
[0299] 1. Test samples
[0300] The test sample in this experimental example is the multi-functional protein MEL3 in Example 1, with a concentration of 10 μg / mL.
[0301] 2. Test methods
[0302] Inspection basis and method: "Disinfection Technical Specification" (2002 Edition) 2.1.1.10 Virus Inactivation Test;
[0303] Judgment basis: "Disinfection Technical Specification" (2002 Edition) 2.1.1.10 Virus Inactivation Test;
[0304] Test items: Virus inactivation test (Influenza A virus A / PR / 8 / 34 H1N1).
[0305] 3. Test results
[0306] The results of the virus inactivation test are shown in Table 29.
[0307] Table 29
[0308]
[0309]
[0310] Note: The cells in the negative control group grew normally.
[0311] After detection, the infection titer of influenza A virus A / PR / 8 / 34 H1N1 in the positive control group was >
[0312] 10 5 TCID 50 / mL, and the cells in the negative control group grew normally. After the sample reacted with the virus for 30 min, the average log value of inactivation of influenza A virus A / PR / 8 / 34 H1N1 was > 4.00, meeting the requirements of the virus inactivation test in "Disinfection Technical Specifications" (2002 edition), 2.1.1.10, indicating that sample MEL3 had a certain inactivation effect on influenza A virus A / PR / 8 / 34 H1N1.
[0313] The above detailed description is a specific description of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or changes made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of this invention patent shall be subject to the appended claims.
Claims
1. A pleiotropic protein MEL3 or a homologous protein thereof, characterized in that: The amino acid sequence of the pleiotropic protein MEL3 or its homologous protein has the following general formula: X1GAX2LX3VLX4GLX5ALISWIKRKRX6; The X1 is M or L; the X2 is one of V, SI, and AI; the X3 is one of K, T, KI, and KR; the X4 is one of KK, TT, SS, and VK; the X5 is one of P, K, A, and T; and the X6 is QQ or no amino acid.
2. The pleiotropic protein MEL3 or its homologous protein according to claim 1, characterized in that: The pleiotropic protein MEL3 or its homologous protein comprises an amino acid sequence as shown in any one of SEQ ID NO.1-20; or comprises a partial segment of any one or more of the amino acid sequences as shown in SEQ ID NO.1-20; or a sequence having more than 30% homology with any one of the amino acid sequences of SEQ ID NO.1-20.
3. The pleiotropic protein MEL3 or its homologous protein according to claim 2, characterized in that: The pleiotropic protein MEL3 comprises the amino acid sequence shown in SEQ ID NO.3; or a partial segment of the amino acid sequence shown in SEQ ID NO.3; or a sequence having more than 30% homology with the amino acid sequence of SEQ ID NO.
3.
4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the pleiotropic protein MEL3 or a homologous protein thereof according to any one of claims 1 to 2.
5. The nucleic acid molecule according to claim 4, characterized in that The nucleic acid molecule encodes the pleiotropic protein MEL3; the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO.21; or a partial segment of the nucleotide sequence shown in SEQ ID NO.21; or a nucleotide sequence after base substitution of SEQ ID NO.21 according to codon degeneracy.
6. An expression vector, characterized in that: The expression vector comprises the nucleic acid molecule according to any one of claims 4-5.
7. A genetically engineered cell, characterized in that: The genetically engineered cell comprises the expression vector according to claim 6.
8. Use of the pleiotropic protein MEL3 or its homologous protein according to any one of claims 1 to 3, the nucleic acid molecule according to any one of claims 4 to 5, the expression vector according to claim 6 or the genetically engineered cell according to claim 7 in the preparation of an anti-pathogenic microorganism product or an anti-inflammatory product.
9. The use according to claim 8, characterized in that: The anti-pathogenic microorganism product includes one or more of antibacterial products, antifungal products, antiviral products, and antimycoplasma products.
10. The use according to claim 9, characterized in that: The antibacterial product is directed against one or more of Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Propionibacterium acnes, and Porphyromonas gingivalis.
11. The use according to claim 9, characterized in that: The antifungal product targets one or more of Candida albicans and Candida krusei.
12. The use according to claim 9, characterized in that: The antiviral product targets one or more of HPV virus, coronavirus and influenza A virus.
13. The use according to claim 9, characterized in that: The anti-mycoplasma product includes an anti-Mycoplasma pneumoniae product.
14. The use according to claim 8, characterized in that: The anti-inflammatory product inhibits the secretion of pro-inflammatory factors by blocking the binding of LPS and Toll-like receptors.
15. A product comprising the pleiotropic protein MEL3 or a homologous protein thereof according to any one of claims 1 to 3, the nucleic acid molecule according to any one of claims 4 to 5, the expression vector according to claim 6 or the genetically engineered cell according to claim 7, characterized in that: The products include one or more of medicines, medical devices, health products, cosmetics, food preservatives, and disinfectants.
16. The product according to claim 15, characterized in that The dosage form of the drug includes a non-gastrointestinal dosage form or a gastrointestinal dosage form.
17. The product according to claim 16, characterized in that The medicine also includes one or more pharmaceutically acceptable excipients.
18. The product according to claim 15, characterized in that The medical devices include medical equipment and medical consumables.
19. The product according to claim 15, characterized in that The health care product also includes conventional supplementary materials for health care products.
20. The product according to claim 15, characterized in that The cosmetics include cleansers, toners, lotions, creams, essences, masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foams, patches, makeup powders, cotton pads, eye essences, eye masks, eye shadows, eye gels or eye creams.
21. The product according to claim 15, characterized in that The preservatives include food preservatives or cosmetic preservatives.
22. The product according to claim 21, characterized in that The food preservative is used for human food or animal food.
Citation Information
Patent Citations
A biological defensin and its application
CN114262363B
A recombinant biological defense fusion protein and its application
CN117024604B
Intelligent engineering bacterium system, preparation thereof and application of intelligent engineering bacterium system in anti-tumor drugs
CN115960936A
Antibacterial peptide with antibacterial and antiviral effects as well as application and product thereof
CN120136978A
Short bioactive peptides and methods for their use
US20030109452A1
Cited By
Antibacterial peptide with antibacterial and antiviral effects as well as application and product thereof
CN120136978A
Antibacterial peptide with antibacterial and antiviral effects, and application and product thereof
CN120136978B